Aquaculture common vibrio pathogen Taqman multiple fluorescent quantitative PCR detection system, kit, application and detection method

Abstract

The invention belongs to the technical field of aquatic pathogen diagnosis, and particularly relates to a Taqman multiple fluorescent quantitative PCR (Polymerase Chain Reaction) detection system and kit for common vibrio pathogens in aquaculture as well as application and a detection method. The system comprises primers and probes for detecting four common vibrio pathogens in aquaculture, the 5'end of each probe is modified with different fluorophores, the 3 'end of each probe is modified with corresponding quenching groups, and the common vibrio pathogens comprise vibrio anguillarum Va, vibrio alginolyticus Val, vibrio harveyi Vh and vibrio scophthalmi Vsc.

Description

Technical Field

[0001] The present invention belongs to the technical field of aquatic pathogen diagnosis, and specifically relates to a Taqman multiplex fluorescence quantitative PCR detection system, a kit, and an application and detection method for common Vibrio pathogens in aquaculture (Vibrio anguillarum Va, Vibrio alginolyticus Val, Vibrio harveyi Vh and Vibrio turbot Vsc). Background Art

[0002] With the expansion of factory farming, aquatic diseases have occurred frequently, seriously restricting the development of aquaculture. Vibrio anguillarum , Va), Vibrio alginolyticus ( Vibrio alginolyticus, Val), Vibrio harveyi ( Vibrio harveyi , Vh) and Vibrio maxima ( Vibrio scophthalmi Vsc) is a common pathogen in aquaculture, which can infect a variety of marine fish, such as turbot, flounder, tongue sole, xu's flathead, sea bass, etc., causing huge economic losses to marine economic fish farming. Currently, the commonly used molecular biological and immunological detection methods include ELISA, colloidal gold, PCR, LAMP, etc. Although the above methods have strong specificity, they all have their own disadvantages, such as low sensitivity of immunological methods, the need to prepare specific monoclonal antibodies, and difficulty in achieving multiple detections. Although the existing molecular biological detection methods have high sensitivity and strong specificity, they are mainly aimed at single pathogen detection, and the potential for promotion and application is limited. Therefore, it is very necessary to establish a rapid, sensitive, and specific detection method for clinical use that can simultaneously identify multiple pathogens. Multiplex fluorescence quantitative PCR technology combines the high sensitivity of fluorescence and the high specificity of PCR technology. It can identify and distinguish multiple pathogens in one reaction and can achieve batch operation. At present, there is no report on the application of multiplex fluorescence quantitative PCR technology in the identification of the above bacteria. Summary of the invention

[0003] The present invention aims to provide a Taqman multiplex fluorescence quantitative PCR detection system, a kit, an application and a detection method for common Vibrio pathogens in aquaculture (Vibrio anguillarum Va, Vibrio alginolyticus Val, Vibrio harveyi Vh and Vibrio turbot Vsc).

[0004] To achieve the above object, the technical solution adopted by the present invention is: A Taqman multiplex fluorescence quantitative PCR detection system for common Vibrio pathogens in aquaculture, comprising primers and probes for detecting four common Vibrio pathogens in aquaculture, and the 5' end of each probe is modified with a different fluorescent group, and the 3' end is modified with a corresponding quenching group; wherein the common Vibrio pathogens are Vibrio anguillarum Va, Vibrio alginolyticus Val, Vibrio harveyi Vh and Vibrio maxima turbot Vsc.

[0005] The Vibrio anguillarum Va probe and primers are directed against Va ampA Gene, the Val probe and primers of Vibrio alginolyticus are all targeted to Val toxR Gene, Vibrio harveyi Vh probe and primers are targeted to Vh VhhP2 Gene, Vsc probe and primers of turbot Vibrio maxima are targeted to Vsc luxR Gene.

[0006] The Va ampA The gene primers and probes are: Primers: ampA-qF AAGTCCGTTACCAGCAGATG; (sequence 1) ampA-qR CGTAAACTTGGCCGATACCT; (sequence 2) Probe: ampA-P [6-FAM]TCTCAGTTTGCGTTGCTACGACTGAC[BHQ1]; (sequence 3) Val's toxR The gene primers and probes are: Primers: toxR-qF GTGTACCGGTGATGACACCTG; (SEQ ID NO: 4) toxR-qR AATCACTTCAACTGGCAACGAG; (SEQ ID NO: 5) Probe: toxR-P [HEX]CACGTAGCGCTCAATGCATTGCTC[BHQ1]; (SEQ ID 6) Vh VhhR2 The gene primers and probes are: Primers: VhhR2-qF CATCCTAGCTGTTGTTGCAGCT; (SEQ ID NO: 7) VhhR2-qR GTTCCACCATTGACTAACCATTGG; (SEQ ID 8) Probe: VhhR2-P [ROX]TGGGTAAATCGCACGCCTGTTTCGA [BHQ2]; (SEQ ID 9) Vsc luxR The gene primers and probes are: Primers: aprX-qF GTCGTGGTCATGCCGATATT; (SEQ ID NO: 10) aprX-qR ATTAGAGAACTGACGTACCACATAGTTC; (Sequence 11) Probe: aprX-P [Cy5]CAACTACTTCCCAACACGTGAAGAC[BHQ2] (Sequence 12).

