Use of fusion gene TVP23C-CDRT4 as a biomarker for benzo[g,h,i]perylene exposure

By screening and identifying the fusion gene TVP23C-CDRT4 as a biomarker for benzo[g,h,i]perylene exposure, the problems of assessing exposure risk and providing therapeutic targets were solved, enabling effective assessment of benzo[g,h,i]perylene exposure risk and mitigation of cell damage.

CN119736388BActive Publication Date: 2026-03-20GUANGZHOU MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411669120.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-21
Publication Date
2026-03-20
Estimated Expiration
2044-11-21

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology to assess the exposure risk of exogenous chemical benzo[g,h,i]perylene to cells or organisms and the resulting risk of malignant transformation, and there is a lack of corresponding biomarkers and therapeutic targets.

Method used

The fusion gene TVP23C-CDRT4 was screened and identified using transcriptomics and bioinformatics techniques as a biomarker for benzo[g,h,i]perylene exposure, providing reagents for detection, inhibition, and overexpression to assess exposure risk and mitigate cell damage.

Benefits of technology

It provides tools for assessing the risk of exposure to benzo[g,h,i]perylene and the risk of malignant transformation, reduces DNA damage, and provides therapeutic targets, which has important scientific and practical significance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736388B_ABST
    Figure CN119736388B_ABST
Patent Text Reader

Abstract

The application discloses application of a fusion gene TVP23C-CDRT4 as an external chemical substance benzo[g,h,i]perylene exposure biomarker in evaluating exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or risk of malignant transformation caused by benzo[g,h,i]perylene exposure. The application screens the fusion gene TVP23C-CDRT4 with a reduced expression level in a poisoned cell exposed to benzo[g,h,i]perylene by using a transcriptome technology, and experiments speculate that the gene is involved in a process of cell DNA damage caused by benzo[g,h,i]perylene exposure, so that the gene can be used as a benzo[g,h,i]perylene exposure biomarker. The application provides help for in-depth understanding of the role of the fusion gene in a mechanism of malignant transformation of cells or organisms caused by an external chemical substance, and has significant value in the fields of environmental health research and disease prevention.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and more particularly relates to the application of fusion gene TVP23C-CDRT4 as a benzo[g,h,i]perylene exposure biomarker. BACKGROUND

[0002] Exogenous chemicals, including air pollutants, pesticides, heavy metals and plastic additives, exist widely in the environment and life, enter the human body through air, water and food, and long-term exposure to cells can cause a series of health problems, including cancer, endocrine disruption, immune system damage and nervous system diseases, and the pathogenesis shows complex interaction of multiple pathways, including gene mutation, oxidative stress, abnormal activation of cell signaling pathway and inflammation. At present, the research on the carcinogenic (malignant transformation) mechanism of exogenous chemicals mainly focuses on DNA sequence changes (such as gene mutation), chromosome number (such as polyploidy and aneuploidy) and structural abnormalities (such as chromosome cross-linking) and other aspects. Genomic instability can cause chromosomal rearrangement, deletion and translocation, etc., so that two genes are fused in whole or part, resulting in fusion genes, which suggests that fusion genes may be a new biomarker for exogenous chemicals to induce cancer (malignant transformation), and screening and identifying fusion genes by reliable technology has important scientific and practical significance for revealing the exposure risk of exogenous chemicals, evaluating their health effects and developing prevention and treatment strategies. However, the research on fusion gene mutation is just beginning and progresses slowly. In the article "Transcriptomic insights into adenoid cystic carcinoma via RNA sequencing", the high expression of fusion gene TVP23C-CDRT4 is related to adenoid cystic carcinoma ACC, but there is no related report on its application as an exogenous chemical exposure biomarker. SUMMARY

[0003] The present application aims to overcome the above-mentioned defects and deficiencies in the prior art, and provides the application of fusion gene TVP23C-CDRT4 as an exogenous chemical benzo[g,h,i]perylene exposure biomarker in evaluating the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure.

[0004] The second object of the present application is to provide the application of a reagent for detecting the expression level of fusion gene TVP23C-CDRT4 in the preparation of a product for evaluating the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure.

[0005] A third objective of this invention is to provide an agent that promotes the overexpression of the fusion gene TVP23C-CDRT4 or its highly specific fragment in the preparation of products that alleviate cell damage caused by benzo[g,h,i]perylene exposure.

[0006] A fourth objective of this invention is to provide an agent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 in the preparation of a malignantly transformed cell model induced by the exogenous compound benzo[g,h,i]perylene.

