Yarrowia lipolytica engineering bacteria for producing p-coumaric acid with glucose as substrate, construction method and application thereof
By integrating specific genes into Yersinia lipolytica and constructing recombinant engineered bacteria using CRISPR/Cas9 technology, the problem of low production efficiency of p-coumaric acid in existing technologies has been solved, realizing efficient and environmentally friendly production of p-coumaric acid from glucose substrates, which is suitable for industrial applications.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HEBEI WEIDAKANG BIOTECHNOLOGY CO LTD
- Filing Date
- 2024-12-05
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies for producing coumaric acid suffer from problems such as long growth cycles, low yields, significant environmental impact, high energy consumption, low production rates, and environmental pollution. Biosynthesis methods have not fully utilized the metabolic characteristics of Yersinia lipolytica.
By integrating L-tyrosine ammonia-lyase gene, DAHP synthase gene, tyrosine synthase gene, histidine phosphoaminotransferase gene, and exogenous phenylalanine deamination hydroxylation pathway gene, a recombinant lipophilic yeast engineered strain was constructed using the CRISPR/Cas9 localization integration method to enhance metabolic pathways and increase coumaric acid production.
The efficient production of p-coumaric acid using glucose as a substrate was achieved, with a yield of 1.7 g/L in shake flasks and up to 30 g/L in a 5 L fermenter, demonstrating significant industrial application value.
Smart Images

Figure HDA0005174064640000011 
Figure HDA0005174064640000021 
Figure HDA0005174064640000022
Abstract
Description
Invention Field
[0001] This invention relates to the field of biotechnology, specifically to a recombinant lipophilic yeast strain for producing p-coumaric acid, its construction method, and its application. Background Technology
[0002] p-Coumaric acid (p-CA), an upstream metabolite of the phenylpropanoid pathway in plants, is a common precursor to phenylpropanoids, lignins, flavonoids, and stilbenes. Various in vivo and in vitro studies have revealed its scavenging and antioxidant properties in reducing oxidative stress and inflammation. Therefore, p-Coumaric acid has many important applications in nutrition, pharmaceuticals, materials, and the chemical industry. Currently, the main sources of p-Coumaric acid are plant extraction, chemical synthesis, and biosynthesis. Plant extraction faces problems such as long growth cycles, low yields, and significant environmental impact, while chemical synthesis faces problems such as high energy consumption, low yields, and environmental pollution. Biosynthesis, due to its advantages of low cost, high yields, and environmental friendliness, is considered the most promising production method of the 21st century.
[0003] Yarrowia lipolytica ( Yarrowia lipolytica Yeast *Yarrowia lipophila* is an important industrial microbial species, widely recognized as a food-grade safe microorganism. It naturally possesses high-throughput malonyl-CoA and pentose phosphate pathways (PPP), metabolic traits that may be particularly relevant to the production of shikimic acid-derived compounds and plant natural products requiring aromatic amino acids and malonyl-CoA-derived building blocks. Therefore, *Yarrowia lipophila* is an excellent host for coumaric acid biosynthesis. Summary of the Invention
[0004] The first objective of this invention is to provide a recombinant Yersinia lipolytica strain that stably produces p-coumaric acid using glucose as a substrate.
[0005] The second objective of this invention is to provide a method for constructing the above-mentioned recombinant Yersinia lipolytica that produces p-coumaric acid.
[0006] A third objective of this invention is to provide an application of the above-mentioned recombinant Yersinia lipolytica that produces p-coumaric acid.
[0007] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is as follows:
[0008] The first aspect of this invention provides a *Yarrowia lipolytica* engineered strain that produces p-coumaric acid using glucose as a substrate. This engineered strain integrates an L-tyrosine ammonia-lyase gene and a DAHP synthase gene. ARO4 , DHS1 , AROG Gene , Tyrosine synthase TYR Genes, histidine phosphotransferaseHIS5 Genes and exogenous phenylalanine deamination and hydroxylation pathways: phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene. 。
[0009] According to the above scheme, L-tyrosine aminolyase TAL The gene is an L-tyrosine ammonia-lyase gene derived from Flavobacterium. FjTAL; DAHP synthase ARO4 , DHS1 , AROG In genes , enzymes ARO4 , The DHS1 gene is an endogenous enzyme gene, AROG Genes originating from E. coli EcAROG Genes; tyrosine synthase TYR Genes, histidine phosphotransferase HIS5 The gene is an endogenous gene; the gene for the exogenous phenylalanine deamination and hydroxylation pathway is an Arabidopsis-derived phenylalanine ammonia-lyase gene. AtPAL2 Cinnamate hydroxylase gene AtC4H P450 reductase gene AtATR2 .
[0010] According to the above scheme, the gene FjTAL The nucleotide sequence is shown in SEQ ID No. 1.
[0011] According to the above scheme, the gene ARO4 The nucleotide sequence is shown in SEQ ID No. 2.
[0012] According to the above scheme, the gene DHS1 The nucleotide sequence is shown in SEQ ID No. 3.
[0013] According to the above scheme, the gene AROG The nucleotide sequence is shown in SEQ ID No. 4.
[0014] According to the above scheme, the tyrosine synthesis TYR Genes and HIS5 The gene is an endogenous gene. TYR The nucleotide sequence of the gene is shown in SEQ ID No. 5. HIS5 The nucleotide sequence is shown in SEQ ID No. 6.
[0015] According to the above scheme, the phenylalanine ammonia-lyase is derived from Arabidopsis thaliana. AtPAL2 The gene, with its nucleotide sequence shown in SEQ ID No. 7.
[0016] According to the above scheme, the cinnamate hydroxylase gene is derived from Arabidopsis thaliana. AtC4H gene,The nucleotide sequence is shown in SEQ ID No. 8.
[0017] According to the above scheme, the P450 reductase gene is derived from Arabidopsis thaliana. AtPAL2, The nucleotide sequence is shown in SEQ ID No. 9.
[0018] The second aspect of this invention provides a method for constructing the above-mentioned engineered *Yarrowia lipolytica* strain that produces p-coumaric acid using glucose as a substrate, employing a CRISPR / Cas9 localization and integration method to integrate tyrosine ammonia-lyase. TAL Genes were introduced into *Yarrowia lipophila* strains to enhance the DAHP synthase gene. ARO4 , DHS1 and AROG Overexpression of tyrosine synthase TYR Genes and histidine phosphotransferases HIS5 The protease gene was further integrated to synthesize exogenous phenylalanine deamination and hydroxylation pathway genes for p-coumaric acid, including phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene.
