Peptides for intracellular delivery

Abstract

The present invention relates to oligopeptides or salts thereof, which can be suitably hydrophobically tail-modified to produce amphiphilic molecules useful for intracellular delivery of biomolecules of interest. Thus, the invention also relates to amphiphilic molecules and complexes between said amphiphilic molecules and biomolecules of interest. Furthermore, the present invention relates to the use of said peptides, said amphiphilic molecules and said complexes for the delivery of biomolecules of interest. The present invention relates to the peptides or salts thereof, the amphiphilic molecules and the complexes for use in medicaments, in particular as vaccines. Methods of preparing the amphiphilic molecules and complexes of the invention are also envisaged. Finally, the invention relates to novel amino acids useful in the synthesis of the peptides and molecules of the invention.

Description

Technical Field

[0001] The present invention relates to short peptides or salts thereof which can be modified with suitable hydrophobic tails to produce amphiphiles useful for intracellular delivery of biomolecules of interest. The present invention further relates to amino acids suitable for the synthesis of the peptides or salts thereof of the present invention. Background Art

[0002] Functional nucleic acids and / or proteins are delivered to cells and continue to be a major challenge for chemistry, biology and materials science. New methodologies and recent breakthroughs have renewed the concerns about new tools for effective intracellular delivery (such as functional nucleic acids and / or protein delivery). However, despite all the progress achieved in the past few years, current technologies still suffer from major limitations. These may relate to nucleic acid or protein cargo, or delivery vehicles. Nucleic acid cargo suffers from potential permanent recombination of plasmids, sensitivity to nuclease degradation of nucleic acids (such as ssRNA) and problematic immunological responses that can be triggered by any type of nucleic acid. Delivery vehicles can be viral or non-viral vectors. Although extremely effective and also selective in some cases, viral vectors have major limitations related to their potential biosafety concerns, their immunogenicity and the low level of DNA packaging capacity. As an alternative, different non-viral vectors have been developed to reach and improve nucleic acid and protein delivery, and the carriers include lipids, peptides, nanoparticles, polymers and supramolecular systems. However, non-viral vectors still present significant obstacles and limitations, such as poor packaging and protection of the cargo, low stability of the resulting complexes, immune responses, escape from the endocytic pathway and, most importantly, low efficiency and high cytotoxicity. In this context, short cationic peptides have been described in the literature as suitable non-viral vectors when modified with appropriate chemical tails. For example, I. Louzao, R. and J.Montenegro, Hydrazone-modulated peptides for efficient gene transfection, J.Mater.Chem.B, 2017 describe hydrazone formation to regulate the transfection activity of parent linear peptides combined with plasmid DNA cargo. Similarly, I.Lostalé-Seijo et al., Peptide / Cas9 nanostructures for ribonucleoprotein cell membrane transport and gene edition, Chem.Sci., 2017 report a supramolecular strategy for direct delivery of Cas9 ribonucleoprotein by amphiphilic penetrating peptides, which are prepared by hydrazone bond formation between cationic peptide scaffolds and hydrophobic aldehyde tails. These contributions show that there is a need in the prior art for the development of peptide-based non-viral vectors for wide application in the intramolecular delivery of biological cargoes of interest. Summary of the invention

[0003] The present inventors have discovered peptides, or salts thereof, which can be modified with a hydrophobic tail to produce an amphiphile useful for intracellular delivery of a biomolecule of interest.

[0004] In a first aspect, the present invention relates to a peptide or a salt thereof,

[0005] a) wherein the peptide or a salt thereof has a length of 7 to 21 amino acids,

[0006] b) wherein the peptide or its salt comprises a basic amino acid residue selected from the group consisting of (i) arginine (R), (ii) histidine (H) and (iii) a reactive basic amino acid residue containing a reactive group on its side chain, and optionally a hydrophobic amino acid residue selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), wherein, if present, the hydrophobic amino acid is less than 50% of the total number of amino acids in the peptide,

[0007] c) wherein the number of arginine in the peptide or its salt is from 2 to 10,

[0008] d) wherein the number of histidine in the peptide or its salt is from 0 to 3,

[0009] e) wherein the number of reactive basic amino acid residues containing reactive residues in their side chains in the peptide or its salt is 3,

[0010] f) wherein the number of hydrophobic amino acids in the peptide or its salt is from 0 to 8;

[0011] g) wherein in the peptide amino acid sequence, there are no more than two consecutive amino acids of the same residue, with the exception of the reactive basic amino acid residue containing a reactive group in its side chain and the amino acid arginine, in which case there may be up to three consecutive arginine residues and / or up to three consecutive reactive basic amino acid residues containing a reactive group in its side chain; and

[0012] h) the amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all the amino acids contained in the peptide are L-amino acids or all the amino acids contained in the peptide are D-amino acids.

[0013] Preferably, the peptide or salt thereof of the present invention is a cationic peptide. The peptide or salt thereof of the present invention is suitable for forming the amphiphile of the present invention, as described below. In a preferred embodiment, the amino acid at the N-terminus of the peptide is arginine (R).

[0014] Preferably, the reactive basic amino acid residue containing a reactive group on its side chain is an amino acid as defined in formula (I):

[0015]

[0016] Wherein, if B is absent, A is a reactive group, preferably a primary amine. If B is present, A is preferably an amide bond, but may also be a secondary amine or any other functional group, such as a functional group derived from an original basic amino acid. If present, B is a spacer group attached to the reactive group, as described herein, and n is 1, 2, 3, 4, 5, 6, 7, 8 or more, preferably n is 1, 2, 3 or 4, more preferably 3 or 4.

[0017] In a second aspect, the present invention relates to an amphiphilic molecule comprising or consisting of:

[0018] a) a peptide as defined in the first aspect of the present invention or a salt thereof and

[0019] b) three hydrophobic tails,

[0020] wherein each hydrophobic tail is linked to the peptide or its salt by a covalent bond, and the covalent bond is formed by the reaction between (i) a reactive group in the side chain of the reactive basic amino acid residue of the peptide and (ii) a precursor of the hydrophobic tail, wherein the precursor of the hydrophobic tail comprises the hydrophobic tail and a second reactive group that can react with the reactive group in the side chain of the reactive basic amino acid residue of the peptide or its salt.

[0021] In a third aspect, the present invention relates to a composite comprising:

[0022] a) at least one amphiphilic molecule as defined in the second aspect of the invention, and

[0023] b) at least one biomolecule of interest.

[0024] In another aspect, the present invention relates to the use of a peptide of the present invention or a salt thereof, an amphiphilic molecule of the present invention or a complex of the present invention for delivering a biomolecule of interest.

[0025] In still another aspect, the present invention relates to the peptide of the present invention or a salt thereof, the amphiphilic molecule of the present invention or the complex of the present invention for use in medicine (as a medicament).

[0026] In another aspect, the present invention relates to a peptide or salt thereof, an amphiphilic molecule of the present invention or a complex of the present invention for use as a vaccine, or as an immunogenic composition. The present invention further provides a vaccine comprising a peptide or salt thereof, an amphiphilic molecule of the present invention or a complex of the present invention. Thus, the biomolecule of interest can produce an immune response in a subject.

[0027] In another aspect, the present invention relates to a method for preparing an amphiphilic molecule according to the present invention, wherein the method comprises contacting a solution of a peptide of the present invention in an organic solvent with a solution of a precursor of a hydrophobic tail, wherein the precursor of the hydrophobic tail comprises a reactive group that reacts with a reactive group in the side chain of a reactive basic amino acid residue in the peptide or a salt thereof under conditions suitable for forming a covalent bond between the reactive group of the precursor of the hydrophobic tail and the reactive group of the peptide or a salt thereof, wherein the conditions consist of:

[0028] - when the reactive group in the precursor of the hydrophobic tail is an aldehyde, an acidic medium, or

[0029] - When the reactive group in the precursor of the hydrophobic tail is an alcohol or a carboxylic acid, a basic medium and in the presence of a carboxylic acid activator reagent.

[0030] In another aspect, the present invention relates to a method for preparing a complex according to the present invention, which comprises contacting a solution of an amphiphilic molecule of the present invention with a solution of at least one biomolecule of interest in a suitable medium under conditions suitable for the formation of a complex between the amphiphilic molecule and the biomolecule of interest.

[0031] In another aspect, the present invention relates to a method for delivering a biomolecule of interest to a cell population in vitro, comprising

[0032] (i) contacting a first solution of an amphiphilic molecule of the invention in a suitable solvent with a second solution comprising a biomolecule of interest in a suitable solvent under conditions suitable for forming a complex between the amphiphilic molecule and at least one biomolecule of interest; and

[0033] (ii) adding the complex obtained in step (i) to the cell population under conditions suitable for delivering the biomolecule of interest to the cell population.

[0034] In another aspect, the present invention relates to a method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, the method comprising contacting at least "n" peptides or salts thereof according to the present invention in an organic solvent with at least "3n" precursors of hydrophobic tails, each precursor comprising a hydrophobic tail and a reactive group that reacts with a reactive group in the side chain of a basic amino acid in the peptide or its salt, wherein the contacting is carried out under conditions suitable for forming a covalent bond between the precursor of the hydrophobic tail and the reactive group in the side chain of a basic amino acid in the peptide or its salt. "n" corresponds to a natural number, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. Preferably, the contacting step of the method for obtaining a library of amphiphilic molecules is carried out by contacting at least one type of peptide or salt thereof with at least one type of precursor of the hydrophobic tail separately. For example, in the method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, at least 2 peptides or salts thereof as defined in the present invention are contacted in an organic solvent with at least 6 precursors of the hydrophobic tail as described above.