[0007] An aquaculture common vibrio pathogen Taqman multiplex fluorescence quantitative PCR detection kit, wherein the kit contains the primers and probes described above.

[0008] The concentrations of the primers and probes in the kit are both 20 µM. The reaction system includes 10 µl of 2×PCR Mix of the reaction solution, 0.3 µl of Va primer, 0.5 µl of Va probe; 0.2 µl of Val primer, 0.6 µl of Val probe; 0.4 µl of Vh primer, 0.5 µl of Vh probe; 0.2 µl of Vsc primer, 0.3 µl of Vsc probe; ultra-pure water + DNA template to make up 20 µl.

[0009] The reaction program is: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 60°C for 30 s, for 40 cycles.

[0010] An application of the detection system or the detection kit described above, the application of the detection system or kit in the multiplex fluorescence quantitative / qualitative detection of common vibrio pathogens in aquaculture.

[0011] A multiplex fluorescence quantitative PCR detection method for common vibrio pathogens in aquaculture, (1) Extraction of total DNA of the sample; (2) Establishing a standard curve using the kit and the positive plasmid corresponding to the common vibrio pathogen in aquaculture for quantitative analysis of the pathogen; (3) Performing a multiplex fluorescence quantitative PCR amplification reaction on the total DNA extracted from the sample using the kit to obtain a PCR amplification curve; (4) Analyzing the results according to the amplification curve.

[0012] If the amplification result is a good "S"-shaped amplification curve and the Cq value ≤ 35, it is determined as positive; if there is no amplification curve and the Cq value > 35, it is determined as negative; if there is an "S"-shaped amplification curve in a certain gene channel of the sample to be tested and 35 < Ct < 40, it is judged as an uncertain sample and the nucleic acid is re-extracted for retesting; in the positive results, the types of the corresponding pathogens in the sample are determined according to the fluorescent pigments corresponding to the amplification curves in different fluorescent channels.

[0013] The present invention has the following advantages: 1. The present invention is based on TaqMan probe technology, which has strong specificity and avoids the generation of false positives; combined with fluorescent quantitative PCR technology, it has high sensitivity.

[0014] 2. The present invention can simultaneously perform differential diagnosis and quantitative detection on four common aquatic Vibrio pathogens, namely Va, Val, Vh and Vsc.

[0015] 3. The present invention is simple to operate, saves detection costs, can meet the needs of large-scale rapid detection of pathogenic bacteria, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The multiplex fluorescence quantitative PCR standard curve provided by the embodiment of the present invention, wherein A, B, C and D represent the standard curves of Va, Val, Vh and Vsc respectively.

[0017] Figure 2 The sensitivity experiment of multiplex fluorescence quantitative PCR provided in the embodiment of the present invention. A, B, C and D represent the sensitivity detection results of Va, Val, Vh and Vsc respectively, and 1-6 represent the standard plasmid concentration of 10 5 -10 0 copies / μL, NC represents negative control.

[0018] Figure 3 This is a multiplex fluorescence quantitative PCR specificity experiment provided in the embodiment of the present invention. 1, 2, 3 and 4 represent Va, Val, Vh and Vsc respectively, 5-13 represent other common aquatic pathogens; NC represents a negative control. DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with the examples. The examples are intended to illustrate the present invention, but are not intended to limit the present invention in any form.

