Sorcpp-miR compound as well as use method and application thereof

Abstract

The invention belongs to the technical field of molecular biology and economic forest fungal disease control, and particularly relates to a SorcPp-miR compound, a using method and application. The invention provides application of miRNA162 to improvement of plant disease resistance, the nucleotide sequence of the miRNA162 is shown as SEQ ID NO.1, and the miRNA162 can improve the expression quantity of a disease-resistant gene VTE6 and prevent and treat plant diseases. The invention further provides a Sorcpp-miR compound, the Sorcpp-miR compound comprises the cell penetrating peptide and the miRNA162, and the cell penetrating peptide can carry the exogenous miRNA162 to enter plant cells and specifically enter organelles to target downstream anti-disease genes and promote the plant to improve the disease resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and prevention and control of economic forest fungal diseases, and specifically relates to a Sorcpp-miR complex, a use method and an application. Background Art

[0002] Plant fungal diseases cause huge losses to agricultural and forestry production, accounting for about 70% to 80% of plant diseases. According to statistics, the global food loss caused by fungal diseases is about 150 million tons per year, equivalent to 10% of the global population's food demand. In addition, fungal diseases have also caused varying degrees of losses to fruit trees, vegetables, flowers, medicinal plants, etc., seriously affecting the economic output of forests, crops, vegetables, etc. Studies have found that several or even dozens of fungal diseases can be found on one economic forest, such as grape gray mold, apple gray mold, crabapple powdery mildew, cotton anthracnose, apple rot, rice blast, etc. These fungal diseases reduce the growth and yield of economic forests, reduce the disease resistance and stress resistance of plants, increase the sensitivity of plants to other diseases and adversities, seriously affect the quality of plants, and cause huge economic losses.

[0003] At present, the main prevention and control methods for plant fungal diseases are physical or chemical methods to block the spread of pathogens. Physical methods include: selecting disease-resistant varieties; reasonably improving the field environment to reduce the infection conditions of pathogens; taking measures such as crop rotation, deep plowing, and removing diseased and dead bodies to reduce the overwintering or oversummering of pathogens. Chemical methods are mainly achieved by spraying chemical agents or biological agents at the right time. However, the above-mentioned prevention and control methods are time-consuming, inefficient, and costly in terms of energy and financial resources, and are not friendly to the ecology and the environment.

[0004] Plant microRNAs are a class of single-stranded RNA molecules with a length of 20 to 30 nucleotides. They can induce the silencing of specific genes through the RNA interference (RNAi) mechanism, thereby regulating gene expression and biological functions. Current studies have found that microRNAs play an important role in plant-pathogenic fungi interactions and can be delivered to recipient cells across species to modify plant disease resistance and pathogenic fungi. There are no reports on the application of miRNA162 in improving plant disease resistance in the prior art. Summary of the invention

[0005] The invention provides a Sorcpp-miR complex, a using method and an application, and miRNA162 has a good disease resistance effect.

[0006] In order to solve the above technical problems, the following technical solutions are proposed:

[0007] The present invention provides application of miRNA162 in improving plant disease resistance, and the nucleotide sequence of the miRNA162 is shown as SEQ ID NO.1.

[0008] Preferably, the disease resistance includes resistance to gray mold; and the plants include any one or more of grape, poplar, apple and crabapple.

[0009] Preferably, the miRNA162 regulates the expression of the disease resistance gene VTE6 to improve the ability of the plant to resist disease, and the nucleotide sequence of the VTE6 is shown in SEQ ID NO.2.

[0010] The present invention provides a Sorcpp-miR complex, comprising miRNA162 and a cell-penetrating peptide; the positively charged NH 3+ The negatively charged PO group in miRNA162 3 - The molar ratio is 1.5 to 2.5.

[0011] Preferably, the cell penetrating peptide comprises KH9.

[0012] Preferably, the complex further comprises a compounding agent; the compounding agent comprises sorbitol, sucrose and flavonoid compounds; the molar ratio of the sorbitol, sucrose and flavonoid compounds is 9-11:2:1; the molar ratio of the sorbitol and the cell penetrating peptide is 580-620:1.

[0013] The present invention provides a method for preparing a Sorcpp-miR complex, comprising:

[0014] The cell-penetrating peptide and miRNA162 were incubated to obtain CPPs-miRNA;

[0015] The CPPs-miRNA and a compounding agent are mixed to obtain a Sorcpp-miR complex; the compounding agent includes sorbitol, sucrose and flavonoid compounds; and the molar ratio of sorbitol to cell penetrating peptide is 580-620:1.

[0016] The present invention provides a method for using a Sorcpp-miR complex, comprising:

[0017] The Sorcpp-miR complex described in the above technical solution or the Sorcpp-miR complex obtained by the preparation method described in the above technical solution is applied to the plant.