[0035] Furthermore, the present invention relates to a library comprising at least two different amphiphilic molecules, each amphiphilic molecule comprising:

[0036] (i) the peptide of the present invention or a salt thereof and

[0037] (ii) three hydrophobic tails,

[0038] wherein the hydrophobic tail is connected to the peptide via a bond formed by a reaction between a reactive group in the side chain of a reactive basic amino acid residue in the peptide or a salt thereof and a precursor of the hydrophobic tail, wherein each precursor of the hydrophobic tail contains the hydrophobic tail and a second reactive group that can react with a reactive group in the side chain of a reactive basic amino acid residue in the peptide or a salt thereof, and wherein one amphiphilic molecule is different from at least another amphiphilic molecule in the peptide and / or the hydrophobic tail.

[0039] Additionally, the present invention relates to a method for identifying an amphiphilic molecule suitable for delivering a biomolecule of interest into a cell, the method comprising:

[0040] (i) contacting the biomolecule of interest with the library of the present invention under conditions suitable for the binding of the amphiphilic molecule to the biomolecule of interest;

[0041] (ii) optionally, selecting amphiphilic molecules that bind to the biomolecule of interest from those that do not bind to the biomolecule of interest, and

[0042] (iii) Screening for amphiphilic molecules suitable for delivering biomolecules of interest into cells.

[0043] Finally, the present invention relates to amino acids having formula (III) or formula (IV):

[0044]

[0045]

[0046] in:

[0047] -X is an N-terminal protecting group,

[0048] -Y is a hydrazide (Formula III) or aminooxy (Formula IV) reactive group protecting group,

[0049] - n is the length of the side chain of the amino acid (n = 2 to 4; Dab, Orn and Lys), and

[0050] - m is the length of the linker containing the reactive group (m = 1 to 10, preferably 1 to 5, more preferably 1 to 3). BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 . Schematic overview of the peptide synthesis procedure.

[0052] Figure 2 . Editing percentage (bars, left axis) in HeLa-EGFP cells incubated with Cas9 ribonucleoprotein with gRNA targeting EGFP using amphiphiles containing 7.3 (Leu-His) peptides and myristene aldehyde, palmitene aldehyde or phloemene aldehyde. After 3 days, EGFP-negative cells (bars; left axis) and cell concentrations (dots; right axis) were quantified by flow cytometry. ([Cas9] = 50 nM, amphiphile concentration in μM).

[0053] Figure 3 . Transfection efficiency of EGFP pDNA in HeLa cells with an amphiphile (7.3(LH)M) containing the 7.3(Leu-His) peptide synthesized using D- and L-amino acids and myristenaldehyde.

[0054] Figure 4 . Transfection efficiency of EGFP pDNA in HeLa cells at different concentrations (60000, 120000 and 240000 cells / mL) with an amphiphile (7.3(LH)M) containing the 7.3(Leu-His) peptide and myristenaldehyde.

[0055] Figure 5Transfection efficiency (% GFP-positive cells) of EGFP pDNA containing the 7.3(Leu-His) peptide and myristenaldehyde amphiphile (7.3(LH)M) at different concentrations in CEFs (chicken embryonic fibroblasts) compared with Lipofectamine 2000 (LF) and trans-IT-LT1 transfection reagent (Mirus).

[0056] Figure 6 EGFP pDNA transfection efficiency in A549, HeLa and HepG2 cell lines via amphiphiles containing peptide 7.3(LH) and other short peptides structurally derived from 7.3(LH) (in all cases using a myristenaldehyde hydrophobic tail). 5 μM amphiphile and 2 ng / μL pDNA / well were used in the transfection experiments. 2000 commercially available reagents.

[0057] Figure 7 In vivo mRNA transfection. Representative bioluminescence images and quantification at different times (1 hour, 4 hours, 7 hours, 24 hours and 48 hours) after im (intramuscular) injection of naked FLuc mRNA (0 μM) or 7.3 (Leu-His) M amphiphile / mRNA complexes (2.5, 5 and 10 μM). 5 μg FLuc mRNA was used in all conditions. 7.3 (Leu-His) M refers to the 7.3 (Leu-His) cationic peptide linked to myristenaldehyde.

[0058] Figure 8 In vivo mRNA transfection. Representative bioluminescence images and quantification at different times (1 hour, 4 hours, 7 hours, 24 hours and 48 hours) after im (intramuscular) injection of naked FLuc mRNA (0 μM) or 7.3 (Leu-His) PA amphiphile / mRNA complexes (2.5, 5 and 10 μM). 5 μg FLuc mRNA was used in all conditions. 7.3 (Leu-His) PA refers to the 7.3 (Leu-His) cationic peptide linked to palmitoleic aldehyde.

[0059] Fig. 9 . In vivo mRNA transfection. Representative bioluminescence images and quantification at different times (1 h, 4 h, 7 h, 24 h, and 48 h) after im (intramuscular) injection of FLuc mRNA / amphiphile complexes. 1.25, 3, and 5 μg FLuc mRNA were used as indicated. 2.5 μM 7.3(Leu-His)M was used in all conditions.

[0060] Fig.10.A) In vivo mRNA transfection. Representative bioluminescence images of animals and extracted organs at different times (1 h, 4 h, 7 h and 24 h) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (0, 2.5 and 5 μM 7.3(Leu-His)M). 1.3 μg FLuc mRNA was used in all conditions. B) Quantification of bioluminescence of organs.

[0061] Fig.11 .A) In vivo mRNA transfection. Representative bioluminescence images of mice and extracted organs at different times (1 hour, 4 hours, 7 hours and 24 hours) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (125 and 250 μM 7.2M). 5 μg FLuc mRNA / mouse was used. B) Quantification of bioluminescence of organs.

[0062] Fig.12 .A) In vivo mRNA transfection. Representative bioluminescence images of mice and extracted organs at different times (1 h, 4 h, 7 h and 24 h) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (125 and 250 μM 7.2DO). 5 μg FLuc mRNA / mouse was used. B) Quantification of bioluminescence of organs.

[0063] Fig.13 .A) In vivo mRNA transfection. Representative bioluminescence images of mice and extracted organs at different times (1 h, 4 h, 7 h and 24 h) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (125 and 250 μM 9.2DO). 5 μg FLuc mRNA / mouse was used. B) Quantification of bioluminescence of organs.

[0064] Fig.14 In vivo mRNA transfection. Metabolic bioluminescence images and quantification at different times (1 h, 4 h, 7 h, 24 h and 48 h) after id (intradermal), im (intramuscular) or sc (subcutaneous) injection of FLuc mRNA / amphiphile complexes. 2.5 μM 7.3(Leu-His) M and 5 μg FLuc mRNA were used in all conditions.

[0065] Fig.15.A- DLS results of amphiphilic complex 7.3M+pDNA (100ng, in vitro conditions). The complex was prepared by mixing different concentrations (x-axis) of freshly prepared amphiphilic molecule 7.3M with 100ng EGFP pDNA in water for 30 minutes. Then, the pH was adjusted to different values ​​(4 to 10), and the particle size (upper figure: bars represent average diameter, left axis; square points represent PDI, right axis) and zeta potential (lower figure) measurements were recorded. B- DLS results of amphiphilic complex 7.3(LH)M+pDNA (100ng, in vitro conditions). The complex was prepared by mixing different concentrations (x-axis) of freshly prepared amphiphilic molecule 7.3(LH)M with 100ng EGFP pDNA in water for 30 minutes. Then, the pH was adjusted to different values ​​(4 to 10), and the particle size (upper figure: bars represent average diameter, left axis; square points represent PDI, right axis) and zeta potential (lower figure) measurements were recorded. C- DLS results of amphiphilic complex 7.3M+mRNA (50ng, in vitro conditions). The complex was prepared by mixing freshly prepared amphiphilic molecule 7.3M with 50ng EGFP mRNA in water for 30 minutes at different concentrations (x-axis). Then, the pH was adjusted to different values ​​(4 to 10), and the particle size (upper figure: bars represent average diameter, left axis; square points represent PDI, right axis) and zeta potential (lower figure) measurements were recorded. D- DLS results of amphiphilic complex 7.3(LH)M+mRNA (50ng, in vitro conditions). The complex was prepared by mixing freshly prepared amphiphilic molecule 7.3(LH)M with 50ng EGFP mRNA in water for 30 minutes at different concentrations (x-axis). Then, the pH was adjusted to different values ​​(4 to 10), and the particle size (upper figure: bars represent average diameter, left axis; square points represent PDI, right axis) and zeta potential (lower figure) measurements were recorded.

[0066] Fig.16 . In vivo mRNA transfection. A-Representative bioluminescence images of mice and extracted organs at different times (1 hour, 4 hours, 7 hours and 24 hours) after iv (intravenous) injection of FLuc mRNA / amphiphile complex (125 μM 7.3(Leu-His)M). 5 μg FLuc mRNA / mouse was used. Ratios 1:100, 1:200 and 1:400 represent the volume ratios between the DMSO phase containing the amphiphile and the aqueous buffer containing the mRNA cargo during the formulation step. "mRNA" labeled mice were injected with the mRNA cargo without any carrier. B-Quantification of bioluminescence of organs.