[0020] Example 1 Preparation of positive plasmid standards for strain Va, Val, Vh and Vsc specific genes Step 1) Primer design for different strain-specific genes Va's ampA Gene, Val toxR Gene, Vh VhhP2 Gene and Vsc luxR Gene design primers, the specific primer sequences are as follows: ampA-F: 5- TTATATTGATAGTTATGTGCACTATTAA -3' ampA-R: 5- ACAAAGAAGTCGACTAAATAAACCAT -3' toxR-F: 5-GTGGAACGCTTGAGCCCATT -3' toxR-R: 5- GCGTAGTGGGCCGACAGTAT -3' VhhP2-F: 5- ATGAAGAGAAGGAATCCTCAAGG -3' VhhP2-R: 5-TTATTCCAATCTAGTTGGTTTTGATG -3' luxR-F: 5- ATGGACTCTATAGCAAAAAGACCC -3' luxR-R: 5- TTACGCTTCTTCTTTGTAAATACACAG -3' Step 2) Construction of recombinant positive plasmid The genomic DNA of Va, Val, Vh and Vsc were extracted respectively, and the genes were amplified using the primers in step 1). The amplified PCR products were identified by agarose gel electrophoresis. The positive products were compared with pMD-19 T The plasmids were ligated and transformed into DH5α competent cells. After culture, positive clones were identified by colony PCR and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The positive plasmid standards were named: pVa, pVal, pVh and pVsc.

[0021] Step 3) Dilution and storage of recombinant positive plasmid The positive clones were tested for concentration, and the plasmid copy number was calculated by the following formula: DNA copy number (copy / μL) = [6.02×10 23 ×Plasmid concentration (ng / μL)×10 -9 ] / [DNA length × 660]. Different positive standards were diluted to make their concentrations 10 9 copies / μL, stored at -20℃ for future use.

[0022] Example 2 Taqman multiplex fluorescence quantitative PCR primer design Step 1) Target gene selection and sequence analysis Va ampA Gene, Val toxR Gene, Vh VhhP2 Gene and Vsc luxR The gene was used as the target gene, and the intraspecies conserved region and interspecies specific region were found through NCBI blast analysis and multiple sequence alignment analysis, and primers and probes were designed.

[0023] Step 2) Design and modification of fluorescent probes Different probes were modified with different fluorescent labels. ampA The 5' end of the gene probe sequence was modified with FAM, Val toxR The 5' end of the gene probe sequence was modified to HEX, Vh VhhP2 The 5' end of the gene probe sequence was modified to ROX, Vsc luxR The 5' end of the gene probe sequence was modified with Cy5, and the specific sequence is shown in (Table 1).

[0024] Table 1 Primer and probe sequences for multiplex fluorescence quantitative PCR

[0025] Step 3) Preparation of primer and probe solutions The above-mentioned different primers and probes were dissolved and diluted with ultrapure water, and their concentrations were adjusted to 20 μM, and stored at -20°C for future use.

[0026] Example 3 Optimization of multiplex fluorescence quantitative PCR reaction conditions Step 1) Setting of reaction system conditions The concentration range of primer concentration is 0.1-1 μmol / L, the concentration gradient difference is 0.1 μmol / L, the concentration range of probe concentration is 0.1-0.8 μmol / L, the concentration gradient difference is 0.1 μmol / L, the annealing temperature range is 58°C-62°C, and the temperature gradient difference is 2°C.

[0027] Step 2) Fluorescence quantitative PCR reaction under different reaction system conditions Taqman fluorescence quantitative PCR was performed using the recombinant plasmid standards pVa, pVal, pVh and pVsc as templates, and the corresponding four pairs of qPCR primers and fluorescent probes (listed in Table 1). FAM, HEX, ROX and Cy5 were selected as the four fluorescent channels of the real-time fluorescence quantitative PCR instrument. The primer concentration and probe concentration were selected according to the Cq value, fluorescence value and amplification curve changes in the single fluorescence PCR amplification results, and the multiplex fluorescence PCR detection method was established using the optimized reaction system and reaction conditions (Table 2).

[0028] Table 2 Optimal reaction system for multiplex fluorescence quantitative PCR

[0029] Example 4 Establishment of multiplex fluorescence quantitative PCR standard curve Step 1) Dilution of positive standard plasmid The positive plasmid standards pVa, pVal, pVh and pVsc were diluted tenfold to obtain 10 9 Copies / μL-10 4Copies / μL of plasmid standard.

[0030] Step 2) Plotting of fluorescence quantitative PCR reaction and standard curve The diluted recombinant plasmid standard was used as a template, and the template was subjected to a multiplex fluorescence quantitative PCR reaction according to the optimized reaction system and reaction conditions described in Example 3. The multiplex fluorescence quantitative PCR standard curve was drawn with the logarithm of the copy number concentration as the abscissa and the Cq value of each copy concentration amplified as the ordinate. Figure 1 ). Standard curve formula, correlation coefficient R 2 , and the amplification efficiency (E) is as follows: Va,y=-3.3157x+43.955,R 2 =0.9963,E=1.00;Val,y=-3.4094x+45.251,R 2 =0.9939,E=0.96;Vh,y=-3.1083x+42.197,R 2 =0.9962,E=1.09;Vsc,y=-3.1427x+36.43,R 2 =0.9961,E=1.08.