[0018] The present invention provides the use of the Sorcpp-miR complex described in the above technical solution or the Sorcpp-miR complex obtained by the preparation method described in the above technical solution in preparing RNA pesticides and / or improving the ability of woody plants to resist fungal diseases.

[0019] The present invention provides an RNA pesticide, comprising the Sorcpp-miR complex described in the above technical solution or the Sorcpp-miR complex obtained by the preparation method described in the above technical solution.

[0020] Beneficial effects of the present invention: The present invention provides an application of miRNA162 in improving plant disease resistance. The nucleotide sequence of the miRNA162 is shown in SEQ ID NO.1. The miRNA162 can increase the expression level of the disease resistance gene VTE6 to prevent and control plant diseases.

[0021] The present invention also provides a Sorcpp-miR complex, comprising a cell-penetrating peptide and miRNA162, wherein the positively charged NH 3+ The negatively charged PO group in miRNA162 3 - The molar ratio is 1.5 to 2.5.

[0022] The present invention utilizes cell penetrating peptides (i.e., CPPs) to embed miRNA162 to form CPPs-miRNA, and utilizes small peptide CPPs to help miRNA162 penetrate cell walls, cell membranes and other organelles to enter plant cells, thereby exerting the function of CPPs as an embedding delivery carrier; by forming CPPs-miRNA, the time effectiveness of miRNA162 in exerting its function can be extended, which helps prevent miRNA162 from being degraded, and further enhances the disease resistance function of miRNA162 in plants.

[0023] The Sorcpp-miR complex of the present invention can resist plant diseases after spraying, and the targeting function of miRNA162 on plant-related disease resistance genes and pests and diseases is used to more efficiently resist pests and diseases and improve the prevention and control effect of diseases. The method of spraying the Sorcpp-miR complex of the present invention has the advantages of simple operation, green environmental protection, high specificity, strong stability, etc., which is conducive to the development and utilization of the Sorcpp-miR complex in a wider and larger area, and provides technology and ideas for preventing and controlling plant diseases and pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1The figure is the result of screening of disease-resistant miRNA, where a is the miRNA with significant differential expression after inoculation screened out through transcriptome; b is the miRNA with the most significant difference screened out through the corrected p value (*, p<0.05; **, p<0.01);

[0025] Figure 2 is the content of miRNA162 under different N / P ratios;

[0026] Figure 3 The stabilizing effect of the Sorcpp-miR system on embedded miRNA and cell-penetrating peptides, among which,

[0027] a is the electrophoresis band of the total miRNA content after exposure to different concentrations of sorbitol complex system for 1 hour; b is the statistical analysis result of the area size of the electrophoresis band; c is the statistical analysis result of the brightness of the electrophoresis band; d is the protein band diagram of SDS-PAGE electrophoresis and Coomassie brilliant blue staining; e is the relative data quantification diagram of the protein band in Figure d; Figure 3 The horizontal axes of each small figure a to e in the figure are the molar concentrations of the sorbitol complex;

[0028] Figure 4 This is a diagram showing the effect of spraying grape leaves with the Sorcpp-miR system on fungal diseases. The grape gray mold pathogen is Botrytis cinerea1-1, which is the pathogenic fungus of grape gray mold.

[0029] Figure 5 Statistical data of grape physiological indicators after spraying grapes with the Sorcpp-miRNA complex system, where a is the Figure 4 a is the statistics of the pathogen area; b is the statistics of the chlorophyll content of the leaves after the bacteria were connected;

[0030] Figure 6 is the expression level of targeted disease resistance genes in plants after spraying; A is the expression level of disease resistance gene VTE6, and B is the content of miRNA162;

[0031] Figure 7 Schematic diagram of the preparation of the Sorcpp-miR system and its related mechanism model. DETAILED DESCRIPTION

[0032] The present invention provides application of miRNA162 in improving plant disease resistance, and the nucleotide sequence of the miRNA162 is shown as SEQ ID NO.1.

[0033] The miRNA162 of the present invention preferably regulates the expression of the disease resistance gene VTE6 to improve the ability of plant disease resistance, and the nucleotide sequence of the VTE6 is shown in SEQ ID NO. 2. The miRNA162 can mediate the expression of the plant endogenous disease resistance gene VTE6, and the expression of miRNA162 can increase the expression level of VTE6, and ultimately improve the ability of plants to resist fungal diseases.

[0034] In the present invention, the disease resistance preferably includes resistance to gray mold; the pathogenic bacteria of gray mold preferably include Botrytis cinerea; and the plants include any one or more of grapes, apples, poplars and crabapples.