[0067] Fig.17Mice were immunized iv with 7.3(Leu-His)M / SARS-CoV-2 spiked mRNA complexes on days 0 and 21, and on days 14 ( Fig.17 A) and 35 days (after 2 weeks of boosting) ( Fig.17 B) Serum levels of S1-specific IgG were determined by ELISA. Data are shown as optical density (in duplicate) of two dilutions of sera from mice immunized with two different amphipathic / mRNA preparations (rt57-62) and control mice treated with naked mRNA only (mRNA1-2). The detection limit (dashed line) was established to be three times the blank value. rt57-rt62 refers to the specific mice included in the group (arbitrary).

[0068] Fig.18 MTT cell viability assay in different cell lines after incubation in the presence of increasing concentrations (0 to 100 μM) of the amphiphile 7.3(LH)M.

[0069] Fig.19 .A) In vivo mRNA transfection. Representative bioluminescent images of mice and extracted organs at different times (1 h, 4 h, 7 h and 24 h) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (125 and 250 μM amphiphile 13.2O, in all cases complexed with 1.3 μg FLuc mRNA). B) Quantification of organ bioluminescence.

[0070] Fig. 20 .A) In vivo mRNA transfection. Representative bioluminescence images of mice and extracted organs at different times (1 hour, 4 hours, 7 hours and 24 hours) after iv (intravenous) injection of FLuc mRNA / amphiphile complexes (125 and 250 μM 9.2M). 5 μg Fluc mRNA / mouse was used. B) Quantification of organ bioluminescence.

[0071] Fig.21 Mice were immunized iv with 7.3(Leu-His)M / OVA mRNA complexes on days 0 and 21, and serum levels of OVA-specific IgG were determined by ELISA on day 35 (2 weeks after boosting) ( Fig.21A). Data are shown as optical density of two dilutions of sera (in duplicate) from mice immunized with two different formulations: amphipathic / mRNA alone (rt1-3) or in the additional presence of CpG ODN adjuvant (rt4-6) and control mice treated with naked mRNA only (mRNA1-2) or PBS (PBS). The detection limit (dashed line) was established as three times the blank value. Rt1-6 refers to the specific mice included in the group (arbitrary). B) Serial dilutions of sera obtained on day 35 (dilution factor ranging from 10 to 20) were analyzed by ELISA using anti-mouse IgG1 or IgG2c secondary antibodies (1:2000). 2 Up to 10 9 ) To determine antibody isotype and characterize the type of immune response by titer.

[0072] Fig. 22 . Recorded amphiphile 7.3(LH)M in DMSO-d6 1 H NMR spectroscopy.

[0073] Fig.23 EGFP mRNA transfection efficiency in HeLa (upper part) and A549 (lower part) cells by different concentrations (2.5 to 10 μM) of 7.3(H,V), 7.3(H,I) and the amphiphile containing 7.3 peptide and myristenaldehyde. The % of GFP-positive cells was quantified by flow cytometry.

[0074] Fig.24 EGFP pDNA transfection efficiency in HeLa (upper part) and A549 (lower part) cells with different concentrations (2.5 to 10 μM) of the amphiphile containing NH2-7.3(LH) peptide and myristenaldehyde. The % of GFP-positive cells was quantified by flow cytometry.

[0075] Fig.25 EGFP pDNA transfection efficiency in HeLa cells with different concentrations (2.5 to 10 μM) of the amphiphile containing 7.3(LH)-OH (non-C-amidated peptide) and 7.3(LH) peptide with myristenaldehyde. The % of GFP-positive cells was quantified by flow cytometry.

[0076] Fig.26 EGFP pDNA transfection efficiency in HeLa (upper part) and A549 (lower part) cells with different concentrations (2.5 to 10 μM) of 7.3(LH)(K-Dab), 7.3(LH)(KO) and the amphiphile of 7.3(LH) peptide with myristenaldehyde. The % of GFP-positive cells was quantified by flow cytometry.

[0077] Fig. 27EGFP mRNA transfection efficiency in HeLa (upper part) and A549 (lower part) cells with different concentrations (2.5 to 10 μM) of 7.3(LH, ONH2), 7.3(LH, C4Hyd) and the amphiphile containing 7.3(LH) peptide and myristenaldehyde. The % of GFP-positive cells was quantified by flow cytometry.

[0078] Fig.28 . Schematic overview of an alternative peptide synthesis procedure using Fmoc-Lys(Boc-Hyd)-OH (also known as Fmoc-Lys(Boc-glutaric acid monohydrazide)-OH) during the peptide elongation phase as an example of using a synthetic amino acid with general formula (III).

[0079] Fig.29 Quantification of siRNA-induced GFP silencing after transfection with different amphiphile-siRNA preparations at different amphiphile concentrations (5 and 10 μM, black bars). siMock-amphiphile complexes were used as controls (light grey bars) and the silencing efficiency was compared with 2000(lipo) comparison.

[0080] Fig.30 Ex vivo spleen bioluminescence readout after mRNA administration (5 μg) of different formulations containing 7.3 (LH)M prepared under different stoichiometric conditions between the reactive hydrazide peptide and the hydrophobic aldehyde tail (0 to 5 equivalents of myristenaldehyde relative to the reactive hydrazide).

[0081] Fig.31 Mice were immunized with 7.3(Leu-His)M / OVA mRNA complexes by im (left) or iv (right) on days 0 and 21, and serum levels of OVA-specific IgG were determined by ELISA over time, on a monthly basis (readout for the first month was performed on day 35, 2 weeks after the boost).

[0082] Fig.32 .Ex vivo tdTomato fluorescence activation after iv administration using 2 different 7.3(Leu-His)M formulations by Cre mRNA delivery. tdTomato fluorescence in major organs was detected and quantified 2 days after administration (upper panel). The mean fluorescence intensity was normalized to the PBS-treated group (black column) of different tissues (lower panel). DETAILED DESCRIPTION

[0083] The present inventors have discovered peptides that can be modified with appropriate hydrophobic tails to produce amphiphilic compounds that can be used for intracellular delivery of biomolecules of interest.

[0084] Peptides

[0085] In a first aspect, the present invention relates to a peptide or a salt thereof

[0086] ● wherein the peptide or its salt has a length of 7 to 21 amino acids,

[0087] wherein the peptide or a salt thereof comprises a basic amino acid selected from the group consisting of arginine (R), histidine (H) and a reactive basic amino acid residue containing a reactive group in its side chain,

[0088] ● wherein the peptide or its salt optionally comprises a hydrophobic amino acid selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), wherein, if present, the hydrophobic amino acid is less than 50% of the total number of amino acids in the peptide or its salt,

[0089] ● wherein the number of arginines in the peptide is from 2 to 10,

[0090] ● wherein the number of histidine in the peptide is 0 to 3,

[0091] ● wherein the number of reactive basic amino acid residues having a reactive group in their side chains in the peptide or a salt thereof is 3,

[0092] ● wherein the number of hydrophobic amino acids in the peptide or its salt is from 0 to 8;

[0093] wherein in the peptide amino acid sequence, there are no more than two consecutive amino acids of the same residue, with the exception of reactive basic amino acid residues containing a reactive group in their side chains and the amino acid arginine, in which case there may be up to three consecutive arginine residues and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains; and

[0094] ●The amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all the amino acids contained in the peptide or its salt are L-amino acids or all the amino acids contained in the peptide or its salt are D-amino acids.

[0095] Preferably, the peptide or salt thereof of the present invention is a cationic peptide. Preferably, the N-terminal amino acid of the peptide or salt thereof of the present invention is arginine.

[0096] Preferably, in the peptide amino acid sequence, no more than two consecutive hydrophobic amino acids are present.

[0097] The peptides of the present invention or their salts are suitable for forming the amphiphilic molecules of the present invention, as described below.

[0098] As used herein, the term "peptide" refers to a sequence of amino acids, analogs or mimetics having substantially similar or identical functions, wherein the one or more amino acids, analogs or mimetics are linked to each other by peptide bonds. The term "peptide" also includes analogs of synthetic and natural amino acids linked by peptide bonds. As used herein and in the claims, peptides are also intended to include analogs, derivatives, salts, reverse-trans isomers, mimetics, mimetics or peptidomimetics thereof. For example, the peptide structure of the modulator of the present invention can be further modified to increase its stability, bioavailability, solubility, etc. "Analogs," "derivatives," and "mimics" include molecules that mimic the chemical structure of the peptide structure and retain the functional properties of the peptide structure. Methods for designing peptide analogs, derivatives, and mimetics are known in the prior art. For example, see Farmer, PS, Drug Design (EJ Ariens, ed.) Academic Press, New York, 1980, Vol. 10, pp. 119-143; Ball, JB and Alewood, PF (1990) J. Mol. Recognition 3:55; Morgan, BA and Gainor, JA (1989) Ann. Rep. Med. Chem. 24:243; and Freidinger, RM (1989) Trends Pharmacol. Sci. 10:270. See also Sawyer, TK (1995) Peptidomimetic Design and Chemical Approaches to Peptide Metabolism, Taylor, MD and Amidon, GL (eds.) Peptide-Based Drug Design: Controlling Transport and Metabolism, Chapter 17; Smith, AB et al., 3rd edition (1995) J. Am. Chem. Soc. 117: 11113-11123; Smith, AB et al., 3rd edition (1994) J. Am. Chem. Soc. 116: 9947-9962; and Hirschmann, R. et al. (1993) J. Am. Chem. Soc. 115: 12550-12568. "Derivatives" (e.g., peptides or amino acids) include forms in which one or more reactive groups on the compound have been derivatized with a substituent. Examples of peptide derivatives include peptides in which the amino acid side chains, the peptide backbone, or the amino or carboxyl termini have been derivatized (e.g., peptide compounds having methylated amide linkages). "Analogs" of compound X include compounds that retain the chemical structure necessary for functional activity but also contain certain chemical structures that are different.Examples of analogs of naturally occurring peptides are peptides comprising one or more non-naturally occurring amino acids. The "mimetic" of a compound comprises a compound in which the chemical structure of the compound necessary for functional activity has been replaced by other chemical structures of the configuration of the simulated compound. Examples of peptidomimetics include peptide compounds in which the peptide backbone is replaced by one or more benzodiazepine molecules (see, e.g., James, GL et al. (1993) Science 260: 1937-1942). In a specific embodiment, the N-terminus of the peptide is terminated by an acyl group, and the C-terminus of the peptide is terminated by an amino group. In another specific embodiment, the acyl group is an acetyl group, and the amino group is a primary amino group.