[0007] The above-mentioned objective of this invention is achieved through the following technical solution:

[0008] This invention uses transcriptomics and bioinformatics techniques to screen and identify a fusion gene, TVP23C-CDRT4, which is a biomarker of exposure to the polycyclic aromatic hydrocarbon compound benzo[g,h,i]perylene. The specific process is as follows: ① RNA-seq was used to sequence human lung bronchial epithelial cells exposed to benzo[g,h,i]perylene for 2 weeks to obtain RNA sequencing data; ② Quality control management was performed on the RNA sequencing data; ③ The fusion transcript was predicted and its carcinogenicity was calculated; ④ Benzo[g,h,i]perylene-specific chimeric RNAs for lung cancer were screened; ⑤ The presence and expression level of the chimeric RNAs were verified; ⑥ The function of the fusion gene was identified. Experimental results showed that the expression level of the fusion gene TVP23C-CDRT4 was reduced in cells and mice subacutely exposed to benzo[g,h,i]perylene; the expression level of the fusion gene TVP23C-CDRT4 was also reduced in malignant transformed cells chronically exposed to benzo[g,h,i]perylene, and the expression level of the fusion gene TVP23C-CDRT4 gradually decreased with the increase of passage number.

[0009] Therefore, this invention provides the application of the fusion gene TVP23C-CDRT4 as a biomarker of exposure to the exogenous chemical benzo[g,h,i]perylene in assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0010] In occupational exposure assessments, for workers in industries such as chemicals, regularly detecting the expression of the aforementioned fusion genes in their cells can monitor their exposure to the polycyclic aromatic hydrocarbon compound benzo[g,h,i]perylene, providing a basis for occupational health protection. In environmental health studies, for residents living in polluted areas (such as near chemical industrial parks), detection of these fusion genes can help assess the long-term effects of the environmental chemical benzo[g,h,i]perylene, particularly the assessment of carcinogenic risks.

[0011] Further, the organism includes but is not limited to human, mouse, cow, horse, etc.

[0012] The application also provides use of a reagent for detecting expression level of the fusion gene TVP23C-CDRT4 in the preparation of a product for evaluating exposure risk of a cell or organism to benzo[g,h,i]perylene or risk of malignant transformation caused by benzo[g,h,i]perylene exposure, wherein the nucleotide sequence of the TVP23C-CDRT4 is shown as SEQ ID No. 1.

[0013] Further, the reagent for detecting expression level of the fusion gene TVP23C-CDRT4 is a real-time fluorescent quantitative PCR primer, and the nucleotide sequences thereof are shown as SEQ ID No. 2-3 in sequence.

[0014] Further, the detection of expression level of the fusion gene TVP23C-CDRT4 is used to evaluate the degree of exposure of a cell or organism to benzo[g,h,i]perylene.

[0015] After overexpression of TVP23C-CDRT4 in normal human lung bronchial epithelial cells BEAS-2B, it is found by comet assay that the percentage of comet tail DNA content, comet tail length and comet Olive tail moment of the cells after overexpression of TVP23C-CDRT4 are significantly lower than those of the normal control group, indicating that overexpression of TVP23C-CDRT4 can reduce DNA double-strand breaks and reduce DNA damage. However, the comet assay results show that there is no statistical difference in the percentage of comet tail DNA content, comet tail length and comet Olive tail moment of the cells after knockdown of TVP23C-CDRT4 in the cells overexpressing TVP23C-CDRT4 compared with the normal control group. The above results suggest that TVP23C-CDRT4 is involved in the process of DNA damage caused by benzo[g,h,i]perylene exposure. Therefore, the fusion gene TVP23C-CDRT4 can also be used as a therapeutic target for cell damage caused by benzo[g,h,i]perylene exposure.

[0016] Based on this, the application provides use of a reagent for promoting overexpression of the fusion gene TVP23C-CDRT4 or a high-specificity fragment thereof in the preparation of a product for alleviating cell damage caused by benzo[g,h,i]perylene exposure, wherein the nucleotide sequence of the TVP23C-CDRT4 is shown as SEQ ID No. 1.

[0017] Further, the nucleotide sequence of the high-specificity fragment of the fusion gene TVP23C-CDRT4 is shown as SEQ ID No. 7.

[0018] Further, the cell damage is DNA breakage in the cell.

[0019] Further, the product is a kit or a test paper.

[0020] The application also provides use of a reagent for inhibiting expression level of a fusion gene TVP23C-CDRT4 in preparation of a malignant transformation cell model caused by an external compound benzo[g,h,i]perylene, wherein the nucleotide sequence of the TVP23C-CDRT4 is shown as SEQ ID No. 1.

[0021] Further, the reagent for inhibiting expression level of the fusion gene TVP23C-CDRT4 is siRNA, and the nucleotide sequences are shown as SEQ ID No. 4-6.