[0019] According to the above scheme, tyrosine ammonia hydrolase genes were integrated at two different gene loci, resulting in the integration of two copies of the tyrosine ammonia hydrolase gene.
[0020] In this invention, the aforementioned genes can be expressed individually at genomic loci, or multiple genes can be expressed at the same genomic locus. Preferably, the recombinant genetically engineered bacteria of this invention are expressed at different gene editing sites such as intE1, intC3, and intE14. DGA1 L-tyrosine ammonia-lyase gene and DAHP synthase gene expressed separately. ARO4 , DHS1 , AROG ) , Tyrosine synthase TYR Genes and histidine phosphotransferases HIS5 The genes and exogenous phenylalanine deamination hydroxylation pathway genes include phenylalanine ammonia-lyase genes, cinnamate hydroxylase genes, and P450 reductase genes, ultimately obtaining an engineered *Yersinia lipolytica* strain that produces p-coumaric acid using glucose as a substrate. Specifically, based on the CRISPR / Cas9 gene editing system, a pylcas9-sgRNA plasmid and a plasmid expressing the target gene can be constructed targeting the gene site to be integrated, and then co-transferred into *Yersinia lipolytica* to construct the engineered *Yersinia lipolytica* strain. More specifically, this can be achieved using *Yersinia lipolytica* strains such as po1fΔ... Ku70 The strain is the originating strain, which integrates L-tyrosine ammonia-lyase at the intE1 site of the genome. TAL Gene , Overexpression of DAHP synthase at intC3 site ARO4 ,DHS1 , EcAROG as well as TAL Gene, intE14 site enhances upstream tyrosine synthesis TYR Genes and histidine phosphotransferases HIS5 Gene , DGA1 Overexpression of exogenous phenylalanine deamination hydroxylation pathway genes at specific sites includes phenylalanine ammonia-lyase genes, cinnamate hydroxylase genes, and P450 reductase genes. 。
[0021] According to the above scheme, the method for constructing the lipophilic yeast *Yarrowia lipolytica* that produces p-coumaric acid using glucose as a substrate includes the following steps:
[0022] 1) The L-tyrosine ammonia-lyase gene TAL was integrated into the intE1 site of Yersinia lipolytica to obtain a recombinant Yersinia lipolytica that synthesizes p-coumaric acid from glucose de novo.
[0023] 2) Based on the strain obtained in step 1), DAHP synthase was further overexpressed at the intC3 site. ARO4 , DHS1 , AROG and L-tyrosine ammonia-lyase gene TAL Remove upstream DAHP synthesis restrictions and increase TAL Copy number increases, enhancing coumaric acid synthesis;
[0024] 3) Based on the strain obtained in step 2), enhance upstream tyrosine synthesis at the intE14 site. TYR Genes and histidine phosphotransferases HIS5 Genes were used to further improve the production of coumaric acid by engineered strains;
[0025] 4) Diacylglycerol transferase of the strain obtained in step 3) DGA1 At specific sites, overexpression of exogenous phenylalanine deamination hydroxylation pathway genes, including phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene, was used to significantly increase coumaric acid production.
[0026] Specifically, step (1) is as follows:
[0027] Build FjTAL gene Expression cassettes, amplified to obtain FjTAL Gene expression cassette fragments were amplified using the yeast genome as a template, specifically the upstream and downstream homologous arms of the intE1 site. These fragments were then combined with... FjTAL Gene expression cassette fragments were cloned and ligated using plasmids in a one-step process to construct plasmids.
[0028] Based on the sgRNA sequence targeting the intE1 site, a tool plasmid pylcas9 expressing Cas9 protein and sgRNA was constructed. Using pylcas9 as a template, the pYlCas9-sgRNA-intE1 fragment containing Cas9 protein and located at the intE1 site was amplified. The vector fragment was self-ligated using T5 to construct the pYlCas9-sgRNA-intE1 plasmid.
[0029] The two plasmids were co-transformed into the starting strain PO1f, and the recombinant strain jz101 was obtained by screening using colony PCR.
[0030] Step (2) is: construct separately ARO4 , DHS1 , EcAROG , FjTAL Gene expression cassettes will amplify ARO4 , DHS1 , EcAROG , FjTAL The gene expression cassette fragment and the upstream homologous arm of intC3 and the upstream homologous arm fragment of intC3 were cloned in one step using a plasmid to construct a plasmid;
[0031] Based on the sgRNA sequence targeting the intC3 site, a tool plasmid pylcas9 expressing Cas9 protein and sgRNA was constructed. Using pylcas9 as a template, the pYlCas9-sgRNA-intC3 fragment containing Cas9 protein and located at the intC3 site was amplified. The vector fragment was constructed by T5 self-ligation to obtain the pYlCas9-sgRNA-intC3 plasmid.
[0032] The recombinant strain jz102 was obtained by colony PCR screening after co-transformation into strain jz101.
[0033] Step (3) is: construct separately TYR Gene expression cassettes and HIS5 Gene expression cassettes will amplify TYR , HIS5 The gene expression cassette fragment and the upstream homologous arm of intE14 were cloned in one step using a plasmid to construct the plasmid.
[0034] Based on the sgRNA sequence targeting the intE14 site, a tool plasmid pylcas9 expressing Cas9 protein and sgRNA was constructed. Using pylcas9 as a template, the pYlCas9-sgRNA-intE14 fragment containing Cas9 protein and located at the intE14 site was amplified. The vector fragment was constructed by T5 self-ligation to obtain the pYlCas9-sgRNA-intE14 plasmid.
[0035] The strain was transformed into jz102, and the recombinant strain jz104 was obtained by screening using colony PCR.
[0036] Step (4) involves constructing gene expression cassettes for phenylalanine ammonia-lyase, cinnamate hydroxylase, and P450 reductase, respectively.
[0037] Amplified diacylglycerol acyltransferase DGA1 The upstream and downstream homologous arm segments DGA1Up and DGA1down are used to construct... DGA1 Site integration vectors will amplify gene expression cassette fragments of phenylalanine ammonia-lyase, cinnamate hydroxylase, and P450 reductase genes, as well as... DGA1 The site-integrated vector amplification fragment was cloned in one step to construct the first plasmid;
[0038] Based on target DGA1 We constructed a tool plasmid, pylcas9, to express Cas9 protein and sgRNA at a specific site. Using pylcas9 as a template, we amplified Cas9 protein and sgRNA containing Cas9 protein. DGA1 The pYlCas9-sgRNA-DGA1 fragment at the site was used to construct the vector fragment using T5 self-ligation, resulting in the pYlCas9-sgRNA-DGA1 plasmid.