[0099] The salt of the peptide of the present invention includes the salt with physiologically acceptable acid addition salt. Examples of these salts are peptide salts with inorganic acids (e.g., hydrochloric acid, phosphoric acid, hydrobromic acid or sulfuric acid, etc.) and peptide salts with organic acids (e.g., acetic acid, trifluoroacetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid or benzenesulfonic acid, etc.).

[0100] Amino acids are amino groups (-NH3 + ) and carboxylate (-CO2 -) functional group, together with an organic compound specifically for the side chain (R group) of each amino acid. Therefore, technically, any organic compound with an amine (-NH2) and a carboxylic acid (-COOH) functional group is an amino acid. The term "amino acid" refers to naturally occurring and synthesized amino acids, as well as amino acid analogs and amino acid mimetics that act in a manner similar to naturally occurring amino acids. Amino acids can be referred to herein by their commonly known three-letter symbols or by the one-letter symbols suggested by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides can be referred to by their commonly accepted single-letter codes. The term "amino acid" refers to amino acids related to protein production (i.e., amino acids biosynthetically incorporated into proteins during translation) and amino acids unrelated to protein production (such as ornithine (Orn, O), which has two bases). The genetic code encodes 20 kinds of standard amino acids for incorporation into proteins during translation. In addition, there are two additional amino acids related to protein production: selenocysteine ​​and pyrrolysine. The term "amino acid" includes naturally occurring amino acids (Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val) and unnatural or unusual amino acids. The amino acids are preferably in the L configuration, but also in the D configuration, or a mixture of amino acids in the D and L configurations. The term "natural amino acids" includes aliphatic amino acids (e.g., glycine, alanine, valine, leucine and isoleucine), hydroxylated amino acids (e.g., serine and threonine), sulfide amino acids (e.g., cysteine ​​and methionine), dicarboxylic acid amino acids and their amides (e.g., aspartic acid, asparagine, glutamic acid and glutamine), amino acids with two bases (e.g., lysine, arginine and histidine), aromatic amino acids (e.g., phenylalanine, tyrosine and tryptophan) and cyclic amino acids (e.g., proline).

[0101] As used herein, the term "unnatural or unusual amino acid" refers to an amino acid that is not a naturally encoded amino acid, ie, an amino acid that is not involved in protein production and that may be produced naturally in plants or bacteria after translation or chemically synthesized. Illustrative, non-limiting examples of modified or unconventional amino acids include 2-aminoadipic acid, 3-aminoadipic acid, β-alanine, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminohexanoic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid (Dab), desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid (Dap), N-ethylglycine, N-ethylasparagine, hydroxylysine, allohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N-methylglycine, N-methylisoleucine, 6-N-methyllysine, N-methylvaline, norvaline, norleucine, ornithine, and the like.

[0102] The peptide or a salt thereof of the present invention contains a basic amino acid selected from the group consisting of arginine (R), histidine (H) and three reactive basic amino acid residues having a reactive group in the side chain thereof.

[0103] In the context of this application, "a reactive basic amino acid residue containing a reactive group in its side chain" refers to any original basic amino acid (eg Lys, Orn, Dab, Dap) containing a group capable of forming a covalent bond (see below) in its side chain.

[0104] "Reactive basic amino acid residue" preferably refers to a basic amino acid residue comprising a primary amine on its side chain, such as, for example, lysine, ornithine, 2,4-diaminobutyric acid, 2,3-diaminopropionic acid or any other basic amino acid having a primary amine on its side chain. A primary amine is an amine in which the amino group (-NH2 moiety) is directly bonded to only one carbon (which cannot be a carbonyl carbon). In these cases, because the reactive group in its side chain is the primary amine of the amino acid, the reactive basic amino acid residue initially has a positive net charge at neutral pH.

[0105] A primary amine is a reactive group, and thus a basic amino acid containing a primary amine on its side chain is a reactive basic amino acid containing a reactive group on its side chain.

[0106] Therefore, the reactive basic amino acid residue containing a reactive group in its side chain can be a basic amino acid residue comprising a primary amine on its side chain, wherein the primary amine is a reactive group in the side chain. This will be the case of (for example) native (or unmodified) Lys or native (or unmodified) Orn or native (or unmodified) Dab, as described above, and the reactive basic amino acid residue containing a reactive group in its side chain will be positively charged at neutral pH. In addition, the reactive group in the side chain may be different from the primary amine. In this case, the reactive group may be (for example) covalently linked (directly or by means of a spacer) to the primary amine preferably present in the reactive basic amino acid residue. This may be the case of, for example, modified Lys or modified Orn or modified Dab, i.e., Lys or Orn or Dab, wherein the reactive group is covalently linked (directly or by means of a spacer) to its primary amine. This is a preferred embodiment.

[0107] Preferably, the spacer is a straight carbon chain, which comprises 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, even more preferably 4 carbon atoms. In a preferred embodiment, the spacer comprises a carboxylic acid that is suitable for forming an amide bond with the primary amine in the side chain of the alkaline reactive amino acid on one side. In addition, on the other side, the spacer is connected to a reactive group ("first reactive group"), as described herein. In a preferred embodiment, the spacer is connected to a reactive group selected from hydrazide, amino, carboxylic acid or aminooxy-carboxylic acid group, as described herein.

[0108] Therefore, the side chain reaction of the spacer group (it is connected to the first reactive group) and the reactive basic amino acid residue (it preferably comprises primary amine), for example, by forming an amide bond.Therefore, in this case, the reactive basic amino acid includes the reactive group bonded to its side chain by the spacer group, which is preferably hydrazide or aminooxy-carboxylic acid, as described herein.In this case, because reacting with the spacer group, the original positive charge of the reactive basic amino acid (for example, Lys or Orn or Dab) at neutral pH is lost.However, in the context of the present invention, also as mentioned above, the modified amino acid is also referred to as "reactive basic amino acid", because it is initially (before reacting with the spacer group connected to the reactive group) for basic amino acid and because it has a reactive group in the side chain.

[0109] For the purposes of this application, when an amino acid in a peptide of the invention or a salt thereof contains a reactive group on its side chain, the amino acid may be referred to by its 3-letter or 1-letter symbol and an asterisk (*) (e.g., K* for native or modified lysine, i.e., native lysine or lysine having a reactive group on its side chain that is not the primary amine of lysine).

[0110] Thus, as described above, in a preferred embodiment, the reactive group that is covalently linked (directly or via a spacer group) to the primary amine of the basic amino acid may not necessarily be an amine, but may be any reactive group that is suitable for forming a covalent bond with other reactive groups, such as other reactive groups present in the precursor of the hydrophobic tail, as defined in detail below.

[0111] In a specific embodiment, the reactive group present in the reactive basic amino acid side chain is selected from the group consisting of a hydrazide group, an amino group, a carboxylic acid and an aminooxy-carboxylic acid group. Preferably, the reactive group present in the reactive basic amino acid side chain is a hydrazide group or an aminooxy-carboxylic acid group. More preferably, the reactive group present in the reactive basic amino acid side chain is a hydrazide group.

[0112] In a preferred embodiment, the reactive basic amino acid residue containing a reactive group on its side chain is an amino acid as defined in formula (I):

[0113]

[0114] in:

[0115] If B is absent, A is a reactive group, preferably a primary amine. If B is present, A is preferably an amide bond, but may also be a secondary amine or any other functional group, such as that derived from the original basic amino acid. If present, B is a spacer group attached to the reactive group, as described herein, and n is 1, 2, 3, 4, 5, 6, 7, 8 or more, preferably n is 1, 2, 3 or 4, more preferably n is 3 or 4.

[0116] Formula (II) represents a reactive basic amino acid residue containing a reactive group on its side chain, when it is part of the amino acid sequence of the peptide of the present invention:

[0117]

[0118] in:

[0119] R 1 is an amino acid residue (as defined herein) comprised in the peptide, an acyl group (preferably an acetyl group), H or a salt thereof;

[0120] R 2 can be an amino acid residue comprised in the peptide, as defined herein, NH2, OH or a salt thereof. 2 When it is NH2, OH or a salt thereof, the reactive basic amino acid residue is located at the C-terminus of the peptide of the present invention;

[0121] B may be present or absent. If B is absent, A is a reactive group as described herein, preferably a primary amine. If B is present, A is preferably an amide bond, but may also be a secondary amine or any other functional group, such as that derived from the original basic amino acid;

[0122] If present, B is a spacer group attached to the reactive group, as described herein; and

[0123] n is 1, 2, 3, 4, 5, 6, 7, 8 or more, preferably n is 1, 2, 3 or 4, more preferably n is 3 or 4.