[0035] The present invention provides a Sorcpp-miR complex, comprising a cell-penetrating peptide and miRNA162, and more preferably comprising a cell-penetrating peptide, miRNA162 and a compounding agent. The cell-penetrating peptide of the present invention functions to embed miRNA162, deliver miRNA162 into plant cells through the cell-penetrating peptide's ability to penetrate plant cells, and specifically enter into organelles, targeting downstream disease-resistant genes, and prompting plants to improve their own disease resistance. The positively charged cell-penetrating peptide can bind to the negative charge in miRNA162 to achieve the embedding of miRNA162. The cell-penetrating peptide preferably comprises KH9. KH9 has the strongest ability to penetrate plant cells. The positively charged NH 3+ The negatively charged PO group in miRNA162 3 - The molar ratio of is preferably 1.5 to 2.5, and more preferably 2. The setting of the molar ratio can optimize the delivery effect of the cell penetrating peptide on miRNA162.

[0036] The compound of the present invention preferably includes sorbitol, sucrose and flavonoid compounds; the molar ratio of sorbitol, sucrose and flavonoid compounds is preferably 9-11:2:1, more preferably 10:2:1. The molar ratio of sorbitol and cell penetrating peptide of the present invention is preferably 580-620:1, more preferably 600:1.

[0037] The present invention has no special limitation on the source of the flavonoid compound, and conventional commercial products can be used. The flavonoid compound of the present invention has the function of improving the antioxidant capacity of the compound. In an embodiment of the present invention, the flavonoid compound is preferably derived from hyperoside. The function of the sucrose is to improve the antioxidant property of the compound.

[0038] The compound agent of the present invention acts as a solvent, stabilizes the protein complex formed by the cell penetrating peptide and miRNA162, forms a protective film on the surface of the protein complex, prevents the degradation of the cell penetrating peptide and miRNA162, and enhances the functional effect of the Sorcpp-miR complex. At the same time, sorbitol also has a certain ability to promote plant resistance to diseases, thereby improving the disease resistance of plants.

[0039] The Sorcpp-miR complex of the present invention improves the stability of miRNA162 in the external environment, enhances the efficiency of exogenous miRNA162 entering cells to target downstream disease resistance genes, and has a positive effect on improving plant disease resistance, increasing plant survival rate, and improving fruit yield and quality.

[0040] The present invention provides a method for preparing the Sorcpp-miR complex described in the above technical solution, comprising incubating the cell penetrating peptide and miRNA162 to obtain CPPs-miRNA; mixing the CPPs-miRNA and a compounding agent to obtain the Sorcpp-miR complex; the compounding agent comprises sorbitol, sucrose and flavonoid compounds; the molar ratio of sorbitol, sucrose and flavonoid compounds described in the present invention has been discussed above and will not be repeated here. The molar ratio of sorbitol to cell penetrating peptide is preferably 580-620:1, more preferably 600:1.

[0041] In the present invention, the cell penetrating peptide and miRNA162 are incubated to obtain CPPs-miRNA; more preferably, the cell penetrating peptide is added to a nuclease-free aqueous solution containing miRNA162 for incubation to obtain CPPs-miRNA, the incubation temperature is preferably 25°C, the incubation time is 0.3 to 1h, preferably 0.5h, and the incubation function is to form different N / P (NH 3 + / PO 3 - The molar ratio of the complex.

[0042] CPPs-miRNA is obtained. In the present invention, the CPPs-miRNA and the compounding agent are mixed to obtain a Sorcpp-miR complex. More preferably, the independently packaged CPPs-miRNA and the sorbitol compounding agent are mixed to obtain the Sorcpp-miR complex. The present invention does not specifically limit the parameters of the mixing, and conventional methods can be used. The Sorcpp-miR complex of the present invention has a protective effect against fungal diseases.

[0043] The present invention incubates and embeds the cell penetrating peptide with miRNA162 and then stabilizes it with a sorbitol compounding agent, and delivers the Sorcpp-miR complex into plant cells by spraying, thereby causing a large amount of expression of the targeted disease-resistant gene VTE6 to exert disease-resistant function.

[0044] The present invention provides a method for using a Sorcpp-miR complex, comprising:

[0045] The Sorcpp-miR complex described in the above technical solution is applied to the plant. The present invention provides the application of the Sorcpp-miR complex described in the above technical solution in enhancing the ability of woody plants to resist fungal diseases. The woody plants preferably include one or more of fruit trees, tea trees, woody food crops, woody oil crops and economic trees; the fruit trees preferably include apples and / or grapes; the economic trees preferably include poplars and / or crabapples. The application methods of the present invention include but are not limited to one or more of spraying, injection and high-pressure penetration. The total amount of spraying of the present invention is preferably 1.2 to 3 mL per leaf; the number of spraying is preferably 3 to 5 times, the amount of each spraying can be 300 to 500 μL, and the interval between two sprayings is 2 to 3 days. During the spraying of the present invention, the solution covers the entire leaf.

[0046] The total amount of injection of the present invention is preferably 1.2-3 mL per leaf, about 400-600 μL is applied each time, spraying is about 3-5 times, and the interval between two injections is 2-3 days. The total amount of high-pressure penetration of the present invention is preferably 1.2-3 mL per leaf, and the amount and time of each application are the same as the spraying method.