[0039] Using the first plasmid as a template, homologous arms and gene expression cassettes were amplified and recovered using primers. The recovered fragments and pYlCas9-sgRNA-DGA1 plasmid were co-transformed into recombinant strain jz104. Colony PCR was used for screening to obtain recombinant strain jz106.
[0040] The third aspect of this invention provides the application of the above-mentioned engineered Yersinia lipolytica strain in the production of p-coumaric acid using glucose as a substrate.
[0041] This invention integrates the tyrosine ammonia-lyase gene. TAL Strengthening the DAHP synthase gene ARO4 , DHS1 and AROG Overexpression of upstream tyrosine synthesis TYR and HIS5 The protease gene was further integrated to synthesize exogenous phenylalanine deamination and hydroxylation pathway genes for coumaric acid, including phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene, resulting in a lipolytic yeast strain that can achieve high coumaric acid production using glucose as a substrate.
[0042] The beneficial effects of this invention are:
[0043] The lipolytic yeast strain for producing p-coumaric acid constructed in this invention has a p-coumaric acid yield of 1.7 g / L in shake flasks and can reach a yield of 30 g / L in a 5 L feed-in fermenter, which has significant industrial application value. Attached Figure Description
[0044] Figure 1 Metabolic pathway of high-yield coumarin lipolysin strain;
[0045] Figure 2 The yield of p-coumaric acid in strains overexpressing key genes;
[0046] Figure 3 To produce p-coumaric acid by batch fermentation of engineered Yeast strain JZ106. Detailed implementation method:
[0047] The present invention will be further described below with reference to the embodiments. The following embodiments are provided to enable those skilled in the art to better understand the present invention, but do not limit the present invention in any way.
[0048] The DNA ligase and other molecular biology reagents used were purchased from TaKaRa (https: / / www.takara.com.cn / ); the Uniclone One Step Seamless Cloning Kit was purchased from Beijing Jinsha Biotechnology Co., Ltd. (https: / / 400-688-7890.company.lookchem.cn / ); and other biochemical reagents were purchased from China Reagent Network (https: / / www.labgogo.com / ).
[0049] The LB liquid culture medium formula is: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, sterilized at 121℃ for 30 min.
[0050] The LB solid medium formula is: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder, sterilized at 121℃ for 30 min.
[0051] YPD liquid culture medium: 10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose, sterilized at 115℃ for 30 min;
[0052] YPD solid medium: 10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose, 20 g / L agar, sterilized at 115℃ for 30 min;
[0053] YPD-40 liquid culture medium: 10 g / L yeast extract, 20 g / L tryptone, 40 g / L glucose, sterilized at 115℃ for 30 min;
[0054] YNB-Leu liquid culture medium: 6.7 g / L YNB, 1.5 g / L (NH4)2SO4, 20 g / L glucose, 0.1 g / L LUra, sterilized at 115℃ for 30 min.
[0055] YNB-Leu solid medium: 6.7 g / L YNB, 1.5 g / L (NH4)2SO4, 20 g / L glucose, 0.1 g / L L ara, 20 g / L agar, sterilized at 115℃ for 30 min.
[0056] Preparation of competent cells of Yersinia lipophila:
[0057] (1) Pick a fresh lipophilic yeast monoclonal cell from a YPD plate and incubate it overnight at 30°C and 250 rpm in 5 ml of YPD liquid medium;
[0058] (2) Measure the OD600 value of the overnight culture;
[0059] (3) Inoculate overnight culture into fresh culture medium to make the initial OD600 value 0.2-0.4;
[0060] (4) Continue culturing in a shaker at 28–30 °C for 3–6 h until the OD600 value reaches 0.6–1.0;
[0061] (5) Take 50 mL of culture medium, centrifuge at 3000 g for 3 min at room temperature to collect yeast cells, and discard the supernatant;
[0062] (6) Resuspend the cells in 50 mL of sterile water, then centrifuge at 3000 g for 3 min at room temperature to collect the cells and discard the supernatant;
[0063] (7) Resuspend the yeast cells in 1.5 mL of 1 × LiAc / 0.5 × TE, then centrifuge at 3000 g for 3 min at room temperature to collect the cells and discard the supernatant;
[0064] (8) Finally, resuspend the yeast cells in 200 μL of 1 × LiAc / 0.5 × TE and dispense into 50 μL tubes.
[0065] Transformation of lipophilic yeast cells:
[0066] (1) Take 50 μL of competent cells, add 2-5 μL of each plasmid to be transfected, and then add 5 μL (10 mg / L) of denatured salmon protamine and mix well;
[0067] (2) Add 300 μL of conversion solution 1 × LiAc / 40% PEG-3350 / 1 × TE, and tap the tube wall to mix.
[0068] (3) Incubate in a 30 ℃ water bath for 0.5-2 h, and mix thoroughly by tapping the tube wall every 15 min;
[0069] (4) Transfer to a 42 ℃ water bath and heat for 15-18 min;
[0070] (5) Centrifuge at 3000 g for 3 min, retain the precipitate, and discard the supernatant;
[0071] (6) The precipitate is resuspended in 50-150 μL of distilled water, spread on the corresponding screening plate, and inverted in 30 ℃ for 2-3 days.
[0072] Reagents:
[0073] 10×TE (100 mL): 100 mM Tris (1.2114 g), 10 mM EDTA (0.29224 g), adjust pH to 7.5, filter to sterilize and store at 4°C;
[0074] 10×LiAc: Dissolve 10.2 g LiAc in 90 mL of distilled water, adjust the pH to 7.5, and bring the volume to 100 mL with distilled water. Filter to sterilize and store at 4°C.
[0075] 50% PEG-3350: Weigh 25 g of PEG-3350, add a small amount of distilled water and heat slowly to dissolve it, then make up to 50 mL with distilled water, filter to sterilize and store at 4℃;
[0076] 1×LiAc / 0.5×TE: Mix 100 μL of 10×LiAc and 50 μL of 10×TE, and bring the volume to 1 mL with distilled water.
[0077] 1×LiAc / 50% PEG-3350 / 1×TE: Mix 100 μL of 10×LiAc, 100 μL of 10×TE and 800 μL of 50% PEG-3350.
[0078] Genome extraction of Yersinia lipophila transformants
[0079] (1) Add 100 μL of bacterial culture to a 1.5 mL centrifuge tube, centrifuge at 5000 rpm for 3 min, and discard the supernatant;
[0080] (2) Add 100 μL of 0.2 M LiAc 1% SDS solution (m / v) to resuspend the cells; incubate in a metal bath at 75℃ for 10 min;
[0081] (3) Add 300 μL of anhydrous ethanol, vortex, centrifuge at 15000 rpm for 3 min, and remove the supernatant with a pipette;
[0082] (4) Add 150 μL of 70% ethanol, centrifuge at 15000 rpm for 3 min, and remove the supernatant with a pipette;
[0083] (5) Dry in an incubator at 37℃;
[0084] (6) Add 50 μL of sterile water, resuspend, centrifuge at 15000 rpm for 1 min, and use the supernatant as a genomic template.