[0124] In a preferred embodiment, if B is absent, A is a primary amine.

[0125] In a preferred embodiment, B exists, and it is preferably a spacer group connected to a hydrazide group, an amino group, a carboxylic acid or an aminooxy group-carboxylic acid group, as described herein. More preferably, B exists, and it is a spacer group connected to a hydrazide group or an aminooxy group-carboxylic acid group. Even more preferably, B exists, and it is a spacer group connected to a hydrazide group. In a preferred embodiment, B exists, and it is connected to a hydrazide group, an amino group, a carboxylic acid or an aminooxy group-carboxylic acid group, more preferably connected to a hydrazide group or an aminooxy group-carboxylic acid group, even more preferably connected to a spacer group comprising 1 to 10 carbon atoms such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms such as 2, 3, 4, 5 or 6 carbon atoms, even more preferably 4 carbon atoms of a hydrazide group. In a preferred embodiment, B is a spacer group comprising 2 to 6 carbon atoms connected to a hydrazide group or an aminooxy group-carboxylic acid group. More preferably, B is a spacer group comprising 4 carbon atoms connected to a hydrazide group.

[0126] In a preferred embodiment, B is present and A is an amide bond.

[0127] Preferably, the spacer group is a straight carbon chain comprising 1 to 10 carbon atoms such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms such as 2, 3, 4, 5 or 6 carbon atoms, even more preferably 4 carbon atoms, as described herein. In a preferred embodiment, the spacer group has a carboxylic acid that is suitable for forming an amide bond with the primary amine in the side chain of the alkaline reactive amino acid (A) on one side. In addition, on the other side, the spacer group is connected to a reactive group ("first reactive group"), as described herein. In a preferred embodiment, the spacer group is connected to a reactive group selected from hydrazide, amino, carboxylic acid or aminooxy-carboxylic acid group, as described herein. Thus, in a preferred embodiment, B is present and is a spacer group comprising 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, such as 2, 3, 4, 5 or 6 carbon atoms, even more preferably 4 carbon atoms and which is linked to a reactive group as described herein ("first reactive group"), which is preferably a hydrazide group, an amino group, a carboxylic acid group or an aminooxy-carboxylic acid group.

[0128] In another preferred embodiment, the trireactive basic amino acid residue containing a reactive group in its side chain is reactive lysine (K*) or reactive ornithine (O*) or reactive Dab (Dab*) or a mixture thereof, more preferably reactive lysine (K*) or reactive ornithine (O*) or a mixture thereof.

[0129] The terms "reactive lysine", "K*" or "chemically available lysine" refer to the amino acid lysine C6H 14 N2O2, which has a free side chain amino group (primary amine). In the context of the present invention, as explained in detail above, the primary amine of the side chain of the native lysine can be a reactive group ("first reactive group") present in the reactive lysine. In addition, in the context of the present invention, as explained in detail above, the reactive group can be covalently linked (directly or via a spacer) to the side chain of the native lysine (i.e., to the ε-amino group present in the lysine), which reactive group is preferably a hydrazide group or an aminooxy-carboxylic acid group.

[0130] The term "reactive ornithine" or "O*" refers to a reactive ornithine having the molecular formula C5H 12 An amino acid not involved in protein production of N2O2, which has a free side chain amino group (primary amine). In the context of the present invention, as explained in detail above, the primary amine of the native ornithine can be the reactive group ("first reactive group") present in the reactive ornithine. Furthermore, in the context of the present invention, as explained in detail above, the reactive group can be covalently linked (directly or via a spacer) to the side chain of the native ornithine (i.e. to the delta-amino group present in ornithine), which reactive group is preferably a hydrazide group or an aminooxy-carboxylic acid group.

[0131] The term "reactive Dab", "Dab*" or "chemically accessible Dab" refers to the amino acid 2,4-diaminobutyric acid (Dab) C4H 10 N2O2, which has a free side chain amino group (primary amine). In the context of the present invention, as explained in detail above, the primary amine of the side chain of the native Dab can be a reactive group ("first reactive group") present in the reactive Dab. In addition, in the context of the present invention, as explained in detail above, the reactive group can be covalently linked (directly or via a spacer) to the side chain of the native Dab (i.e., to the -gamma amino group present in the Dab), and the reactive group is preferably a hydrazide group or an aminooxy-carboxylic acid group.

[0132] Therefore, the reactive lysine K* in the peptide of the present invention or its salt can be native lysine or modified lysine, wherein the modified lysine is characterized in that the first reactive group is connected to the ε-amino group of lysine via an amide bond, and the first reactive group and the amide bond are preferably connected via a spacer group. Preferably, the reactive lysine K* in the peptide of the present invention is a modified lysine, as described above.

[0133] Thus, the reactive ornithine O* may be native ornithine or modified ornithine, wherein the modified ornithine is characterized in that the first reactive group is linked to the delta-amino group of ornithine via an amide bond, the first reactive group and the amide bond preferably being linked via a spacer group. Preferably, the reactive ornithine O* in the peptide of the present invention is a modified ornithine, as described above.

[0134] Therefore, the reactive Dab (Dab*) can be a native Dab or a modified Dab, wherein the modified Dab is characterized in that the first reactive group is connected to the γ-amino group of Dab via an amide bond, and the first reactive group and the amide bond are preferably connected via a spacer group. Preferably, the reactive Dab (Dab*) in the peptide of the present invention is a modified Dab, as described above.

[0135] Preferably, the reactive group present in the side chain of the reactive basic amino acid (i.e., the first reactive group) is a hydrazide and is linked to the ε-amino group of lysine and / or the δ-amino group of ornithine and / or the γ-amino group of Dab via an amide bond, the hydrazide group and the amide bond being linked via a spacer group, the spacer group being a carbon chain preferably comprising 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, even more preferably 4 carbon atoms. For example, and as described in the following examples, the lysine and / or ornithine and / or Dab in the peptide of the present invention may preferably be modified with glutaric acid monohydrazide, and with aminooxy-acetic acid or succinic acid monohydrazide, such that an amide bond is formed between the ε-amino group of lysine / ornithine / Dab (if the amino acid is lysine) (or the δ-amino group (if the amino acid is ornithine), or the γ-amino group (if the amino acid is Dab)) and the carboxylic acid of glutaric acid monohydrazide, aminooxy-acetic acid or succinic acid monohydrazide. Thus, when the carboxylic acid is glutaric acid, the hydrazide group is linked to lysine and / or ornithine and / or Dab in the peptide of the invention via an acyl spacer group comprising 4 C atoms.

[0136] In a specific embodiment, the reactive group (i.e., the first reactive group) present in the reactive basic amino acid side chain (which can be connected to a spacer group, as described above) is any group that allows bioconjugation by means of click chemistry. In a specific embodiment, the reactive group present in the reactive basic amino acid side chain is any group suitable for developing a specific and controllable bioorthogonal reaction. The term "click chemistry" or "click reaction" is used interchangeably herein and is intended to be consistent with its use in the technology. It refers to a reaction class that is extremely effective and selective and can be used to stitch molecules together in high yields, as originally described by Sharpless and colleagues in 2001 (Kolb, HC, Finn, MG and Sharpless, KB (2001), Angewandte Chemie International Edition, 40 (11), 2004-2021). In the context of the present invention, a bioorthogonal reaction refers to any chemical reaction that can occur inside a living system without interfering with native biochemical processes. Many chemical ligation strategies have been developed that meet the bioorthogonal requirements, including (but not limited to) 1,3-dipolar cycloadditions between azides and cyclooctynes, between nitrones and cyclooctynes ​​(also known as copper-free click chemistry), oxime / hydrazone formation, tetrazine ligation, isocyanide-based click reactions, and tetracycloalkane ligation.

[0137] In a specific embodiment, the reactive group present in the reactive basic amino acid side chain is selected from the group consisting of hydrazide, straight-chain alkyl amino acid, carboxylic acid and aminooxy-carboxylic acid. Preferably, the reactive group present in the reactive basic amino acid side chain is selected from hydrazide and aminooxy-carboxylic acid. Even more preferably, the reactive group present in the reactive basic amino acid side chain is hydrazide. In another specific embodiment, the reactive group is connected to a spacer group, which is a carbon chain, preferably comprising 1 to 10 carbon atoms such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms such as 2, 3, 4, 5 or 6 carbon atoms, even more preferably 4 carbon atoms. In this embodiment, the spacer group has (for example) a carboxylic acid suitable for forming an amide bond between ε-amino (if amino acid is lysine) or δ-amino (if amino acid is ornithine) or γ-amino (if amino acid is Dab) on one side. In addition, on the other side, the spacer group is connected to a reactive group, which is selected from the group consisting of hydrazide, straight-chain alkyl amino acid, carboxylic acid and aminooxy-carboxylic acid. Preferably, the reactive group present in the reactive basic amino acid side chain is selected from hydrazide and aminooxy-carboxylic acid. Even more preferably, the reactive group is hydrazide.