[0047] The present invention provides the use of the Sorcpp-miR complex described in the above technical solution in the preparation of RNA pesticides.

[0048] The present invention provides an RNA pesticide, comprising the Sorcpp-miR complex described in the above technical solution. The present invention has no special limitation on the dosage form of the RNA pesticide, and conventional products can be used.

[0049] As a small molecule nucleotide single strand, small molecule RNA is easily degraded by RNase when exposed to the environment. The existing cationic nanocarriers can effectively prevent RNA from degrading small molecule RNA, but they generally have the problems of high cost, difficult preparation, and low delivery efficiency. Therefore, it is necessary to provide an economical, efficient and stable small RNA administration carrier. Cell penetrating peptides (CPPs) are short peptides (less than 20 amino acids) that can promote the cell's uptake and absorption of nanoparticles, small compounds and large DNA fragments. In the field of animal research, CPPs nucleic acid complexes have been developed as a delivery carrier of siRNA, but in the field of plants, there are still very few related studies. The present invention develops a technical method for combining small molecule RNA with cell penetrating peptides to promote plants to resist fungal diseases. The method is simple to operate, green and environmentally friendly, and economical in price. It provides new ideas and new opportunities for the development of miSorcpp-miR complexes, which is of great significance for promoting the prevention and treatment of diseases in the agricultural, forestry, and fruit industries, and can be extended to a variety of species and multiple application scenarios, not limited to disease resistance, and provides new ideas for the future development of agricultural and forestry industries.

[0050] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] Example 1 Screening of miRNA and its targeted disease resistance genes

[0052] (1) The pathogenic fungus of grape gray mold (Botrytis cinerea) was inoculated on a PDA medium plate at -80°C for recovery and culture. When the fungus grew to nearly full plate, its spores were scraped into sterile water, and the spore growth and spore quantity were observed under a microscope. A spore suspension was obtained by dilution. The spore quantity in the suspension was 2.5×10 6 Pieces / mL.

[0053] (2) Take 12 leaves of grape plants, and infect 9 of them with the spore suspension of the pathogenic fungus of grape gray mold obtained in step (1); the process of infiltration is: a small wound is made on the leaves of the grape plants by a needle, and 10 μL of the spore suspension is inoculated on the wound; the remaining 3 leaves are used as controls and are not infected. Samples are taken at 0h, 8h, and 16h after infection, and all 12 leaves are sent to BioMed for miRNA omics determination.

[0054] The sequencing results were analyzed and screened, and the expression abundance and related functional annotations (such as Figure 1As shown in SEQ ID NO.1, miRNA162 was screened for further experiments; the nucleotide sequence of miRNA162 is shown in SEQ ID NO.1.

[0055] SEQ ID NO.1:

[0056] >miRNA162

[0057] UGAAGUCACUGGAUGCAGCGGUUCAUCGAUCUCUUCCUGAAAUUG UUGUGAAAAAAGCAGAUCAAGAAUCGGUCGAUAAACCUCUGCAUCCAG CGUUCACUCC.

[0058] (3) The pathogenic fungus of grape gray mold in step (1) is inoculated into plant leaves, and samples are taken after 0h, 8h, and 16h of infection, and transcriptomic sequencing is performed to screen miRNAs and predict and analyze related disease resistance target genes according to their expression levels. The disease resistance and miRNA expression levels are verified in plants by transient expression methods, and their disease resistance functions are compared to obtain disease resistance miRNAs and their disease resistance target genes.

[0059] At least three time points were set for sequencing samples to compare different miRNA expression levels, and leaves with the same state were used for sequencing. The transient expression method used a vacuum pump to infiltrate the Agrobacterium solution containing the overexpression vector pCAMBIA1300-miRNA162, and inoculated the pathogenic fungus of grape gray mold three days after the original environment was restored. The leaf state was observed after 7 to 8 days to determine its disease resistance.

[0060] Through relevant target gene prediction and relevant disease resistance gene expression level identification, it was screened that the promoter region of VTE6 had a targeting relationship with miRNA162 and was synergistically expressed, and VTE6 had corresponding disease resistance functions in previous reports; therefore, miRNA162 and VTE6 were used as miRNA and targeted disease resistance genes for further experiments; the nucleotide sequence of VTE6 is shown in SEQ ID NO.2.