[0022] Compared with the prior art, the application has the following beneficial effects:

[0023] The application provides use of a fusion gene TVP23C-CDRT4 as an exposure biomarker of an external chemical substance benzo[g,h,i]perylene in evaluation of exposure risk of a cell or organism in a benzo[g,h,i]perylene environment or risk of malignant transformation caused by benzo[g,h,i]perylene exposure. The application screens and identifies a benzo[g,h,i]perylene exposure biomarker, the fusion gene TVP23C-CDRT4, based on transcriptomics and bioinformatics technologies. Experimental verification shows that the expression level of the fusion gene TVP23C-CDRT4 is reduced in a cell and a mouse exposed to benzo[g,h,i]perylene sub-chronically, and the expression level of the fusion gene TVP23C-CDRT4 is also reduced in a malignant transformation cell exposed to benzo[g,h,i]perylene chronically, and the expression level of the fusion gene TVP23C-CDRT4 gradually reduces with an increase in the number of passages, and it is inferred that the gene participates in a process of DNA damage induced by benzo[g,h,i]perylene exposure. Therefore, the fusion gene TVP23C-CDRT4 can be used as a benzo[g,h,i]perylene exposure biomarker. The application provides a solid foundation for in-depth understanding of the role of the fusion gene in a mechanism of malignant transformation of a cell or organism caused by an external chemical substance, has significant value in the fields of environmental health research and disease prevention and treatment, and has important significance for public health and environmental science. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a result graph of agar gel electrophoresis experiment.

[0025] Figure 2 It is a result graph of Sanger sequencing.

[0026] Figure 3 It is a schematic diagram of the fusion gene TVP23C-CDRT4.

[0027] Figure 4Expression level of fusion gene TVP23C-CDRT4 in malignant transformation (chronic) cell model exposed to benzo[g,h,i]perylene.

[0028] Figure 5 Expression level of fusion gene TVP23C-CDRT4 in malignant transformation (chronic) cell model exposed to benzo[g,h,i]perylene.

[0029] Figure 6 Expression level of fusion gene TVP23C-CDRT4 in subacute poisoning (acute) mouse model exposed to benzo[g,h,i]perylene.

[0030] Figure 7 Results of constructing fusion gene TVP23C-CDRT4 overexpression cell model.

[0031] Figure 8 Results of comet assay after overexpressing fusion gene TVP23C-CDRT4.

[0032] Figure 9 Results of comet assay after knocking down fusion gene TVP23C-CDRT4 in overexpressing fusion gene TVP23C-CDRT4. DETAILED DESCRIPTION

[0033] The present application will be further described by the following description and examples with reference to the accompanying drawings, however, the examples do not limit the present application in any manner. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0034] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0035] 1. Cell lines, experimental animals and test substances

[0036] Human lung bronchial epithelial cells BEAS-2B were purchased from American Type Culture Collection (ATCC). Experimental animals BALB / c mice were purchased from Guangdong Experimental Animal Center, and all animals were approved by the Animal Ethics Committee of Guangzhou Medical University (Approval No. GY2024-036). Benzo[g,h,i]perylene standard was purchased from Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0037] 2. Main reagents

[0038] 2.1 Cell culture: DMSO (MP Biomedicals, USA), fetal bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd.), MEM medium, PBS buffer (Zhejiang Senrui Biological Technology Co., Ltd.), DMEM / F12 medium (Gibco, USA), 0.25% trypsin containing 0.02% EDTA (Guangzhou Jingxin Biological Technology Co., Ltd.). Cells were cultured in a humidified incubator at 37°C with 5% CO2.

[0039] 2.2 Total RNA extraction: anhydrous ethanol (Guangzhou Xincheng Fine Chemical Co., Ltd.), isopropanol, chloroform (Guangzhou Chemical Reagent Factory), TRIzol Reagent lysis buffer (Thermo Fisher Scientific, USA), 75% ethanol (Shandong Lierkang Co., Ltd.).

[0040] 2.3 Reverse transcription of RNA and qRT-PCR experiment: qPCR Master Mix, GoScript TM Reverse Transcription System (Promega, USA).

[0041] 2.4 Agarose gel electrophoresis: nucleic acid red NA-Red (Biuntian, Guangzhou, China), 5×TBE electrophoresis buffer, 50bp Ladder DNA Marker (Guangzhou Jingxin Biological Technology Co., Ltd.), and normal melting point agarose (Guangzhou Yisheng Technology Co., Ltd.).