[0138] In a preferred embodiment, the first reactive group (preferably hydrazide) is connected to a spacer group comprising 5 carbon atoms. In another embodiment, the reactive group is connected to a spacer group comprising 4 carbon atoms. For example, if the reactive group is a carboxylic acid, the reactive group is connected to the spacer group and exists as glutaric acid. In another embodiment, if the reactive group is a carboxylic acid, the reactive group is connected to the spacer group and exists as succinic acid. In another embodiment, if the reactive group is an aminooxy-carboxylic acid, the reactive group is connected to the spacer group and exists as aminooxy-acetic acid. Preferably, the reactive group is hydrazide and it is connected to the spacer group and exists as glutaric acid monohydrazide. Therefore, the spacer group connected to the reactive group is preferably in the form of glutaric acid monohydrazide, glutaric acid, aminooxy-acetic acid or succinic acid monohydrazide, more preferably in the form of glutaric acid monohydrazide, aminooxy-acetic acid or succinic acid monohydrazide, even more preferably in the form of glutaric acid monohydrazide.

[0139] In one embodiment, modified lysine or modified ornithine or modified Dab is obtained by reacting the peptide with hydrazide carboxylic acid such as glutaric acid monohydrazide or succinic acid monohydrazide, preferably glutaric acid monohydrazide, or with aminooxy-carboxylic acid, preferably aminooxy-acetic acid, to obtain modified lysine or modified ornithine or modified Dab, wherein the reactive groups are hydrazide and aminooxy-carboxylic acid groups, respectively. For more details, see "Hydrazone-modulated peptides for efficient gene transfection" (J. Mater. Chem. B (2017), 5: 4426-4434). In a more preferred embodiment, modified lysine or modified ornithine is obtained by reacting the peptide with hydrazide carboxylic acid, preferably glutaric acid monohydrazide, to obtain modified lysine or modified ornithine, wherein the reactive group is hydrazide.

[0140] The peptide of the present invention or its salt may further optionally comprise at least one hydrophobic amino acid selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), preferably leucine (L). If a hydrophobic amino acid is present in the peptide of the present invention, the hydrophobic amino acid is less than 50%, 40%, 30%, 20% or 10% of the total number of amino acids in the peptide or its salt.

[0141] In a preferred embodiment, the peptide of the present invention or its salt has a minimum length of 7 amino acids and a maximum length of 21 amino acids. For example, the peptide of the present invention or its salt has a length of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acids. More preferably, the peptide of the present invention or its salt has 7 to 17 amino acids, even more preferably 7 to 13 amino acids such as 7, 9 or 13 amino acids, or 7 to 9 amino acids. In a preferred embodiment, the peptide of the present invention or its salt has 7, 9, 13, 17 or 21 amino acids.

[0142] The number of R amino acids (arginine) in the peptide or its salt is preferably 2 to 10. Therefore, the number of arginine in the peptide or its salt is preferably 2, 3, 4, 5, 6, 7, 8, 9 or 10. Preferably, the number of arginine is 2 to 4.

[0143] The number of H amino acids (histidine) in the peptide or its salt is preferably 0 to 3, even more preferably 0 to 2. Therefore, the number of histidine in the peptide or its salt is preferably 0, 1, 2 or 3, more preferably 0, 1 or 2.

[0144] The number of reactive basic amino acid residues (preferably lysine and / or ornithine and / or Dab, preferably modified lysine and / or modified ornithine and / or modified Dab, also referred to as K* and / or O* and / or Dab*, as described above) containing reactive groups in their side chains in the peptide or its salt is 3.

[0145] The number of hydrophobic amino acids in the peptide or its salt is preferably 0 to 8. Therefore, the number of hydrophobic amino acids in the peptide or its salt is preferably 0, 1, 2, 3, 4, 5, 6, 7 or 8. In one embodiment, the hydrophobic amino acid is alanine (A). In another embodiment, the hydrophobic amino acid is valine (V). Preferably, the hydrophobic amino acid is leucine (L). In another embodiment, the hydrophobic amino acid is isoleucine (I). In another embodiment, the hydrophobic amino acid present in the peptide or its salt is any combination of two or more of alanine (A), valine (V), leucine (L) and / or isoleucine (I).

[0146] The amino acid contained in the peptide of the present invention or its salt can be L-amino acid or D-amino acid or its combination. Preferably, all amino acids contained in the peptide of the present invention or its salt are L-amino acid or, all amino acids contained in the peptide of the present invention or its salt are D-amino acid. In a more preferred embodiment, all amino acids contained in the peptide of the present invention or its salt are L-amino acid.

[0147] In the peptides of the present invention or their salts, there are no more than two consecutive amino acids that are identical residues, with the exception of a reactive basic amino acid residue containing a reactive group in its side chain (e.g., K* or O* or Dab*) and the amino acid arginine, in which case there may be up to three consecutive arginines and / or up to three consecutive reactive basic amino acid residues containing a reactive group in its side chain (e.g., there may be up to three consecutive Arg, RRR and / or up to three consecutive reactive basic amino acid residues containing a reactive group in its side chain, for example, K*K*K*, K*O*O*, O*O*O*, O*K*O*, K*O*K*, O*O*K*, O*K*K*, Dab*K*K*, K*Dab*K*, O*K*Dab*, O*O*Dab*, K*O*Dab*, K*K*Dab*, Dab*Dab*K*, Dab*Dab*Dab*, etc.).

[0148] In a preferred embodiment, in the peptide of the present invention or its salt, there are no more than two consecutive hydrophobic amino acids, that is, there are at most two consecutive hydrophobic amino acids, for example, AA, VV, AV, VA, LL, LA, VL, II, IL, LI, IA, VI, AI, etc.

[0149] Thus, the peptide of the present invention or a salt thereof may have no more than three adjacent R residues, no more than two adjacent H residues, no more than two adjacent hydrophobic residues and no more than three adjacent reactive basic amino acid residues containing reactive groups in their side chains (e.g., K* or O* or Dab*).

[0150] In a specific embodiment, the peptide of the present invention or a salt thereof has a length of 7 amino acids and comprises only basic amino acids selected from the group consisting of R and H and reactive basic amino acid residues containing a reactive group (i.e., the peptide does not contain hydrophobic amino acids), wherein the number of R amino acids in the peptide is at least 2, wherein the number of H amino acids in the peptide is 1 or 2, preferably 2, and wherein the number of reactive basic amino acid residues containing a reactive group (preferably K* and / or O* and / or Dab*) in the peptide is 3. In a preferred embodiment, the reactive group-containing basic amino acid is selected from K*, Dab* and O*, preferably K* and O*, even more preferably K*.

[0151] In a specific embodiment, the peptide sequence is selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO:1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO:2) and Ac-RK*HHK*K*R-NH2 (SEQ ID NO:3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO:52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO:53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO:58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO:59).

[0152] In another embodiment, the peptide of the present invention or its salt has a length of at least 7 amino acids and comprises a core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In the context of the present invention, "core sequence" means a sequence in which additional amino acids can be added at the C-terminus of the sequence and / or at the N-terminus of the sequence. For example, in this embodiment, the peptide of the present invention or its salt has a core sequence defined by RX1X2R (SEQ ID NO: 9) and has a length of at least 7 amino acids. This means that the peptide according to the present invention or its salt may have a sequence of RX1X2R and at least three additional amino acids in the C-terminus and / or three amino acids in the N-terminus, or a combination of amino acids in both the C-terminus and the N-terminus of the peptide, as defined above.

[0153] In another embodiment, the peptide of the present invention or a salt thereof has a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, such as 7 amino acids, and comprises a core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0154] In another embodiment, the peptide of the present invention or its salt has a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids, and comprises a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In another embodiment, the peptide has a length of at least 9 amino acids, such as 9, 13 or 21 amino acids. As described above, if the peptide or its salt according to this embodiment has more than 7 amino acids, additional amino acids are added at the C-terminus and / or N-terminus of the core sequence defined by SEQ ID NO: 4. Preferably, if the peptide according to this embodiment has more than 7 amino acids, additional amino acids are added at the C-terminus of the core sequence defined by SEQ ID NO: 4.

[0155] In another embodiment, the peptide of the present invention or a salt thereof has a length of 7 to 21 amino acids, such as 9 to 21 amino acids, preferably 9 to 17 amino acids, more preferably 9 to 13 amino acids, such as 9 amino acids, and comprises a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0156] In a specific embodiment, the peptide of the present invention or a salt thereof is a peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In a specific embodiment, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In a specific embodiment, the peptide of the present invention is a peptide of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In a specific embodiment, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L. In a specific embodiment, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0157] In one embodiment, the peptide of the present invention or a salt thereof is a peptide of sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7) or RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0158] In a specific embodiment, the peptide or a salt thereof is selected from Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 20), Ac- The group consisting of Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21) and Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23).

[0159] In a preferred embodiment, the peptide or its salt is selected from the group consisting of Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21), and Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23).

[0160] In another preferred embodiment, the peptide or its salt is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO:11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO:12), Ac-RK*HK*HK*R-NH2 (SEQ ID NO:49), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO:13), Ac-RRK*HRK*K*H (SEQ ID NO:54), RRK*LRK*K* (SEQ ID NO:55), RRK*LRK*K*L (SEQ ID NO:56) and RRRK*LRK*K*L (SEQ ID NO:57).

[0161] In another preferred embodiment, the peptide or its salt is selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO:65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO:66), Ac-RK*HRK*K*H-OH (SEQ ID NO:68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO:69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO:70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQID NO:72).

[0162] In another preferred embodiment, the peptide or its salt is selected from the group consisting of NH2-RK*HRK*K*H-NH2 (SEQ ID NO:69), Ac-RK*VRK*K*H-NH2 (SEQ ID NO:66) and Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71).