[0061] SEQ ID NO.2:

[0062] >VTE6

[0063] ATGGCACTCTCAACGACTCTTTTCAGATTTCCTCCGATCCCACTCCAACAGTTCCACCACACCTCTTCCACCAAAAGACTTCTCTACCCCCGGATCAGCCCCCAATTCCCCAAAATGCCTCTCACCGCCAAGGCTCTCCCTAACCCTGTCCCTGGATTTAGGGGGGCAGTTTCGGAAGCCATCGCTCTCATCCAATCGTCACCCGCCACGTGGAAGTCGGCTCTTCTCAACAACTTCCTCATCTTCATTGCCGGCGCTCCGATCCTCGTCTCCGGCCTCTCGCTATCCGGCATCGCCGCCGCCTTCTTGCTCGGGACGCTGACATGGCGCGCCTTTGGATCACCTGGGTTTCTGCTCGTGGCTACATACTTCGTTATTGGGACGGCAGCCACAAAGGTGAAAATGGCACAGAAAGAGGCTCAAGGGGTTGCTGAGAAGAGGAAAGGAAGAAGAGGGCCTGGTAGTGTTATTGGTTCTAGTGCTGCTGGTTGTGTTTGTGCTTTTCTTTCCATATATGGGGTAGGGGGAGAGGCATTTTTGCAGCTTTGGCAACTTGGATTTGTTGCCAGTTTCTGTACTAAACTGAGTGATACTGTCTCAAGTGAGATAGGCAAGGCATATGGGAAAACAACGTACCTAGTTACAACATTGAAGATAGTTCCAAGAGGAACAGAAGGGGCTGTAAGTGCTGAGGGAACCTCTGCTGGACTTTTAGCATCAATTCTTCTTGCTTTTGTTGGTTGTCTCATGGGTCAGATTGATGCAGTGGAAGCAGTAATATGTGTAGTAGCTGCCCAGATTGCTAACCTTGGTGAGAGCTTTATCGGTGCTGCACTCCAGGGGAAGGAAGGATTTCGATGGCTCAACAATGATGTGGTCAATGTAATCAATATATCCATGGGCAGCATTTTAGCAATCTTGATACAGAAAATACTCCGCGGATTTTAA。

[0064] Screening of Cell-Penetrating Peptides (CPPs) in Example 2

[0065] (1) The reported cell-penetrating peptides (CPPs) were sorted out, and their functions were briefly described (see Table 1); cell-penetrating peptides with strong cell-penetrating ability were selected from the above CPPs for synthesis by artificial synthesis, and fluorescently labeled with TAMRA.

[0066] (2) Compounding and spraying experiment of CPPs: The CPPs synthesis company is Hangzhou Jingjie Biotechnology Co., Ltd., which uses the peptide solid phase synthesis method to synthesize each CPPs in Table 1 to obtain CPPs dry powder. After synthesis, each CPPs dry powder was dissolved in Tris-HCl buffer at pH = 7.4 to obtain CPPs solution, and the final concentration of CPPs in the CPPs solution was 0.1μg / mL; the CPPs solution was labeled with TAMRA, and 1mL of the labeled CPPs solution was loaded into a spray atomizer with a volume of 5mL, and 1.5mL was sprayed on each leaf, about 500μL each time, and sprayed about 3 times, with an interval of 2 minutes between each spraying. The leaves of two economic trees, grapes and apples, were selected as the leaves to be sprayed. Three leaves of each economic tree were selected as a group, and three groups were repeated for a total of 9 leaves. Each leaf was sprayed with a nozzle at a distance of 20 to 30 cm from the plant until the spray covered the entire leaf area. The plants were then covered with plastic covers and returned to standard cultivation conditions for grapes and apples.

[0067] (3) Data statistics and analysis of the cell penetration effect of CPPs after spraying: The leaf surface was cleaned at 30, 90, and 150 min after spraying, and the collected leaf samples were weighed and leaf lysates were extracted. The extraction process was as follows: the leaves were ground in liquid nitrogen and lysate to extract leaf lysate; the amount of lysate added was 100 μL, and the lysate was a mixture of 1× PBS buffer (pH 7.4) and TritonX 100, and the working concentration of TritonX 100 in the mixture was 0.1%. The fluorescence in the leaf lysate was measured using a fluorescence microplate reader at excitation wavelengths of 545 / 580 nm and emission wavelengths, respectively.

[0068] According to the ratio of the fluorescence value to mass of the TAMRA-CPPs marker, the linear regression equation of the CPPs content was obtained: in, Represents the content of CPPs, unit: μg, x i It represents the fluorescence value measured by TAMRA at 545 / 580 nm, in AU. According to the above linear regression equation, the content of CPPs in the sprayed leaves was calculated.

[0069] Table 1 Cell penetrating peptides (CPPs) reported in the prior art and their functional effect scores

[0070]

[0071]

[0072] Five CPPs were screened based on the penetration effect scores in Table 1: BP100, KH9, R9, d-R9, and R8 were used for the next step of TAMRA fluorescence intensity analysis experiments in grape (Vitis vinifera) and apple (Malus domestica) leaves; the results are shown in Table 2. According to Table 2, the average content of KH9 at each time end in both leaves was higher, so KH9 was selected for further experiments.