[0031] Example 5 Multiplex fluorescence quantitative PCR sensitivity experiment Step 1) Dilution of positive standard plasmid The concentrations of the positive plasmid standards pVa, pVal, pVh and pVsc were diluted to 10 5 -10 0 copies / μL.

[0032] Step 2) Multiplex fluorescence quantitative PCR detection The diluted recombinant plasmid standard was used as a template, and the Taqman multiplex fluorescence quantitative PCR sensitivity test was performed according to the optimized reaction system and reaction conditions described in Example 3. At the same time, the diluted standard plasmid was used as a template to perform conventional PCR amplification for comparison. It was finally determined that the detection limits of the established multiplex fluorescence quantitative PCR for pVa, pVal, pVh, and pVsc were 4.0×10 1 copies / uL, 3.4×10 1 copies / uL, 6.0×10 1 copies / uL and 2.6×10 1 copies / uL, which is about 100 times more sensitive than ordinary PCR ( Figure 2 ).

[0033] Example 6 Multiplex Fluorescence Quantitative PCR Specificity Experiment Step 1) Selection of strains Eight other common aquatic pathogens were selected, such as Edwardsiella piscicida ( Edwardsiella piscicida )、Photobacterium luminescens( Photobacterium damselae )、Vibrio rotifer( Vibrio rotiferianus ) and Pseudomonas fluorescens ( Pseudomonas fluorescens )、Non-decarboxylative Luxenbergia ( Leclercia adecarboxylata )、Haemophilus influenzae( Haemophilus piscium )、 Vibrio azureus and Vibrio alginolyticus Conduct specificity experiments.

[0034] Step 2) Specific reaction The genomic DNA of each strain in step 1) was extracted respectively, and the plasmid standards pVa, pVal, pVh and pVsc were used as positive controls, and ultrapure water was used as negative control. Fluorescence quantitative PCR amplification and detection were performed according to the optimized reaction system and reaction conditions described in Example 3 above to determine the specificity of the established multiplex fluorescence quantitative PCR detection. The results showed that the established multiplex fluorescence quantitative PCR detection method had good specificity ( Figure 3 ).

[0035] Example 7 Multiplex Fluorescence Quantitative PCR Repeatability Experiment The dilution range is 10 6 Copies / μL-10 4 The recombinant plasmid standards pVa, pVal, pVh and pVsc were 1000 copies / μL. The diluted standard plasmid was used as a template, and the multiplex fluorescence quantitative PCR repeatability experiment was performed according to the optimized reaction system and reaction conditions described in Example 3 above, and three groups of repeated intra-group repeat experiments and three repeated experiments on the template under the same conditions at three different time periods were performed. At the same time, the coefficient of variation (CV) was calculated by the Cq value of each dilution to evaluate the repeatability of the method. The results showed that the established multiplex fluorescence quantitative PCR detection method had good repeatability.

[0036] Example 8 Clinical application of multiplex fluorescence quantitative PCR kit Step 1) Preparation of clinical samples 100 μL of Va, Val, Vh, Vsc (10 7 cfu / ml) or PBS (control), and the liver, spleen and kidney of the flatfish were aseptically collected at 12, 24 and 48 hours after infection, mixed and ground with PBS at a mass volume ratio of 1:10, and the presence of bacteria in the samples was detected by plate counting. In order to conduct multiplex qPCR detection studies, different ground samples were combined in different ways to obtain clinical samples containing 0, 1, 2, 3 and 4 bacteria, respectively.

[0037] Step 2) Multiplex fluorescence quantitative PCR detection

[0038] Table 3 Multiplex fluorescence quantitative PCR test results of clinical samples

[0039] The total genomic DNA from each sample in step 1) was extracted separately, and the plasmid standards pVa, pVal, pVh and pVsc were used as positive controls, and ultrapure water was used as negative control. Fluorescence quantitative PCR amplification and analysis were performed to determine the application potential of the established multiplex fluorescence quantitative PCR in fish clinical samples. The results showed that the detection accuracy of the established multiplex fluorescence quantitative PCR detection method was 100% (Table 3).