[0085] Example 1. Construction of engineered *Yarrowia spp.* producing p-coumaric acid lipolysinic yeast
[0086] L-tyrosine aminolyase derived from Flavobacterium FjTAL Integrating into Yersinia lipophila po1fΔ Ku70 A recombinant Yersinia lipolyticis strain was constructed to synthesize p-coumaric acid de novo using glucose as a substrate. The specific procedures are as follows:
[0087] FjTAL The gene sequence is shown in SEQ ID No. 1, and amplification was performed. FjTAL Gene primers (SEQ ID No. 10-11) amplify L-tyrosine ammonia-lyase FjTAL Gene fragments were constructed in Escherichia coli DH5α using plasmid pUC19. FjTAL gene Expression box P TEF1 - FjTAL -T lip2t Using primers (SEQ ID No. 12-15) to amplify the upstream and downstream homologous arms of the intE1 site in the yeast genome as a template, fragments of the upstream and downstream homologous arms of the intE1 site were amplified, respectively. FjTAL Gene expression cassette primers (SEQ ID No. 16-17) amplification FjTAL Gene expression cassettes were obtained FjTAL Gene expression cassette fragments, connecting the upstream and downstream homologous arms of the intE1 site with... FjTAL Gene expression cassette fragments were cloned and ligated in one step using plasmid pUC19 to construct plasmid pUC19-intE1-P. TEF1 -FjTAL -T lip2t .
[0088] Based on the sgRNA sequence targeting the intE1 site, a tool plasmid pylcas9 was constructed to express Cas9 protein and sgRNA. Using pylcas9 as a template, primers (SEQ ID No. 18-19) were used to amplify the pYlCas9-sgRNA-intE1 fragment containing Cas9 protein and localized to the intE1 site, resulting in the pYlCas9-sgRNA-intE1 fragment. Dpn I After overnight digestion of the PCR product, it was recovered, and the vector fragment was constructed using T5 self-ligation to obtain the pYlCas9-sgRNA-intE1 plasmid.
[0089] SEQ ID No. 1 Flavobacterium ( Flavobacterium johnsoniae ) Source gene
[0090] FjTAL deoxyribonucleic acid sequence
[0091]
[0092] Amplification FjTAL Gene primer sequence
[0093] FjTAL -F:ttgcagtactaaccgcagAACACCATCAACGAGTACCTG, SEQ ID No.10
[0094] FjTAL -R: ggttgattccgaacagaagCTAGTTGTTAATCAGATG, SEQ ID No.11
[0095] Primer sequences for amplifying the upstream and downstream homologous arms of the intE1 site in the yeast genome
[0096] puc19-intE1-F1: TTGTAAAACGACGGCCAGTGcactgttgattgcttcagttac, SEQ IDNo.12
[0097] intE1-pTEF1-R1: GCCGCCAACCCGGTCTCTaagcactatcctctgctgcg, SEQ ID No. 13
[0098] Lip2t-intE1-F2: ACCGCCCAAGAATGCATCTGttgtgtcgaaatacaacagcc, SEQ ID No. 14
[0099] intE1-puc19-R2:CCATGATTACGCCAAGCTTGcttaaagcgatgtggcgcag, SEQ ID No.15
[0100] Amplification FjTAL Gene expression cassette primer sequences
[0101] pTEF1-UP: AGAGACCGGGTTGCGGC, SEQ ID No. 16
[0102] Lip2t-R: cagatgcattcttgggcggt, SEQ ID No.17
[0103] Primer sequences for amplification containing Cas9 protein and the pYlCas9-sgRNA-intE1 fragment localized to the intE1 site were obtained.
[0104] sgRNA-intE1-F: gggctatctgagctggatcgGTTTTAGAGCTAGAAAT, SEQ ID No. 18
[0105] sgRNA-intE1-R: cgatccagctcagatagcccTAACCAACCTGCGCCGA, SEQ ID No. 19
[0106] The plasmids pUC19-intE1-PTEF1-FjTAL-Tlip2t and pYlCas9-sgRNA-intE1 were co-transferred into *Yersinia lipolytica* po1fΔKu70 using a lithium acetate / single-stranded DNA / PEG3350 thermal transfer method and plated on a leucine-deficient selection plate, YNB-leu. After 2-3 days, several transformants were randomly selected and cultured in the corresponding liquid YNB-leu medium at 30°C and 250 rpm for 48 h. Genomic DNA was extracted and validated by PCR. Positive transformants were then selected to obtain the recombinant strain jz101.
[0107] A single colony of recombinant strain jz101 was picked and inoculated into a test tube containing 2 mL of YPD medium and cultured in a shaker at 250 rpm and 30 °C for 24 h. The primary seed culture was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of YPD medium and cultured for 24 h at an inoculation rate of 1% (v / v) to obtain the secondary seed culture. The secondary seed culture was inoculated into a 250 mL Erlenmeyer flask containing 30 mL of YPD-40 medium at an inoculation rate of 5% (v / v). After fermentation under the same conditions for 96 h, the yield of coumaric acid was 100.8 mg / L.