[0073] Table 2 Statistics of CPPs content after penetrating peptide spraying

[0074]

[0075] Example 3 Screening of N / P ratios of cell penetrating peptides (CPPs) encapsulating miRNA

[0076] (1) Hangzhou Jingjie Biotechnology Co., Ltd. synthesized miRNA to obtain a solution containing miRNA162, wherein the molar concentration of miRNA162 in the solution was 0.1 μmol / mL.

[0077] (2) The positively charged NH 3 + The negatively charged PO in the group and miRNA162 3 - The molar ratio of the groups is set as the N / P value. According to Table 3 below, miRNA162 and CPPs are compounded according to different N / P ratios. After the spraying experiment, the amount of miRNA162 in the leaves is increased (see Figure 2 and Table 3-1), screen and determine the optimal N / P ratio.

[0078] Table 3 Screening of different N / P ratios

[0079]

[0080] Table 3-1 Content of miRNA162 at different N / P ratios

[0081]

[0082] (3) The process of complexing miRNA162 and CPPs in step (2) is as follows: CPPs and miRNA162 are complexed in a centrifuge tube, incubated at 25°C for 30 minutes, and the formed CPPs-miRNA162 complex is diluted five times with DEPC water and placed in a small spray bottle for subsequent experiments.

[0083] (4) The spraying experiment in step (2) is specifically as follows: the entire leaf is sprayed with a small spray bottle, and after spraying evenly, it is moisturized with plastic wrap, placed under normal culture conditions for 3 hours, and the miRNA and target gene content are quantitatively analyzed using fluorescence quantification.

[0084] (5) According to the above miRNA quantification results (see Figure 2 As shown in Figure 2, it was found that when N / P=2, the delivery effect was optimal; therefore, N / P=2 was selected for further experiments.

[0085] Example 4 Screening and Configuration of Sorbitol Compounds

[0086] (1) The CPPs-embedded miRNA system prepared in Example 3 will have different degradation rates during preparation and spraying. The degradation rates of CPPs and miRNA162 at different times are shown in Table 4:

[0087] Table 4 Degradation rate of miRNA162 after CPPs encapsulation

[0088] Serial number CPPs content in the system (%) miRNA162 content in the system (%) Time (min) 1 100 100 0 2 98 99 30 3 95 92 60 4 89 80 90 5 84 77 120 6 80 65 150 7 75 51 180

[0089] According to Table 4, cell penetrating peptides (CPPs) and miRNA162 will be degraded to varying degrees when exposed, and miRNA162 will degrade particularly rapidly, with its content decreasing at a fast rate.

[0090] (2) It has been reported that sorbitol can stabilize protein complexes to a certain extent. In order to prevent the degradation of CPPs and miRNA162, sorbitol was used to prepare a sorbitol compound to stably encapsulate the CPPs and miRNA162 complex system.

[0091] The preparation method of the sorbitol compound is as follows: sorbitol, sucrose and flavonoid compound are mixed in a molar ratio of about 10:2:1, and the molar concentration of sorbitol in the obtained sorbitol compound is 15 mM.

[0092] Different concentrations of sorbitol, CPPs and miRNA162 were set, and gradient concentration experiments of sorbitol-encapsulated CPPs-miRNA162 were carried out to verify the specific sorbitol concentration for further experiments.

[0093] Specifically:

[0094] (1) The CPPs-miRNA encapsulated system is referred to as CPPs-miRNA162 complex. The preparation method of the CPPs-miRNA162 complex is the same as that of Example 3. The N / P of the CPPs-miRNA162 complex is 2.

[0095] (2) The concentration of the sorbitol compound is calculated based on the molar concentration of sorbitol, and the sorbitol compound of different concentrations is mixed with the CPPs-miRNA162 complex to obtain the Sorcpp-miRNA complex system. After 90 minutes, the degradation rates of CPPs and miRNA162 in the Sorcpp-miRNA complex system are measured. The schematic diagram of the preparation of the Sorcpp-miRNA complex and the related mechanism model is shown in Figure 7 The molar concentration gradient of sorbitol and the results are shown in Table 5.

[0096] Table 5 Effect of different sorbitol concentrations on the degradation rate of CPPs-embedded miRNA162

[0097]

[0098]

[0099] According to Table 5, sorbitol solution has a certain slowing effect on the degradation rate of CPPs-miRNA162. When the sorbitol concentration in the sorbitol compound is 15 mM, the degradation rate of CPPs and miRNA is the lowest.