[0163] Preferably, the peptide of the present invention or a salt thereof is N-acylated and / or C-amidated. Even more preferably, the peptide of the present invention or a salt thereof is N-acylated and C-amidated.

[0164] According to the present invention, the term "N-acylated peptide" refers to a peptide wherein the N-terminal amino acid residue is acylated, preferably acetylated.

[0165] The term "C-amidation" refers to a peptide in which the terminal carboxyl group is in the form of an acylamino group (-CO-NH2) instead of a carboxyl group (-COOH).

[0166] As discussed above, the peptides of the present invention or their salts may contain L-amino acids and / or D-amino acids. Preferably, the amino acids contained in the peptides of the present invention or their salts are all L-amino acids. However, the amino acids contained in the peptides of the present invention or their salts may be all D-amino acids.

[0167] All terms and embodiments described elsewhere herein apply equally to these aspects of the invention.

[0168] Amphiphilic molecules

[0169] In a second aspect, the present invention relates to an amphiphilic molecule (also referred to herein as an "amphiphile") comprising or consisting of:

[0170] a) a peptide or a salt thereof as defined in the first aspect of the present invention, which is preferably a cationic peptide, as described above;

[0171] b) three hydrophobic tails, wherein the three hydrophobic tails are connected to the peptide by bonds, and the bonds are formed by the reaction between a reactive group in the side chains of the three basic amino acid residues of the peptide ("first reactive group") and one or more precursors of the three hydrophobic tails, wherein each precursor comprises a hydrophobic tail and a "second reactive group", wherein the second reactive group can react with a reactive group in the side chains of the three reactive basic amino acid residues of the peptide ("first reactive group"), as described above.

[0172] As used herein, an "amphiphilic molecule" is a molecule that contains both hydrophilic and hydrophobic groups.

[0173] The term "peptide" has been described in detail above and is equally applicable to the amphiphilic molecules according to the present invention. All embodiments and preferred forms explained above are equally applicable to the amphiphilic molecules as defined herein.

[0174] As used herein, the term "hydrophobic part" or "hydrophobic tail" refers to a group or molecule that is not attracted to water and has a significant non-polar surface area under physiological pH and / or salt conditions. This phase separation can be observed via a combination of dynamic light scattering and aqueous NMR measurements. Typically, the hydrophobic part is lipophilic, which means that it is soluble in fats, oils, lipids and lipophilic non-polar solvents (such as hexane or toluene) or miscible with fats, oils, lipids and lipophilic non-polar solvents (such as hexane or toluene). Suitable hydrophobic tails or hydrophobic parts used in the present invention include any hydrophobic group. Preferably, it is an alkyl or alkenyl, most preferably an alkenyl. The alkyl group can be substituted and functionalized (for example) to improve hydrophobicity. The alkyl group can be linear or branched, cyclic or non-cyclic. The carbon chain can contain one or more oxygen atoms contained at one or more positions of the main chain.

[0175] In some embodiments, the hydrophobic portion or hydrophobic tail is an aliphatic carbon chain. As used herein, the term "aliphatic carbon chain" refers to a hydrocarbon based on a chain of carbon atoms. There are three types of aliphatic hydrocarbons. Alkanes are aliphatic hydrocarbons with only a single covalent bond. Alkenes are hydrocarbons containing at least one C-C double bond, and alkynes are hydrocarbons containing C-C triple bonds. In a preferred embodiment of the amphiphile of the present invention, the hydrophobic portion comprises an alkane. Suitable aliphatic carbon chains that can be incorporated into the amphiphilic moiety according to the present invention are those having at least 2 carbon atoms (C2), at least 3 carbon atoms (C3), at least 4 carbon atoms (C4), at least 5 carbon atoms (C5), at least 6 carbon atoms (C6), at least 7 carbon atoms (C7), at least 8 carbon atoms (C8), at least 9 carbon atoms (C9), at least 10 carbon atoms (C10), at least 12 carbon atoms (C12), at least 14 carbon atoms (C14), at least 16 carbon atoms (C16), at least 18 carbon atoms (C18), at least 20 carbon atoms (C20), at least 22 carbon atoms (C22), at least 24 carbon atoms (C24) or more.

[0176] The term "precursor of a hydrophobic tail" refers to a molecule containing a hydrophobic tail as previously defined and a reactive group (according to the invention, a "second reactive group") that reacts to form a covalent bond with a reactive group in the side chain of three reactive basic amino acid residues in the peptide of the present invention (according to the invention, a "first reactive group") In a specific embodiment, the second reactive group present in the precursor of the hydrophobic tail as mentioned in the context of the first reactive group refers to any entity capable of forming a covalent bond. Therefore, the amphiphilic molecule is obtained by combining the peptide of the present invention with a precursor of the three hydrophobic tails through a reactive group ("first reactive group") present in the side chain of the three reactive basic amino acid residues of the peptide and a reactive group ("second reactive group") of the precursor of the three hydrophobic tails.

[0177] In a preferred embodiment, the three hydrophobic parts or hydrophobic tails are selected from C6 aliphatic chains, C8 aliphatic chains, C10 aliphatic chains, C12 aliphatic chains, myristenyl, palmityl, phellinyl, oleyl, linoleyl, eicosyl and tetracosyl or mixtures thereof.

[0178] More preferably, the three hydrophobic moieties or hydrophobic tails are selected from C12 aliphatic chains, myristenyl, palmityl, phlegmene or mixtures thereof. Even more preferably, the three hydrophobic moieties or hydrophobic tails are selected from myristenyl, palmityl and phlegmene or mixtures thereof.

[0179] In a particular embodiment, the second reactive group present in the precursor of the hydrophobic tail is selected from the group consisting of an aldehyde, a carboxylic acid, and an alcohol.

[0180] In some embodiments, wherein the second reactive group is an aldehyde, the precursor of the hydrophobic tail is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristenal, palmitenal, phellinenal, oleyl, linoleyl, eicosene aldehyde and tetracosene aldehyde or a mixture thereof. These precursors will result in amphiphilic peptides wherein the hydrophobic tails are each a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, myristenyl, palmitenyl, phellinenyl, oleyl, linoleyl, eicosene aldehyde and tetracosene aldehyde, or a mixture thereof.

[0181] In some embodiments, when the second reactive group is a carboxylic acid, the precursor of the hydrophobic tail is selected from the group consisting of caproic acid, caprylic acid, capric acid, dodecanoic acid, myristic oleic acid, palmitoleic acid, celery acid, oleic acid, linoleic acid, eicosenoic acid, lignoceric acid or a mixture thereof. These precursors will result in amphipathic peptides in which the three hydrophobic tails are each a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, myristenyl, palmityl, celerythrene, oleyl, linoleyl, eicosene, lignoceryl or a mixture thereof.

[0182] In some embodiments, when the second reactive group is an alcohol, the precursor of the hydrophobic tail is selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristenol, palmitenol, phellinenol, oleyl alcohol, linoleyl alcohol, gondoyl, tetracosene alcohol or a mixture thereof. These precursors will result in amphiphilic peptides in which each of the hydrophobic tails is a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, myristenyl, palmitenyl, phellinenyl, oleyl, linoleyl, gondoyl, tetracosene or a mixture thereof.

[0183] Preferably, the second reactive group is an aldehyde and the precursor of the hydrophobic tail is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristenal, palmitenal, phellandrenal, oleal, linoleal, eicoseneal and tetracoseneal or a mixture thereof, more preferably selected from dodecanal, myristenal, palmitenal and phellandrenal or a mixture thereof, even more preferably selected from myristenal, palmitenal and phellandrenal or a mixture thereof.

[0184] Therefore, in a preferred embodiment, the amphiphilic molecule of the present invention comprises:

[0185] (i) a peptide according to the invention or a salt thereof, which is preferably a cationic peptide, which has a length of 7 amino acids and comprises only basic amino acids selected from the group consisting of R and H and reactive basic amino acid residues containing a reactive group (i.e., the peptide does not contain hydrophobic amino acids), wherein the number of R amino acids in the peptide is at least 2, wherein the number of H amino acids in the peptide is 1 or 2, preferably 2, and wherein the number of reactive basic amino acid residues containing a reactive group in the peptide is 3, preferably wherein the basic amino acid containing a reactive group is selected from K*, Dab* and O*, preferably K*; and

[0186] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0187] In other embodiments, the amphiphilic molecules of the present invention include:

[0188] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59); and

[0189] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0190] In other embodiments, the amphiphilic molecules of the present invention include:

[0191] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO:65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO:66), Ac-RK*HRK*K*H-OH (SEQ ID NO:68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO:69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO:70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2, (SEQ ID NO:72); and

[0192] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and myristenyl, more preferably selected from the group consisting of myristenyl, palmityl and myristenyl, even more preferably myristenyl.

[0193] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0194] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of at least 7 amino acids and comprising a core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L; and

[0195] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0196] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0197] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, such as 7 amino acids, and comprising the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L; and

[0198] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0199] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0200] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L, and preferably wherein the peptide has a length of at least 9 amino acids (such as 9, 13 or 21 amino acids); and

[0201] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0202] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0203] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, such as 9 to 21 amino acids, preferably 9 to 17 amino acids, more preferably 9 to 13 amino acids, such as 9 amino acids, and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L; and

[0204] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0205] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0206] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L; and

[0207] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0208] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0209] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide of the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L; and

[0210] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0211] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0212] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L; and

[0213] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0214] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0215] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L; and

[0216] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0217] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0218] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L; and

[0219] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0220] In another embodiment, the amphiphilic molecule of the present invention comprises:

[0221] (i) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7) or RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L; and

[0222] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegm-enyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegm-enyl.