[0042] 3. Main instruments

[0043] LS-75HD vertical pressure steam sterilizer (China Jiangyin Binjiang Company), high-temperature constant-temperature air drying oven (China Shanghai Fomar Company), ultrapure water system (millipore), super-clean workbench (Thermo Fisher Scientific, USA), cell incubator (Thermo Fisher Scientific, USA), CoolCell program cooling box (Biocision, USA), -80℃ ultra-low temperature refrigerator (Thermo Fisher Scientific, USA), liquid nitrogen tank (Sichuan Leshan Company, China), electric heating constant-temperature water bath (Suzhou Changfeng Company, China), low-speed centrifuge (ScanSpeed), ice maker (SANYO), BSA124S analytical balance (Sartorius), durable low-temperature operation platform module (Biocision, USA), inverted microscope (Nikon), refrigerator (Haier, Samsung), Heraeus Fresco 17 refrigerated centrifuge (Thermo Fisher Scientific, USA), LX-300 mini centrifuge (Xilinbailai), VORTEX-5 vortex mixer (Xilinbailai), electrophoresis power supply (Bio-Rad), horizontal electrophoresis tank (Bio-Rad), BLT GV1500 Pro full-automatic gel imaging system and Gel View 6000 high-sensitivity chemiluminescence imaging system (Guangzhou Bolvteng Company, China), Epoch multifunctional microplate reader (Bio-Tek, USA), micropipette and matching consumables (Eppendorf, Germany), 10cm culture dishes (Eppendorf, Germany), 6cm culture dishes (Corning, USA), 15mL and 50mL centrifuge tubes (Corning, USA), 0.2mL, 1.5mL, 2mL EP tubes and 0.2mL eight-row flat-cap thin-walled tubes (Axygen, USA), HOPE-MED 8052H single-concentration oral-nasal inhalation exposure system (Hechuangkang, Tianjin Development Zone, China).

[0044] 4. Main solution preparation

[0045] 4.1 Complete medium containing 5% fetal bovine serum: fetal bovine serum (Shanghai Sijiqing Company) was added to MEM medium (Hyclone, USA) and DMEM / F12 medium (Hyclone, USA) respectively to prepare complete medium containing 5% fetal bovine serum, which was stored in the refrigerator at 4℃ for standby.

[0046] 4.2 Cell cryopreservation solution: DMSO and fetal bovine serum were mixed at a volume ratio of 1:9 and stored in the refrigerator at 4℃ for standby.

[0047] 4. 3TBE electrophoresis buffer: add 1200 mL of pure water to a beaker, add 300 mL of 5x TBE electrophoresis buffer, mix well, prepare 1500 mL of 1x TBE electrophoresis buffer, and store at room temperature.

[0048] Example 1 Total RNA extraction

[0049] According to the experimental scheme, the cells were exposed to exogenous chemicals. After exposure to exogenous chemicals, the treated cell samples (human lung bronchial epithelial cells BEAS-2B) were gently collected using an RNase-free tool, and then total RNA was extracted.

[0050] Subacute exposure model: DMSO was used to dissolve the benzo[g,h,i]perylene (BghiP) analysis standard, and the BghiP concentration gradient was set to 0, 5, 50, 500 and 5000 ng / mL. After 24 h of exposure, the appropriate exposure concentration was determined, and a time gradient exposure (0, 1, 2, 3 and 4 w) was performed on human lung bronchial epithelial BEAS-2B cells. The volume fraction of DMSO was 0.1% to control the effect of the solvent on the cells. According to the results of the pre-experiment, 500 ng / mL BghiP was selected for continuous exposure of BEAS-2B cells for 2 w to construct a subacute exposure model, and the first generation of exposed cells was selected for subsequent experiments.

[0051] Progressive (chronic) model: DMSO was used to dissolve the benzo[g,h,i]perylene (BghiP) analysis standard, and 50 ng / mL of benzo[g,h,i]perylene was obtained. Human lung bronchial epithelial BEAS-2B cells were exposed and continuously exposed to subculture to obtain a progressive cell strain. The cell strain was deposited with the Guangdong Microbial Culture Collection Center on June 27, 2024, and the deposit number is GDMCC No: 64810.

[0052] Control group: BEAS-2B cells exposed to 0.1% DMSO for 2 w were selected to construct a control group model, and the first generation of exposed cells was selected for subsequent experiments.

[0053] 1. Total RNA extraction

[0054] (1) Cell collection: After the cells grew to a confluence of more than 70%, they were washed with PBS twice, 1 mL of Trizol reagent was added, and the Trizol was blown for 4 min to make it fully contact with the cells and digest them. Then, the cells were placed in a 1.5 mL EP tube.

[0055] (2) Cell extraction: Add 200 μL of chloroform to the Trizol suspension containing cells, shake vigorously for 30 seconds, let stand for 10 minutes, centrifuge at 4°C and 12000 rcf for 15 minutes, and then use a 200 μL pipette to aspirate 400 μL of supernatant into a new 1.5 mL EP tube. Discard the rest.

[0056] (3) Cell pellet: Add 400 μL of isopropanol at a 1:1 ratio. Gently invert the container 10 times to mix, label the group information, and let stand for 10 min. Centrifuge at 4℃ and 12000 rcf for 10 min, discard the supernatant, and retain the RNA pellet.