Claims

1. A Taqman multiplex fluorescence quantitative PCR detection system for common Vibrio pathogens in aquaculture, characterized by: The system consists of primers and probes for detecting four common Vibrio pathogens in aquaculture, and each probe is modified with a different fluorescent group at the 5' end and a corresponding quenching group at the 3' end; among them, the common Vibrio pathogens are Vibrio anguillarum Va, Vibrio alginolyticus Val, Vibrio harveyi Vh and Vibrio maxima turbot Vsc.

2. The Taqman multiplex fluorescence quantitative PCR detection system for common Vibrio pathogens in aquaculture according to claim 1, characterized in that: The Vibrio anguillarum Va probe and primers are directed against Va ampA Gene, the Val probe and primers of Vibrio alginolyticus are all targeted to Val toxR Gene, Vibrio harveyi Vh probe and primers are targeted to Vh VhhP2 Gene, Vsc probe and primers of turbot Vibrio maxima are targeted to Vsc RXGD Gene.

3. The Taqman multiplex fluorescence quantitative PCR detection system for common Vibrio pathogens in aquaculture according to claim 1 or 2, characterized in that: The Va ampA The gene primers and probes are: Primers: ampA-qF AAGTCCGTTACCAGCAGATG; ampA-qRCGTAAACTTGGCCGATAACCT; Probe: ampA-P[6-FAM]TCTCAGTTTGCGTTGCTACGACTGAC[BHQ1]; Val's toxR The gene primers and probes are: Primers: toxR-qF GTGTACCGGTGATGACACCTG; toxR-qR AATCACTTCAACTGGCAACGAG; Probe: toxR-P[HEX]CACGTAGCGCTCCAATGCATTGCTC[BHQ1]; Vh VxR The gene primers and probes are: Primers: VhhR2-qF CATCCTAGCTGTTGTTGCAGCT; VhhR2-qR GTTCCACCATTGACTAACCATTGG; Probe: VhhR2-P [ROX]TGGGTAAATCGCACGCCTGTTTCGA[BHQ2]; Vsc RXGD The gene primers and probes are: Primers: aprX-qF GTCGTGGTCATGCCGATATT; aprX-qR ATTAGAGAACTGACGTACCACATAGTTC; Probe: aprX-P[Cy5]CAACTACTTCCCAACACGTGAAGAC[BHQ2].

4. A Taqman multiplex fluorescence quantitative PCR detection kit for common Vibrio pathogens in aquaculture, characterized by: The kit contains the primers and probes according to claim 1.

5. The Taqman multiplex fluorescence quantitative PCR detection kit for common Vibrio pathogens in aquaculture according to claim 4, characterized in that: The concentration of primers and probes in the kit is 20µM, and the reaction system includes 2×PCR Mix 10µl, Va primer 0.3µl, Va probe 0.5µl, Val primer 0.2µl, Val probe 0.6µl, Vh primer 0.4µl, Vh probe 0.5µl, Vsc primer 0.2µl, Vsc probe 0.3µl; ultrapure water + DNA template to make up 20µl.

6. The Taqman multiplex fluorescence quantitative PCR detection kit for common Vibrio pathogens in aquaculture according to claim 5, characterized in that: The reaction procedure is: pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing at 60°C for 30s, and 40 cycles.

7. A use of the detection system according to claim 1 or the detection kit according to claim 4, characterized in that: The detection system or kit is used in multiple fluorescence quantitative / qualitative detection of common Vibrio pathogens in aquaculture.

8. A multiplex fluorescence quantitative PCR detection method for common Vibrio pathogens in aquaculture, characterized by: (1) Extraction of total DNA from samples; (2) Using the kit described in claim 4 and the positive plasmid corresponding to the common Vibrio pathogens in aquaculture to establish a standard curve for quantitative analysis of pathogens; (3) Use the kit described in claim 4 to extract the total DNA of the sample for multiplex fluorescence quantitative PCR amplification reaction to obtain a PCR amplification curve; (4) Analyze the results according to the amplification curve.

9. The multiplex fluorescence quantitative PCR detection method for common Vibrio pathogens in aquaculture according to claim 8, characterized in that: If the amplification result is a good "S" - shaped amplification curve and the Cq value ≤ 35, it is determined as positive; if there is no amplification curve and the Cq value > 35, it is determined as negative; if there is an "S" - shaped amplification curve in a certain gene channel of the sample to be tested and 35 < Ct < 40, it is judged as an indeterminate sample, and nucleic acid is re - extracted for retesting; in the positive results, the types of corresponding pathogenic bacteria in the sample are determined according to the fluorescent pigments corresponding to the amplification curves of different fluorescent channels.

Images