[0108] Example 2. Enhancing upstream DAHP synthesis and increasing FjTAL Copy number
[0109] yeast endogenous gene DAHP synthase gene ARO4 , DHS1 and DAHP synthase gene from E. coli The sequence of EcAROG is as As shown in SEQ ID No. 2-4, the endogenous gene DAHP synthase in Yersinia lipolytica is further overexpressed. ARO4 , DHS1 and DAHP synthase gene from E. coli EcAROG, Remove upstream DAHP synthesis restrictions and simultaneously increase L-tyrosine ammonia-lyase gene. FjTAL Number of copies. The specific steps are as follows:
[0110] Amplification ARO4 , DHS1 ,EcAROG Amplification of gene fragments using primers (SEQ ID No. 20-25) ARO4 , DHS1 , EcAROG Gene fragments were used to construct expression cassettes P in E. coli DH5α using plasmid pUC19. FAB1in - ARO4 -T Pex20 P hp4d - ECAROG -T xpr2t P GPD1 - DHS1 -T xpr2t Using primers (SEQ ID No. 26-29) for amplifying the upstream and downstream homologous arms of intC3, and with the *Yarrowia lipolytica* genome as a template, fragments of the upstream and downstream homologous arms of intC3 were amplified. ARO4 , DHS1 , EcAROG , FjTAL Gene expression cassette primers (e.g., SEQ ID No. 34-35, SEQ ID No. 36-37, SEQ ID No. 32-33, SEQ ID No. 30-31, respectively) were used for amplification. ARO4 , DHS1 , EcAROG , FjTAL Gene expression cassettes will amplify ARO4 , DHS1 , EcAROG , FjTAL The gene expression cassette fragment and the upstream homologous arm of intC3 were cloned in one step using plasmid pUC19 to construct plasmid pUC19-intC3- FjTAL - ARO4- EcAROG-DHS1 Based on the sgRNA sequence targeting the intC3 site, a tool plasmid pylcas9 was constructed to express Cas9 protein and sgRNA. Using pylcas9 as a template, primers (SEQ ID No. 38-39) containing Cas9 protein and the pYlCas9-sgRNA-intC3 fragment located at the intC3 site were used to amplify the pYlCas9-sgRNA-intC3 fragment containing Cas9 protein and the pYlCas9-sgRNA-intC3 fragment located at the intC3 site. Dpn I After overnight digestion of the PCR product, it was recovered, and the vector fragment was constructed using T5 self-ligation to obtain the pYlCas9-sgRNA-intC3 plasmid.
[0111] SEQ ID No. 2 Yersinia lipolytica ( Yarrowia lipolytica Endogenous
[0112] [[ID= deoxyribonucleic acid sequence
[0113]
[0114] SEQ ID No. 3 Yersinia lipolytica ( Endogenous
[0115] deoxyribonucleic acid sequence
[0116]
[0117] SEQ ID No. 4 Escherichia coli ( ) Source gene
[0118] deoxyribonucleic acid sequence
[0119]
[0120] Amplification Primer sequences of gene fragments
[0121] -F:caaactaacccagCTCTCCatgTCCCGTTCCTCCT, SEQ ID No.20
[0122] -R: acttccccatccacacttTTAGTTCTTGTTTC, SEQ ID No.21
[0123] Amplification Primer sequences of gene fragments
[0124] -F:CCCGAAACTAAggatcATGCCCGCTATGCACAA, SEQ ID No.22
[0125] -R:ACACAAGTTCCGTAGTTgCTAACCTCGTCGAGTC, SEQ ID No.23
[0126] Amplification Primer sequences of gene fragments
[0127] -F:gtactaacacagGTCatgaattatcagaacga, SEQ ID No.24
[0128] -R: AGGCCATGGAGGTACCttacccgcgacgcgctttt, SEQ ID No.25
[0129] Primer sequences for amplifying the upstream and downstream homologous arms of the intC3 site in the yeast genome
[0130] puc19-intC3-F1: TAGCTTATCGATACGCGTaaaaaactgtagtagtgtggtgat, SEQ IDNo.26
[0131] IntC3-R1:TTTCAGTCTCCTCTTCACCatacagtgtctatcaacggggc, SEQ ID No.27
[0132] IntC3-F2: TAAATTTAGTCTGCAGCCCAgccatagcactattgtagagtgg, SEQ ID No. 28
[0133] intC3-puc19-R2: ACCATGATTACGCCAAGCTTGaattattgcacaggacacac, SEQ ID No. 29
[0134] Amplification Gene expression cassette primer sequences
[0135] IntC3- -F:TGGTGAAGAGGAGACTGAAATAGAGACCGGGTTGGCGG,SEQ IDNo.30 - R: GCAGGACATCCTACTGCGTCcagatgcattcttgggcgg, SEQ ID No. 31
[0136] Amplification Gene expression cassette primer sequences
[0137] - F: ccgcccaagaatgcatctgGACGCAGTAGGATGTCCTGC, SEQ ID No. 32
[0138] - -R: AGTTAGCTCACTCATTAGGCACCCATCTCACTTGCGTAT, SEQ ID No.33
[0139] Amplification Gene expression cassette primer sequences
[0140] - -F: ATACGCAAGTGAGATGGGTGCCTAATGAGTGAGCTAACT, SEQ IDNo.34 - -R: CACGGCTCCGCCAGAGacgcaactaacatgaatga, SEQ ID No.35
[0141] Amplification Gene expression cassette primer sequences
[0142] - -F:tcattcatgttagttgcgtCTCTGGCGGAGCCGTG, SEQ ID No.36
[0143] -IntC3--R: AGTTAGCTCACTCATTAGGCACCCATCTCACTTGCGTAT, SEQ ID No.37
[0144] Primer sequences for amplification containing Cas9 protein and the pYlCas9-sgRNA-intC3 fragment localized to the intC3 site were obtained.
[0145] sgRNA-intC3-F: ctcgctccatgatcgtcgtaGTTTTAGAGCTAGAAAT, SEQ ID No. 38
[0146] sgRNA-intC3-R: tacgacgatcatggagcgagTAACCAACCTGCGCCGA, SEQ ID No. 39
[0147] pUC19-intC3- was transferred via a thermal transfer method using lithium acetate / single-stranded DNA / PEG3350. - The pYlCas9-sgRNA-intC3 was co-transferred into *Yersinia lipolytica* jz101 and plated on a leucine-deficient selection plate, YNB-leu. After 2-3 days, several transformants were randomly selected and cultured in the corresponding liquid YNB-leu medium at 30°C and 250 rpm for 48 h. After genomic DNA extraction and PCR verification, positive transformants were selected to obtain the recombinant strain jz102.
[0148] A single colony of recombinant strain jz102 was picked and inoculated into a test tube containing 2 mL of YPD medium and cultured in a shaker at 250 rpm and 30 °C for 24 h. The primary seed culture was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of YPD medium and cultured for 24 h at an inoculation rate of 1% (v / v) to obtain the secondary seed culture. The secondary seed culture was inoculated into a 250 mL Erlenmeyer flask containing 30 mL of YPD-40 medium at an inoculation rate of 5% (v / v). After fermentation under the same conditions for 96 h, the yield of coumaric acid was 355.9 mg / L.
[0149] Example 3. Enhancing the tyrosine synthesis pathway and increasing tyrosine flux.