[0057] (4) RNA washing: Add 1 mL of pre-cooled 75% ethanol, vortex, and centrifuge at 4°C and 12000 rcf for 5 min. Discard the supernatant. Add another 1 mL of pre-cooled anhydrous ethanol, vortex, and centrifuge at 4°C and 12000 rcf for 5 min. Discard the supernatant.

[0058] (5) RNA dissolution: Invert the EP tube containing cell pellet onto filter paper, air dry for 10 min, add 15 μL of enzyme-free water, mix well, and store at -80℃ for later use.

[0059] (6) RNA detection: Take 1.8 μL of dissolved RNA sample, and use 1.8 μL of enzyme-free water as a blank control to detect RNA concentration and quality. OD 260 / OD 280 A value between 1.8 and 2.0 indicates that the RNA quality is acceptable. The closer the value is to 2.0, the better the quality. A value below 1.8 indicates that the quality is unacceptable and the sample should be discarded.

[0060] Example 2: Transcriptome Sequencing and Bioinformatics Analysis

[0061] I. Experimental Methods

[0062] 1. Experimental Design and Sample Preparation

[0063] The RNA extracted in Example 1 (subacute exposure (acute) group and control group) was subjected to transcriptome sequencing, and the sequencing results were provided by Beijing Biomarker Biotechnology Co., Ltd.

[0064] 2. RNA-seq data sequencing

[0065] Total RNA extracted must undergo quality control and library construction before high-throughput sequencing. RNA-seq is performed using a sequencing platform to generate raw sequence data. The sequenced data is stored in FASTQ format, which includes sequence information and corresponding quality information. This ensures high-quality and sufficient coverage of the sequencing data, providing a reliable data foundation for subsequent analysis stages.

[0066] 3. Quality Assessment

[0067] Quality Assessment Each FASTQ file is subjected to quality assessment using FastQC (v0.11.9) software, producing a detailed quality assessment report. The report contains multiple key indicators, such as sequence quality distribution, adapter contamination, and GC content distribution, which help identify potential issues. Through the report's red, yellow, and green icons, one can quickly determine whether each indicator is acceptable. When all indicators are green (indicating acceptance), the data can proceed to the next analysis stage; otherwise, if any indicator is not acceptable, the FASTQ file needs to be corrected or the sample that failed quality control needs to be removed.

[0068] 4. Data Preprocessing

[0069] Preprocessing The FASTQ files that pass the quality assessment are preprocessed using Trimmomatic (v0.39). This step includes identifying and trimming adapter sequences to ensure that adapters do not interfere with sequence alignment. At the same time, reasonable quality and length filtering criteria are set to filter out low-quality or shorter-than-threshold reads, ensuring that the data used in subsequent analysis is more accurate and reliable.

[0070] 5. Sequence Alignment

[0071] Alignment The processed FASTQ-format reads are aligned to the human reference genome (GRCh38) using STAR (v2.7.8a) software. STAR is fast and efficient, capable of processing large amounts of data in a short time while ensuring the accuracy of the alignment results. The alignment results will be output in BAM format, laying a solid foundation for subsequent fusion transcript analysis.

[0072] 6. Fusion Transcript Prediction

[0073] Next, STAR-Fusion (v1.10.0) is used to analyze the alignment results generated by STAR to predict possible fusion transcripts. This step aims to identify any gene rearrangements that may have been caused by exposure to exogenous chemicals, and the generated data will help with subsequent malignant transformation analysis.

[0074] 7. Carcinogenicity Analysis

[0075] After obtaining the fusion transcripts, DEEPrior software is used to analyze the results generated by STAR-Fusion in depth. This software calculates the probability of each fusion transcript having a carcinogenic mutation or activating a carcinogenic pathway, helping to assess the potential carcinogenicity of each fusion gene and providing scientific evidence for understanding the role of exogenous chemicals in the carcinogenic process.

[0076] 8. Data integration and filtering

[0077] After completing the carcinogenicity analysis, the "ComplexUpset" package in R was used to perform an intersection analysis on all the results. This step integrates the results from each experiment, screening for specific fusion genes associated with exogenous chemicals, and further focusing on finding targets with the potential to become biomarkers.

[0078] II. Experimental Results

[0079] STAR-Fusion identified 22 chimeric RNAs. Based on the difference in chimeric RNA expression levels between the control group (DMSO exposure) and the experimental group (subacute exposure (acute) group), TVP23C-CDRT4 was selected.

[0080] Example 3: Fusion Gene Verification

[0081] I. Experimental Methods

[0082] 1. Reverse transcription

[0083] Using GoScript TM The Reverse Transcription System kit was used to reverse transcribe the RNA extracted in Example 1 into cDNA. The first step reaction mixture was prepared as follows: 8 μL of RNA sample, 1 μL of Oligo(dT) Primer, and 1 μL of Random Primer were added to a 200 μL EP tube and mixed thoroughly. The mixture was then denatured at 70°C for 5 min using a multi-functional gradient thermal cycler, followed by incubation at 4°C for 5 min.