[0100] The electrophoresis band verification results of total miRNA content after different concentrations of sorbitol complexes mixed with 25 μM Sorcpp-miR complexes were exposed for 1 hour are shown in Figure 3 In a, it can be seen that when the concentration of the complex is 15mM and 5mM, the miRNA band is brighter, proving that the amount of miRNA degradation is less. The area size of the electrophoresis band is statistically analyzed. Figure 3 In b, we can see that according to the statistical results, miRNA degradation is the least when the concentration of sorbitol complex is 15mM, followed by 5mM, and the degradation levels of other concentrations are similar. Therefore, the concentration of 15mM sorbitol complex is the best concentration to slow down miRNA degradation; the brightness statistical analysis of the electrophoresis bands is shown in Figure 3 In c, the concentration of the indicator miRNA is consistent with the above results. 15mM sorbitol complex is the concentration that slows down the degradation of miRNA. The protein bands of Sorcpp-miR complexes with different concentrations of sorbitol complexes were subjected to SDS-PAGE electrophoresis and Coomassie brilliant blue staining. Figure 3 d; It can be seen that the protein band is the darkest and the degradation amount is the smallest when the sorbitol complex concentration is 15mM; the relative data quantification results of the protein bands are shown in Figure 3 In Figure e, it can be seen that at a sorbitol complex concentration of 15 mM, the protein degradation of the CPPs penetrating peptide is minimal.

[0101] According to the experimental verification results ( Figure 3 In c and Table 5-3, Figure 3 b and Table 5-1, Figure 3 e and Table 5-2), it can be obtained that the sorbitol concentration is 15mM, and the sorbitol complex mixed with 25μM Sorcpp-miR complex has the best effect, that is, when the molar ratio of sorbitol to CPPs is 600:1, its functional effect may be optimal. The four sets of data in Table 5-1 and Table 5-3 represent 4 repeated experiments.

[0102] Table 5-1 Statistical analysis results of the area size of the electrophoresis bands of miRNA content

[0103]

[0104] Note: The average values ​​represent the mean of four replicate experimental results.

[0105] Table 5-2 Quantification of relative brightness data of protein bands in protein band diagram stained with Coomassie Brilliant Blue by SDS-PAGE electrophoresis

[0106] Complex concentration (mM) CK 5 10 15 20 0 Relative brightness of protein bands 1 0.109506 2.715336 3.829392 1.243142 0.233222

[0107] Table 5-3 Statistical analysis results of brightness of electrophoresis bands

[0108]

[0109] Example 5 Sorcpp-miRNA complex system spraying experiment and disease resistance analysis

[0110] (1) The concentration of the sorbitol compound is calculated based on the molar concentration of sorbitol. Sorbitol at a concentration of 15 mM is mixed with the CPPs-miRNA162 complex to obtain a Sorcpp-miRNA complex system. The molar ratio of sorbitol to CPPs is 600:1.

[0111] (2) To verify whether the Sorcpp-miRNA complex can play a functional role in helping plants resist diseases after exogenous application, experimental verification was carried out using a treatment group inoculated with pathogens and a control group not inoculated with pathogens.

[0112] Grape, as an economic forest fruit, often suffers from grape gray mold disease, which seriously affects the yield and benefits of economic fruits. Therefore, grape (Vitis vinifera L.) was used as the experimental material, and grape gray mold (BcCrh1) was used as the inoculum to inoculate grape leaves for the next experiment.

[0113] (3) Three treatment groups and one control group were set up, with three grape plants in each group; the Botrytis cinerea1-1 group (i.e., gray mold treatment group, grape gray mold pathogen) had three grape plants, the Botrytis cinerea1-1-Sorcpp-miR group (i.e., gray mold treatment-Sorcpp-miRNA group, grape gray mold pathogen-Sorcpp-miR) had three grape plants. The Botrytis cinerea1-1-Sorcpp-miR group (i.e., gray mold treatment-Sorcpp-miRNA group, grape gray mold pathogen-Sorcpp-miR) had three grape plants.

[0114] The three grape plants in the control group (referred to as control) were sprayed with distilled water at a spraying amount of about 1.5 mL per leaf, so that the distilled water covered the entire leaf, and distilled water was sprayed again after 3 days.

[0115] Three grape plants in the Botrytis cinerea1-1 group were sprayed with Botrytis cinerea1-1 spores suspended in sterile water at an inoculum concentration of about 2.5×10 -6 spores / mL, the spraying amount was about 1.5mL per leaf. After 3 days, the leaves inoculated with the pathogen were sprayed with distilled water, about 1.5mL per leaf, so that the distilled water covered the entire leaf.

[0116] Three grape plants in the Botrytis cinerea1-1-Sorcpp-miR group were sprayed with Botrytis cinerea1-1 spores resuspended in sterile water at an inoculum concentration of about 2.5×10 -6 spores / mL, and the spraying amount was about 1.5mL per leaf; 3 days later, the experimental group sprayed the leaves inoculated with the pathogen with the Sorcpp-miRNA complex solution, and each leaf was sprayed with about 1.5mL, so that the complex solution covered the entire leaf.