[0150] Enhanced endogenous upstream tyrosine synthesis in Yersinia lipolytica Genes and Genes were used to further enhance the coumaric acid production of the engineered strain. The specific procedures are as follows:
[0151] Endogenous upstream tyrosine synthesis in Yersinia lipolytica Genes and The gene sequences are shown in SEQ ID No. 5 and 6, and were amplified using... Gene fragment primers (SEQ ID No. 40-41) and amplification Gene fragment primers (SEQ ID No. 42-43) were used as templates to amplify the gene fragments. Genes and Gene fragments were used to construct expression cassettes P in E. coli DH5α using plasmid pUC19. GPD1 - -T lip2 P TEFin - -T lip2t Using the yeast genome as a template, primers (SEQ ID No. 44-47) were used to amplify the upstream and downstream homologous arms of the intE14 site. The upstream homologous arm fragment of intE14 was amplified. Gene expression cassette primers (SEQ ID No. 48-49) and amplification Gene expression cassette primers (SEQ ID No. 50-51) amplification , Gene expression cassettes will , The gene expression cassette fragment and the upstream homologous arm of intE14 were cloned in one step using plasmid pUC19 to construct plasmid pUC19-intE14- - Plasmid. Based on the sgRNA sequence targeting the intE14 site, a tool plasmid pylcas9 was constructed to express Cas9 protein and sgRNA. Using pylcas9 as a template, primers (SEQ ID No. 52-53) were used to amplify the pYlCas9-sgRNA-intE14 fragment containing Cas9 protein and located at the intE14 site, to amplify the pYlCas9-sgRNA-intE14 fragment containing Cas9 protein and located at the intE14 site. After overnight digestion of the PCR product, it was recovered, and the vector fragment was constructed using T5 self-ligation to obtain the pYlCas9-sgRNA-intE14 plasmid.
[0152] SEQ ID No. 5 Yersinia lipolytica ( Endogenous
[0153] deoxyribonucleic acid sequence
[0154]
[0155] SEQ ID No. 6 Yersinia lipolyticis ( Endogenous
[0156] HIS5 deoxyribonucleic acid sequence
[0157]
[0158] Amplification TYR Gene fragment primer sequence
[0159] TYR -F:caatgtactaacacagGTCTCTATTGAGGAATGGAAG, SEQ ID No.40
[0160] TYR -R: GTTGTAAAGAGTGATAAATAGCTTAAGTGGTTGACAGAATGGTG, SEQ ID No.41
[0161] Amplification HIS5 Gene fragment primer sequence
[0162] HIS5 -F: CTGAGTATAAGAATCATTCAAAATGCCCAACACGAAATTCAACCTC, SEQ ID No.42
[0163] HIS5 -R:GTTGTAAAGAGTGATAAATAGCCTACTGTCTCAGGGCAGCAATTG, SEQ ID No.43
[0164] Primer sequences for amplifying the upstream and downstream homologous arms of the intE14 site in the yeast genome
[0165] puc19-intE14-F:GTAAACGACGGCCAGTGccccatctgtagagctagtcagt, SEQ ID No.44
[0166] IntE14-R1:TTTCAGTCTCCTCTTCACCAgagtacaacgccgacatccac, SEQ ID No.45
[0167] IntE14-F2: TAAATTTAGTCTGCAGCCCAtttgccctatgctcagtcaac, SEQ ID No.46
[0168] intE14-puc19-R2: CCATGATTACGCCAAGCTTGagccttacatagactggtac, SEQ ID No.47
[0169] Amplification TYR Gene expression cassette primer sequences
[0170] IntE14-TYR -F:TGGTGAAGAGGAGACTGAAATGACGCAGTAGGATGTCCTG, SEQ ID No.48
[0171] TYR - HIS5- R: CTGACCCTAGTTACGGTACACAGATGCATTCTTGGGCGGT, SEQ ID No. 49
[0172] Amplification HIS5 Gene expression cassette primer sequences
[0173] TYR - HIS5- F: GTACCGTAACTAGGGTCAGAGAGACCGGGTTTGGCGGCGCATT, SEQ ID No.50
[0174] HIS5 -IntE14-R: TGGGCTGCAGACTAAATTTACAGATGCATTCTTGGGCGGT, SEQ ID No. 51
[0175] Primer sequences for amplification of the pYlCas9-sgRNA-intE14 fragment containing Cas9 protein and localized to the intE14 site were obtained.
[0176] sgRNA-intE14-F:GCTTCGGTGGACACACACTGGTTTTAGAGCTAGAAAT, SEQ ID No.52
[0177] sgRNA-intE14-R: CAGTGTGTGTCCACCGAAGCTAACCAACCTGCGCCGA, SEQ ID No. 53
[0178] pUC19-intE14- was transferred via a thermal transfer method using lithium acetate / single-stranded DNA / PEG3350. TYR - HIS5 The pYlCas9-sgRNA-intE14 was co-transferred into *Yersinia lipolytica* jz102 and plated on a leucine-deficient selection plate, YNB-leu. After 2-3 days, several transformants were randomly selected and cultured in the corresponding liquid YNB-leu medium at 30°C and 250 rpm for 48 h. Genomic DNA was extracted and validated by PCR. Positive transformants were then selected to obtain the recombinant strain jz104.
[0179] A single colony of engineered strain jz104 was picked and inoculated into a test tube containing 2 mL of YPD medium and cultured in a shaker at 250 rpm and 30 °C for 24 h. The primary seed culture was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of YPD medium and cultured for 24 h at an inoculation rate of 1% (v / v) to obtain the secondary seed culture. The secondary seed culture was then inoculated into a 250 mL Erlenmeyer flask containing 30 mL of YPD-40 medium at an inoculation rate of 5% (v / v). After fermentation under the same conditions for 96 h, the yield of coumaric acid was 463.6 mg / L.