[0084] Prepare the reaction mixture for the second step: 0.5 μL Recombinant Rnasin Ribonuclease Inhibitor, 1 μL PCR Nucleotide Mix (10 mmol / L), 1 μL GoScript™ Reverse Transcriptase, 2 μL MgCl2 (25 mmol / L), 4 μL GoScript™ 5× Reaction Buffer, and 1.5 μL Nuclease-Free Water are mixed thoroughly. Add 10 μL of the mixture to the denatured solution and cycle using a multi-functional gradient thermal cycler: 25°C for 5 min; 42°C for 60 min; 70°C for 15 min; and cool at 4°C. Store the cDNA sample at -20°C.

[0085] 2. Conventional PCR

[0086] use qPCR Master Mix kit to verify the presence of chimeric RNA, configured in a 20 μL reaction system: 7.2 μL of enzyme-free water, 0.4 μL of forward primer (10 μmol / L), 0.4 μL of reverse primer (10 μmol / L), 10 μL of qPCR Master Mix, and 2 μL of sample cDNA were mixed uniformly in a 200 μL EP tube. The EP tube was placed in a multifunctional gradient thermal cycler, and the following thermal cycles were performed: 50 °C reverse transcription for 10 min (1 cycle), 95 °C pre-denaturation for 2 min (1 cycle); 95 °C, 15 s, then converted to 60 °C for 1 min, and then 72 °C for 1 min (40 cycles); and finally, 72 °C for 10 min for amplification. The primers for TVP23C-CDRT4 were as follows:

[0087] Forward primer (5'-3'): ACTGTGTCAGAGGCTGAATCAAGAA

[0088] Reverse primer (5'-3'): CACAGGTTCAGATTCCAGCCACTT

[0089] 3. Agarose gel electrophoresis and Sanger sequencing

[0090] 2.0 g of normal melting point agarose powder was weighed using an electronic balance, 100 mL of 1 × TBE electrophoresis buffer was added, and the mixture was heated in a microwave oven for 90 s. After the agarose powder was completely dissolved and boiled, 100 μL of NA-Red dye was added and mixed. The mixture was poured into a mold, 100 uL of a syringe was used to remove air bubbles, and a comb was inserted. The gel was left to stand at room temperature for 30 min. After the comb was removed, the gel was placed in a horizontal electrophoresis tank, the hole end was placed on the black electrode, and 1 × TBE electrophoresis buffer was added. 4 μL of 6 × DNA loading buffer and 20 μL of RT-PCR product were mixed and added to the hole, and 10 μL of 50 bp Ladder DNA Marker was added on both sides. The gel was electrophoresed at a constant voltage of 100 V for 50 min. The gel was placed on a UV Tray ultraviolet excitation plate, and a photograph was taken using a full-automatic dye-free gel imaging system. The length of the chimeric RNA was confirmed by agarose gel electrophoresis. The PCR unpurified product and the chimeric RNA forward and reverse primers were sent to GenScript Biotech (Shanghai) Co., Ltd., which completed the Sanger sequencing.

[0091] 4. Quantitative reverse transcript-polymerase chain reaction (qRT-PCR experiment)

[0092] use The qPCR Master Mix kit was used for experiments, and the reaction mixture was prepared in 20 μL volumes: 7 μL of enzyme-free water, 0.2 μL of C×R, 0.4 μL of forward primer (10 μmol / L), 0.4 μL of reverse primer (10 μmol / L), and 10 μL of [unspecified ingredient] were added to each eight-tube container. Mix qPCR Master Mix and 2 μL of sample cDNA thoroughly. Place the eight-tube strips in the PCR instrument and perform pre-denaturation at 95°C for 10 min (one cycle); then amplify at 95°C for 15 s, followed by holding at 60±3°C for 1 min (40 cycles), entering the melting curve stage. -ΔΔCt The method involves calculating the fold change in differential expression based on the GAPDH internal reference gene, where ΔCt = Cttargetgene - Ctinternal referencegene, and ΔΔCt = ΔCtexperimentalgroup - ΔCtcontrolgroup. The fold change in differential expression of the target gene between the experimental group and the control group is 2. -ΔΔCt The gene primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd., and the primer design is as follows:

[0093] GAPDH:

[0094] Forward primer (5'-3'): ACAGTCAGCCGCATCTTCTT

[0095] Reverse primer (5'-3'): GACTCCGACCTTCACCTTCC

[0096] TVP23C-CDRT4:

[0097] Forward primer (5'-3'): ACTGTGTCAGAGGCTGAATCAAGAA

[0098] Reverse primer (5'-3'): CACAGGTTCAGATTCCAGCCACTT

[0099] II. Experimental Results

[0100] 1. The results of the agarose gel electrophoresis experiment are as follows: Figure 1 As shown, TVP23C-CDRT4 exhibited specific bands in both subacute benzo[g,h,i]perylene exposure and malignant transformation cell models; Sanger sequencing results are as follows. Figure 2 As shown, TVP23C-CDRT4 is formed by the fusion of the parental genes TVP23C and CDRT4. The schematic diagram of TVP23C-CDRT4 is shown below. Figure 3 As shown.