[0117] Gray mold-procymidone group: Three grape plants were sprayed with Botrytis cinerea1-1 spores suspended in sterile water, with an inoculum concentration of about 2.5×10 -6 spores / mL, the spraying amount is about 1.5mL per leaf; 3 days later, spray 1.5mL of dilution of procymidone (the procymidone product is "Huilong" brand, and the product should be diluted 1000 times according to the instructions before use) on the leaves inoculated with the pathogen, and take samples and take pictures 7 to 10 days after infection; Botrytis cinerea1-1 is Botrytis cinerea1-1.

[0118] (4) The phenotype picture of the above processing results is as follows Figure 4 As shown in Figure 2, the relevant physiological indicators and the expression levels of relevant key disease resistance genes are as follows Figure 5 , Figure 6, as shown in Tables 5-4 to 5-7; The above-mentioned inoculation and disease-resistant spraying experiments were carried out on grape leaves. Compared with the disease-resistant product procymidone on the market, the expression level of the disease-resistant gene VTE6 was increased by 198% (4.72 / 2.38383=1.98, i.e. 198%), and the area infected by the pathogen was reduced by 83.44%, as shown in Tables 5-4 to 5-7. Figure 4 , 5 , 6. Table 5-4 The percentage of pathogen area on grape leaves after spraying grapes with Sorcpp-miRNA complex system

[0119]

[0120] Note: 9 represents the number of repeated experiments.

[0121] Table 5-5 Chlorophyll content of grape leaves after spraying grapes with Sorcpp-miRNA complex system (unit: mg / g)

[0122]

[0123] Note: 3 represents the number of repeated experiments.

[0124] Table 5-6 Expression of the targeted disease resistance gene VTE6 in grapes after spraying grapes with the Sorcpp-miRNA complex system

[0125]

[0126] Note: 3 represents the number of repeated experiments; the gene expression level of the control group is taken as 1, and the relative expression levels of genes under different treatments are calculated. -ΔΔCT Methods The relative expression levels were calculated.

[0127] Table 5-7 miRNA162 content in grapes after spraying with Sorcpp-miRNA complex system

[0128]

[0129] Note: 3 represents the number of repeated experiments; the gene expression level of the control group is taken as 1, and the relative expression levels of genes under different treatments are calculated. -ΔΔCT Methods The relative expression levels were calculated.

[0130] According to the above experimental results, the Sorcpp-miRNA complex has a significant promoting effect on grape resistance to Botrytis cinerea and can significantly inhibit the spread of Botrytis cinerea lesions. At the same time, the expression of miRNA and its targeted disease resistance genes in grape leaves increased significantly, improving the ability of grapes to resist Botrytis cinerea.

[0131] In summary, CPPs were incubated and embedded with miRNA162 and then stabilized using a sorbitol complex. MiRNA162 was delivered to plant cells by spraying, causing massive expression of disease-resistant genes to exert disease-resistant functions.

[0132] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of miRNA162 in improving plant disease resistance, the nucleotide sequence of miRNA162 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The disease resistance includes resistance to gray mold; the plants include any one or two or more of grapes, poplars, apples and crabapples.

3. The use according to claim 1, characterized in that: The miRNA162 regulates the expression of the disease resistance gene VTE6 to improve the ability of plant disease resistance. The nucleotide sequence of VTE6 is shown in SEQ ID NO.

2.

4. A Sorcpp-miR complex, characterized in that comprising miRNA162 and a cell-penetrating peptide; wherein the cell-penetrating peptide has a positively charged NH 3+ The negatively charged PO group in miRNA162 3- The molar ratio is 1.5 to 2.

5.

5. The composite according to claim 4, characterized in that The cell penetrating peptides include KH9.

6. The composite according to claim 4, characterized in that The complex also includes a compounding agent; the compounding agent includes sorbitol, sucrose and flavonoid compounds; the molar ratio of the sorbitol, sucrose and flavonoid compounds is (9-11):2:1; the molar ratio of the sorbitol and the cell penetrating peptide is 580-620:

1.

7. A method for preparing a Sorcpp-miR complex, characterized in that: include: The cell-penetrating peptide and miRNA162 were incubated to obtain CPPs-miRNA; The CPPs-miRNA and a compounding agent are mixed to obtain a Sorcpp-miR complex; the compounding agent includes sorbitol, sucrose and flavonoid compounds; and the molar ratio of sorbitol to cell penetrating peptide is 580-620:

1.

8. A method for using a Sorcpp-miR complex, characterized in that: include: The Sorcpp-miR complex according to any one of claims 4 to 6 or the Sorcpp-miR complex obtained by the preparation method according to claim 7 is applied to the plant.

9. Use of the Sorcpp-miR complex according to any one of claims 4 to 6 or the Sorcpp-miR complex obtained by the preparation method according to claim 7 in preparing RNA pesticides and / or improving the ability of woody plants to resist fungal diseases.

10. An RNA pesticide, characterized in that: It comprises the Sorcpp-miR complex according to any one of claims 4 to 6 or the Sorcpp-miR complex obtained by the preparation method according to claim 7.

Images