[0180] Example 4. Synthesis of p-coumaric acid by integrating exogenous phenylalanine deamination and hydroxylation pathway
[0181] Deaminohydroxylation pathway of exogenous phenylalanine AtPAL2 , AtC4H , AtATR2 Integration into diacylglycerol transferase DGA1 The specific operation for the site is as follows:
[0182] AtPAL2 , AtC4H , AtATR2 The gene sequences, as shown in SEQ ID Nos. 7, 8, and 9, were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (https: / / store.sangon.com / ). AtPAL2 , AtC4H , AtATR2 Genes are generated using synthetic sequences as templates and amplification. AtPAL2 Gene primers, amplification AtC4H Gene primers, amplification AtATR2 Gene amplification was performed using primers (as shown in SEQ ID No. 54-55, SEQ ID No. 56-57, and SEQ ID No. 58-59, respectively), and then the expression cassette P was constructed in E. coli DH5α using plasmid pUC19. TEF1 - AtPAL2 -T xpr2t / P TEF1 - AtC4H -T xpr2t / P TEF1 - AtATR2 -T xpr2t Using the genome of *Yersinia lipolytica* as a template, primers (SEQ ID No. 60-63) were used to amplify the upstream and downstream homologous arms of diacylglycerol acyltransferase DGA1. DGA1 The upstream homologous arm fragment and the downstream homologous arm fragments DGA1Up and DGA1down were used to construct an E. coli DH5α using plasmid pUC19. DGA1The site integration vector pUC19-DGA1Up-DGA1down was used. Amplification was performed separately. AtPAL2 , AtC4H , AtATR2 The gene expression cassette primers (SEQ ID No. 64-65, SEQ ID No. 66-67, SEQ ID No. 68-69, respectively) were used to amplify the gene expression cassette. AtPAL2 , AtC4H , AtATR2 Gene expression cassettes, using amplified diacylglycerol acyltransferase DGA1 The upstream homologous arm fragment and downstream homologous arm primers (SEQ ID No. 70-71) were used to amplify the pUC19-DGA1Up-DGA1down plasmid containing the homologous arm. AtPAL2 , AtC4H , AtATR2 The gene expression cassette fragment and the vector pUC19-DGA1Up-DGA1Down fragment were cloned in one step to construct the plasmid pUC19-ΔDGA1- AtPAL2 - AtC4H - AtATR2 ;
[0183] Using gRNA to design the website chopchop (https: / / chopchop.cbu.uib.no / ) to design positioning DGA1 We constructed a tool plasmid, pylcas9, to express Cas9 protein and sgRNA, using it as a template to amplify Cas9 protein and sgRNA. DGA1 Primers (SEQ ID No. 72-73) for the pYlCas9-sgRNA-DGA1 fragment at the site were used to amplify the Cas9 protein and its localization. DGA1 The pYlCas9-sgRNA-DGA1 fragment at the site, Dpn I After overnight digestion of the PCR product, it was recovered, and the vector fragment was constructed using T5 self-ligation to obtain the pYlCas9-sgRNA-DGA1 plasmid.
[0184] With plasmid pUC19-ΔDGA1- AtPAL2 - AtC4H - AtATR2Using a template, homologous arms and gene expression cassettes were amplified and recovered using primers (sequences shown in SEQ ID No. 60 and 63). The recovered fragments and pYlCas9-sgRNA-DGA1 plasmid were transformed into yeast jz104 using a lithium acetate / single-stranded DNA / PEG3350 thermal transfer method and plated on a leucine-deficient selection plate (YNB-leu). After 2-3 days, several transformants were randomly selected and cultured in the corresponding liquid YNB-leu medium at 30°C and 250 rpm for 48 h. Genomic DNA was extracted and validated by PCR. Positive transformants were then selected to obtain recombinant strain jz106.
[0185] SEQ ID No. 7 Arabidopsis thaliana source gene
[0186] AtPAL2 deoxyribonucleic acid sequence
[0187]
[0188] SEQ ID No. 8 Arabidopsis thaliana source gene
[0189] AtC4H deoxyribonucleic acid sequence
[0190]
[0191] SEQ ID No. 9 Arabidopsis thaliana source gene
[0192] AtATR2 deoxyribonucleic acid sequence
[0193]
[0194] Amplification AtPAL2 Gene primer sequence
[0195] AtPAL2 -F: TAAGAATCATTCAAAATGGACCAGATCGAGGCCATG, SEQ ID No.54
[0196] AtPAL2 -R: ACAGGCCATGGAGGTACTTAACAGATGGGGATGGGGGCA, SEQ ID No.55
[0197] Amplification AtC4H Gene primer sequence
[0198] AtC4H -F: TAAGAATCATTCAAAATGGACCTGCTGCTGCTGGA, SEQ ID No.56
[0199] AtC4H -R: ACAGGCCATGGAGGTACTTAGCAGTTTCGGGGCTTCA, SEQ ID No.57
[0200] Amplification AtATR2 Gene primer sequence
[0201] AtATR2 -F: TAAGAATCATTCAAAATGTCTTCTTCTTCCTCTTC, SEQ ID No.58
[0202] AtATR2 -R: ACAGGCCATGGAGGTACTTACCAGACGTCTCGCAGGT, SEQ ID No.59
[0203] Amplification of diacylglycerol acyltransferase DGA1 upstream homologous arm fragment and downstream homologous arm primer sequences
[0204] puc19-dga1-F: GTAAAACGACGGCCAGTGTATGTAGATGGCTTCTCTTCTCCA, SEQ ID No.60
[0205] DGA1-R1: AGCTTTTGTTTTGTGTGACTTG, SEQ ID No.61
[0206] DGA1-F2: AGTCACACAAAACAAAAGCTGAAAACTGCCTGGGTTAGGC, SEQ ID No. 62
[0207] dga1-puc19-R2: CCATGATTACGCCAAGCTTGGCAGTTCTCGTTCTCTTCATGC, SEQ ID No. 63
[0208] Amplification AtPAL2 Gene expression cassette primer sequences
[0209] dga1up -AtPAL2 -F:CAAGTCACACAAAACAAAAGCTAGAGACCGGGTTTGGCGGC, SEQ ID No.64
[0210] Feature 13 -AtPAL2 -R: GCTATCTAATTTCGTGGCCGCATCTCACTTGCGTATGTATGGA, SEQ IDNo.65
[0211] Amplification AtC4H Gene expression cassette primer sequences
[0212] Feature 13- AtC4H -F:GGCCACGAAATTAGATAGCCAGAGACCGGGTTTGGCGGC, SEQ ID No.66
[0213] Feature 14 - AtC4H -R: TGGACAGGACTAGTTTTAGTCATCTCACTTGCGTATGTATGGA, SEQ IDNo.67
[0214] Amplification AtATR2 Gene expression cassette primer sequences
[0215] Feature 14 - AtATR2 -F: ACTAAAACTAGTCCTGTCCACGGAGAGACCGGGTTTGGCGGC, SEQ IDNo.68
[0216] dga1down- AtATR2 -R: GCCTAACCCAGGCAGTTTTCCATCTCACTTGCGTATGTATGGA, SEQ IDNo.69
[0217] Amplification of pUC19-DGA1Up-DGA1down primer sequences with homologous arms
[0218] dga1down-F: GAAAACTGCCTGGGTTAGGC, SEQ ID No.70
[0219] dga1up-R:AGCTTTTGTTTTGTGTGACTTG, SEQ ID No.71
[0220] Amplification yielded Cas9 protein and localization DGA1 Primer sequence for the pYlCas9-sgRNA-DGA1 fragment at the site
[0221] sgRNA-dga-F: GTTAGGCTCCAACGGCCACGCCTCGTTTTAGAGCTAGAAAT, SEQ ID No. 72
[0222] sgRNA-dga-R: AACGAGGCGTGGCCGTTGGAGCCTAACCAACCTGCGCCGAC, SEQ ID No. 73
[0223] A single colony of engineered strain jz106 was picked and inoculated into a test tube containing 2 mL of YPD medium and cultured in a shaker at 250 rpm and 30 °C for 24 h. The primary seed culture was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of YPD medium and cultured for 24 h at an inoculation rate of 1% (v / v) to obtain the secondary seed culture. The secondary seed culture was inoculated into a 250 mL Erlenmeyer flask containing 30 mL of YPD-40 medium at an inoculation rate of 5% (v / v). After fermentation under the same conditions for 96 h, the yield of coumaric acid was 1719.0 mg / L.