[0101] 2. Expression level analysis of TVP23C-CDRT4

[0102] (1) Expression level of TVP23C-CDRT4 in subacute (acute) cell model As shown in Table 1, it is indicated that in the subacute cell model of benzo[g,h,i]perylene, the expression level of TVP23C-CDRT4 in the benzo[g,h,i]perylene group was significantly lower than that in the control group. Figure 4

[0103] (2) Expression level of TVP23C-CDRT4 in malignant transformation (chronic) cell model As shown in Table 2, it is indicated that in the malignant transformation cell model of benzo[g,h,i]perylene, the expression level of TVP23C-CDRT4 gradually decreased significantly with the increase of the number (degree) of benzo[g,h,i]perylene exposure compared with the control group. Figure 5

[0104] Example 4 Effect of benzo[g,h,i]perylene exposure on mouse TVP23C-CDRT4

[0105] I. Experimental methods

[0106] 1. Experimental animals and grouping

[0107] Sixteen 3-4 week old SPF BALB / c mice, half male and half female, were purchased and acclimated for one week after quarantine. They were randomly divided into a control group and a benzo[g,h,i]perylene exposure group, with four males and four females in each group.

[0108] 2. Setting of exposure conditions

[0109] According to the conversion formula for internal and external exposure doses in respiratory toxicology and the description of exposure concentration in the subacute cell model in Example 1, 500 μg / m 3 was selected as the exposure concentration for mice. After one week of adaptation at this concentration, the mice were in good condition, so this concentration was selected as the final exposure concentration, and a DMSO solvent control group was set up. Meanwhile, referring to the exposure condition setting for in vivo subacute inhalation toxicity experiments in international standards and guidelines (OECD TG 412), the exposure time and frequency were set to 28 days, 6 h / day, 7 d / week. The growth status of the mice was observed during the exposure period.

[0110] 3. Collection of mouse lung tissue and extraction of total RNA from lung tissue

[0111] After the exposure was completed, the mice were sacrificed by decapitation and the mouse lung tissue was collected and stored at -80°C for later use. About 20 mg of lung tissue was added to 1 mL of Trizol solution and thoroughly ground using a tissue grinder. The subsequent extraction of total RNA from mouse lung tissue was consistent with the extraction method of total RNA from cells in Example 1.​​

[0112] 4. Detection of expression level of TVP23C-CDRT4 in mouse lung tissue

[0113] After the total RNA of lung tissue of mouse model was extracted, reverse transcription and qRT-PCR experiment was performed according to the experimental method in Example 3 to detect the expression level of TVP23C-CDRT4.

[0114] II. Experimental results

[0115] The expression level of TVP23C-CDRT4 in the mouse model is shown in Figure 6 As shown in the table, the expression level of TVP23C-CDRT4 in the mouse exposed to benzo[g,h,i]perylene is significantly reduced compared with the Control group.

[0116] Example 5 Functional analysis of TVP23C-CDRT4

[0117] I. Experimental method

[0118] 1. Construction and transfection method of TVP23C-CDRT4 overexpression vector

[0119] The virus was dissolved in a beaker in an ice bath overnight, and the MOI was set to 200 according to the recommended instructions. The blank control group (Control) was set to only complete medium for culturing cells. The negative control group (Vector) was set to add negative vector virus liquid, complete medium and 4 μg / mL puromycin. The overexpression TVP23C-CDRT4 group (OE-TC) was set to add overexpression target virus liquid, complete medium and 4 μg / mL puromycin. Each group was repeated twice.

[0120] 40000 cells (human lung bronchial epithelial cells BEAS-2B) were inoculated in a 24-well plate and cultured in a constant temperature incubator for 24 h for virus infection. The virus volume was calculated according to the virus titer, and the virus volume = (MOI x cell number) / virus titer. 20 μL of HiTransG P liquid and the calculated virus volume were added to a 1.5 mL EP tube, and complete medium was added to a final volume of 500 μL and mixed uniformly. The 24-well plate was taken out, and the complete medium was discarded. After washing twice with PBS buffer, the virus infection liquid was added. After 24 h of infection, the culture medium was discarded, and complete medium was added for 24 h. Puromycin with a concentration of 4 μg / mL was added, and continuous culture was carried out for 2 weeks. Under a microscope, it was observed that the cells had GFP fluorescence. qRT-PCR experiment was used to detect the infection effect. The vector was constructed by Shanghai Jikai Gene Co., Ltd.