[0224] Example 5. Feed-in fermentation of strain JZ106 to produce glutaric acid
[0225] The specific operation for producing coumaric acid using a 5L fermenter with batch feeding is as follows:
[0226] Single clones of JZ106 were picked from the plate and inoculated into test tubes containing 2 ml of YPD medium. The culture was carried out at 30°C and 220 rpm with shaking for 24 h. The culture was then transferred to 500 ml Erlenmeyer flasks containing 100 ml of YPD medium and cultured with shaking for another 24 h to obtain the seed culture for batch fermentation. All 100 ml of the seed culture was transferred to 2 L of fermentation medium, which consisted of: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 12 ml / L vitamins, and 10 ml / L trace metal salts. The trace metal salt solution contained the following components: 5.75 g / L ZnSO4·7H2O, 0.32 g / L MnCl2, 0.32 g / L CuSO4, 0.47 g / L CoCl2, 0.48 g / L Na2MoO4, 2.9 g / L CaCl2·2H2O, 2.8 g / L FeSO4·7H2O, and 0.5 M EDTA. The vitamin solution contained the following components: 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L nicotinic acid, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxal phosphate, and 0.2 g / L para-aminobenzoic acid.
[0227] The batch fermentation temperature was 30℃, and the pH was controlled to 5.5 using ammonia. The fed-batch medium contained 800 g / L glucose. The culture medium was added continuously during fermentation, and the glucose concentration in the fermentation broth was controlled to be below 0.1 g / L. Product formation was monitored during the fermentation process. Ultimately, strain JZ106 fermented to produce 29.4 g / L of p-coumaric acid. Figure 3 As shown, this represents the highest level of reported de novo synthesis of coumaric acid to date.
[0228] It should be understood that those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.
Claims
1. A Yersinia lipolyticis engineered strain that produces p-coumaric acid using glucose as a substrate, characterized in that: This engineered bacterium integrates L-tyrosine aminolyase. TAL Gene, DAHP synthase ARO4 , DHS1 , AROG Genes, tyrosine synthase TYR Genes, histidine phosphotransferase HIS5 Genes and exogenous phenylalanine deamination hydroxylation pathway phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene, wherein the phenylalanine ammonia-lyase gene, cinnamate hydroxylase gene, and P450 reductase gene are integrated into diacylglycerol transferase. DGA1 site; The TAL The nucleotide sequence of the gene is shown in SEQ ID No. 1; ARO4 The nucleotide sequence of the gene is shown in SEQ ID No. 2; DHS1 The nucleotide sequence of the gene is shown in SEQ ID No. 3; AROG The nucleotide sequence of the gene is shown in SEQ ID No. 4; the nucleotide sequence of the TYR gene is shown in SEQ ID No. 5; HIS5 The nucleotide sequence of the gene is shown in SEQ ID No. 6; the nucleotide sequence of the phenylalanine ammonia-lyase gene is shown in SEQ ID No. 7; the nucleotide sequence of the cinnamate hydroxylase gene is shown in SEQ ID No. 8; and the nucleotide sequence of the P450 reductase gene is shown in SEQ ID No.
9. L-tyrosine aminolyase was extracted at two different gene loci. TAL Gene integration, integration of two copies of L-tyrosine aminolyase TAL Gene.
2. The engineered *Yarrowia lipophila* strain according to claim 1, characterized in that: The L-tyrosine ammonia-lyase TAL The gene is an L-tyrosine ammonia-lyase gene derived from Flavobacterium. FjTAL; DAHP synthase ARO4 , DHS1 , AROG In genes , ARO4 , DHS1 The gene is an endogenous enzyme gene. AROG Genes originating from E. coli EcAROG Genes; tyrosine synthase TYR Genes, histidine phosphotransferase HIS5 The gene is an endogenous gene; the gene for the exogenous phenylalanine deamination and hydroxylation pathway is an Arabidopsis-derived phenylalanine ammonia-lyase gene. AtPAL2 Cinnamate hydroxylase gene AtC4H P450 reductase gene AtATR2 .
3. The method for constructing the engineered *Yarrowia lipolytica* strain that produces p-coumaric acid using glucose as a substrate, as described in claim 1, is characterized in that: The L-tyrosine ammonia-lyase gene was integrated using the CRISPR / Cas9 localization and integration method. TAL In *Yarrowia lipophila* strains, the DAHP synthase gene was enhanced. ARO4 , DHS1 and AROG Overexpression of tyrosine synthase TYR Genes and histidine phosphotransferases HIS5 The protease gene, further in diacylglycerol transferase DGA1 The genes for the exogenous phenylalanine deamination and hydroxylation pathway of p-coumaric acid were obtained by site integration, including the phenylalanine ammonia-lyase gene, the cinnamate hydroxylase gene, and the P450 reductase gene.
4. The construction method according to claim 3, characterized in that: The L-tyrosine ammonia-lyase gene was integrated at two different gene loci, resulting in the integration of two copies of the L-tyrosine ammonia-lyase gene.
5. The construction method according to claim 3, characterized in that: Includes the following steps: 1) Integration of L-tyrosine ammonia-lyase gene at the intE1 site of *Yarrowia lipolytica* TAL ; 2) Based on the strain obtained in step 1), overexpress DAHP synthase at the intC3 site. ARO4 , DHS1 , AROG and L-tyrosine ammonia-lyase gene TAL Remove upstream DAHP synthesis restrictions and increase TAL Copy number; 3) Based on the strain obtained in step 2), enhance upstream tyrosine synthesis at the intE14 site. TYR Genes and histidine phosphotransferases HIS5 Gene; 4) Diacylglycerol transferase of the strain obtained in step 3) DGA1 Sites for overexpression of exogenous phenylalanine deamination hydroxylation pathway genes, including phenylalanine ammonia-lyase genes, cinnamate hydroxylase genes, and P450 reductase genes. 。 6. The use of the engineered Yersinia lipophila strain according to claim 1 or 2 in the production of p-coumaric acid using glucose as a substrate.
Citation Information
Patent Citations
CN116731885A
CN117737107A