[0121] 2. Construction method and transfection method of TVP23C-CDRT4 knockdown vector

[0122] Inoculate 200,000 cells (TVP23C-CDRT4-overexpressing cells OE-TC obtained in step 1) treated according to the experimental design into each well of a 6-well plate to perform a transfection experiment, and set up Si-1 group, Si-2 group, Si-3 group, negative control siRNA (Negative control, NC group), and Control group. Add 2 mL serum-free medium to the Control group, add 245 μL of serum-free medium to an EP tube, add 5 μL of siRNA corresponding to the group, mix well, and incubate for 5 min. Mix 250 μL of serum-free medium and LipofectamineTM2000 diluent at a ratio of 50:1, blow well, and add to the EP tube, and incubate at room temperature for 25 min. Add 500 μL of the mixed solution to the 6-well plate, and incubate in a constant-temperature incubator for 24 h, then replace with complete medium and continue to incubate for 24 h. siRNA kits are provided by Guangzhou Ribobio Biotechnology Co., Ltd. serum-free medium and LipofectamineTM2000 diluent at a ratio of 50:1, blow well, and add to the EP tube, and incubate at room temperature for 25 min. Add 500 μL of the mixed solution to the 6-well plate, and incubate in a constant-temperature incubator for 24 h, then replace with complete medium and continue to incubate for 24 h. siRNA kits are provided by Guangzhou Ribobio Biotechnology Co., Ltd.

[0123] si-h-TVP23C-CDRT4_001: GTGGCTGGAATCTGAACCT;

[0124] si-h-TVP23C-CDRT4_002: ACAGTAAAGTGGCTGGAAT;

[0125] si-h-TVP23C-CDRT4_003: AGTAAAGTGGCTGGAATCT.

[0126] 3. Comet experiment

[0127] After washing the glass slide, prepare the first layer of glue, place it on the slide rack, and store it in the 4°C refrigerator for standby. Mix the cell suspension and agarose glue to prepare the second layer of glue, immerse the glass slide in the cell lysis solution to lyse the cells, and after lysis is complete, place it in the electrophoresis tank to unwind, and after unwinding is complete, perform electrophoresis. After electrophoresis, use NA-Red for staining, use fluorescence microscopy to take cell images under a 10x lens, and use CSAP analysis software to analyze DNA damage indicators including comet Olive tail moment, comet tail length, and comet tail DNA content percentage (Tail DNA%).

[0128] II. Experimental results

[0129] 1. The results of overexpression of TVP23C-CDRT4 are as shown in Figure 7 ​As shown, it indicates that both the Vector control and the overexpression chRNA TVP23C-CDRT4 group (OE-TC) express green fluorescence, and the expression level of TVP23C-CDRT4 in the OE-TC group is significantly higher than that in the Control and Vector groups, and the cell strain overexpressing TVP23C-CDRT4 is successfully constructed.

[0130] 2. The results of comet assay after overexpression of TVP23C-CDRT4 are as shown in Figure 8 As shown, it indicates that the percentage of comet tail DNA content, comet tail length and comet Olive tail moment of the OE-TC group are significantly lower than those of the Control and Vector groups, and after overexpression of TVP23C-CDRT4, DNA double-strand breaks are reduced and DNA damage is decreased.

[0131] 3. The results of comet assay after knockdown of TVP23C-CDRT4 in overexpression of TVP23C-CDRT4 are as shown in Figure 9 As shown, it indicates that the percentage of comet tail DNA content, comet tail length and comet Olive tail moment of the OE-TC+Si-TC group have no statistical difference compared with the Control group, indicating that TVP23C-CDRT4 is involved in the process of DNA damage caused by benzo[g,h,i]perylene exposure.

[0132] Therefore, the fusion gene TVP23C-CDRT4 can also be used as a therapeutic target for cell damage caused by benzo[g,h,i]perylene exposure.

Claims

1. The application of a reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 in the preparation of products for assessing the risk of malignant transformation of cells or organisms due to benzo[g,h,i]perylene exposure, characterized in that, The nucleotide sequence of TVP23C-CDRT4 is shown in SEQ ID No. 1; the reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 is a real-time quantitative PCR primer, the nucleotide sequences of which are shown in SEQ ID No. 2 to 3.

2. The application according to claim 1, characterized in that, The detection of the expression level of the fusion gene TVP23C-CDRT4 is used to assess the degree of exposure of cells or organisms to benzo[g,h,i]perylene.

3. The application according to any one of claims 1 to 2, characterized in that, The product is a reagent kit or test strip.

Citation Information

Patent Citations

  • CeRNA regulation and control network of biomarker for identifying acute myocardial infarction and stable angina pectoris and application of ceRNA regulation and control network

    CN116334214A

  • Modulating resistance to BCL-2 inhibitors

    US20220401460A1