[0223] Two representative examples of reactions between reactive groups in peptides or their salts are shown below in Table A. Precursors for modifying groups within lysine and / or ornithine and hydrophobic tails are shown below, where aldehydes are utilized as the second reactive group.

[0224]

[0225] Table A. Tail bonding to lysine residues. The tail is represented by a solid sphere attached to a reactive group. The reactive group is specified in each case.

[0226] In one embodiment, the precursor of the three hydrophobic tails is hexanal, which results in a hydrophobic tail containing a C6 aliphatic chain. In one embodiment, the precursor of the three hydrophobic tails is octanal, which results in a hydrophobic tail containing a C8 aliphatic chain. In one embodiment, the precursor of the three hydrophobic tails is decanal, which results in a hydrophobic tail containing a C10 aliphatic chain. In one embodiment, the precursor of the three hydrophobic tails is dodecanal, which results in a hydrophobic tail containing a C12 aliphatic chain. In one embodiment, the precursor of the three hydrophobic tails is myristenal, which results in a hydrophobic tail consisting of a C14 aliphatic chain containing unsaturation. In one embodiment, the precursor of the three hydrophobic tails is palmitolene aldehyde, which results in a hydrophobic tail consisting of a C16 aliphatic chain containing unsaturation. In one embodiment, the precursor of the three hydrophobic tails is phelene aldehyde, which results in a hydrophobic tail consisting of a C18 aliphatic chain containing unsaturation. In one embodiment, the precursor of these three hydrophobic tails is oleyl aldehyde, which causes the hydrophobic tail consisting of the C18 aliphatic chain containing monounsaturation. In one embodiment, the precursor of these three hydrophobic tails is linoleyl aldehyde, which causes the hydrophobic tail consisting of the C18 aliphatic chain containing two unsaturations. In some embodiments, the precursor of these three hydrophobic tails is eicosene aldehyde, which causes the hydrophobic tail consisting of the C20 aliphatic chain containing monounsaturation. In one embodiment, the precursor of these three hydrophobic tails is tetracosene aldehyde, which causes the hydrophobic tail consisting of the C24 aliphatic chain containing monounsaturation. In a specific embodiment, this tail is a hydrophobic aldehyde precursor selected from the group consisting of myristene aldehyde, palmitylene aldehyde and phelene aldehyde or its mixture.

[0227] In a preferred embodiment, the amphiphilic molecule of the present invention is any one of the following specific combinations:

[0228] -[7.3 (Leu-His)] the cationic peptide is Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal or phellandrenal, preferably selected from myristenal, palmitenal or phellandrenal, even more preferably myristenal;

[0229] -[V1-7.3 (Leu-His)] the cationic peptide is Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal or phellandrenal, preferably selected from myristenal, palmitenal or phellandrenal, even more preferably myristenal;

[0230] -[V2-7.3 (Leu-His)] the cationic peptide is Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal or phellandrenal, preferably selected from myristenal, palmitenal or phellandrenal, even more preferably myristenal;

[0231] [7.3] the cationic peptide is Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellinenal or olealdehyde, preferably selected from myristenal, palmitenal or phellinenal, even more preferably myristenal;

[0232] -[7.3(Leu-Arg)] the cationic peptide is Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from palmitolealdehyde or phellinealdehyde, preferably selected from myristolealdehyde, palmitolealdehyde or phellinealdehyde, even more preferably myristolealdehyde;

[0233] -[7.3(LH)(KO)] the cationic peptide is Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenal, palmitenal or phellandrenal, preferably myristenal;

[0234] [9.3] the cationic peptide is Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellandrenal or oleal, preferably selected from myristenal, palmitenal or phellandrenal, or selected from dodecanal or palmitenal;

[0235] -[13.3] the cationic peptide is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellandrenal or oleal;

[0236] -[13.3(2+1)] the cationic peptide is Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, palmitolenal or phellandrenal;

[0237] -[13.3(3b)] the cationic peptide is Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal or phellandrenal;

[0238] -[13.3 (Leu-His)] The cationic peptide is Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellandrenal, oleenal, and tetracosene aldehyde;

[0239] -[13.3(Arg-His)] the cationic peptide is Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellandrenal, oleenal, eicosene aldehyde or tetracosene aldehyde;

[0240] -[13.3(3His)] the cationic peptide is Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal, phellandrenal or oleal;

[0241] [17.3] the cationic peptide is Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from dodecanal, myristenal, palmitenal or phellandrenal;

[0242] [21.3] the cationic peptide is Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail that is palmitolenal;

[0243] -[R+7.3(LH)-H] the cationic peptide is Ac-RRK*HRK*K*-NH2 (SEQ ID NO:53) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail that is myristenaldehyde;

[0244] -[R+7.3(LH)] the cationic peptide is Ac-RRK*HRK*K*H-NH2 (SEQ ID NO:54) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail that is myristenaldehyde;

[0245] -[R+7.3-L] the cationic peptide is Ac-RRK*LRK*K*-NH2 (SEQ ID NO:55) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde;

[0246] -[R+7.3] the cationic peptide is Ac-RRK*LRK*K*L-NH2 (SEQ ID NO:56) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde;

[0247] -[RR+7.3] the cationic peptide is Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde;

[0248] -[V3-7.3(LH)] the cationic peptide is Ac-RO*HRK*K*H-NH2 (SEQ ID NO:58) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde; and

[0249] -[V4-7.3(LH)] The cationic peptide is Ac-RK*HRK*O*H-NH2 (SEQ ID NO:59) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is generated by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0250] -[7.3(H,I)] The cationic peptide is Ac-RK*IRK*K*H-NH2 (SEQ ID NO.: 65) or a salt thereof, the spacer group containing the reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0251] -[7.3(H,V)] The cationic peptide is Ac-RK*VRK*K*H-NH2 (SEQ ID NO.: 66) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0252] -[7.3(LH)-OH] The cationic peptide is Ac-RK*HRK*K*H-OH (SEQ ID NO.: 68) or a salt thereof, the spacer group comprising a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0253] -[NH2-7.3(LH)] The cationic peptide is NH2-RK*HRK*K*H-NH2 (SEQ ID NO.: 69) or a salt thereof, the spacer group containing the reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0254] -[7.3(LH,K-Dab)] The cationic peptide is Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO.: 70) or a salt thereof, the spacer group containing the reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0255] -[7.3(LH,ONH2)] The cationic peptide is Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ IDNO.:71) or a salt thereof, the spacer group containing the reactive group is aminooxy-acetic acid, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0256] -[7.3(LH,C4Hyd)] The cationic peptide is Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO.:72) or a salt thereof, the spacer group containing the reactive group is succinic acid monohydrazide, and the tail is produced by conjugation with a precursor of a hydrophobic tail selected from myristenaldehyde.

[0257] In a specific embodiment, the amphiphilic molecule of the present invention is obtained by reacting a cationic peptide or a salt thereof with three precursors of a hydrophobic tail, the three precursors containing a second reactive group that reacts with a reactive group in a trireactive basic amino acid residue to form the covalent bond, as described above.

[0258] In another preferred embodiment, the bond formed by the reaction between the reactive group in the side chain of the tri-reactive basic amino acid residue and three precursors of the hydrophobic tail containing the hydrophobic tail and the second reactive group that can react with the reactive group in the side chain of the reactive basic amino acid residue in the cationic peptide is an amide bond, an ester bond, a hydrazone bond or an oxime bond.

[0259] In another embodiment, the reactive basic amino acid residue containing a primary amine in its side chain is a reactive lysine (K*) or a reactive ornithine (O*) or a reactive Dab (Dab*), and the covalent bond is formed (i) between the precursor of the hydrophobic tail and native lysine or native ornithine or native Dab, or (ii) between the precursor of the hydrophobic tail and a modified lysine or modified ornithine or modified Dab, as described above.

[0260] In a preferred embodiment, the second reactive group is an aldehyde selected from the group consisting of myristenal, palmitenal and phellandrenal.

[0261] In other embodiments:

[0262] (i) according to the present invention, a peptide or a salt thereof, which is preferably a cationic peptide of the amphiphilic molecule of the present invention: Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, a spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least three glutaric acid monohydrazide molecules per peptide molecule) to obtain a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has three hydrazide-reactive groups, as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with palmitoleic acid or myristoleic acid as a precursor of the hydrophobic tail,

[0263] (ii) according to the present invention, a peptide or a salt thereof, which is preferably a cationic peptide, is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof, a spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least three glutaric acid monohydrazide molecules per peptide molecule) to obtain a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide, because the peptide has three hydrazide-reactive groups, as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with palmitoleic acid aldehyde or phlorothalene aldehyde as a precursor of the hydrophobic tail,

[0264] (iii) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide selected from the group consisting of Ac-RO*HRO*O*H-NH2 (SEQ ID NO:52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO:53), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO:54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO:55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO:56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO:57), Ac-RO*HRK*K*H-NH2 (SEQ ID NO:58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO:59). NO:59) or a salt thereof, a spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residues or the δ-amino groups in the ornithine residues is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least three glutaric acid monohydrazide molecules per peptide molecule) to obtain a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has three hydrazide-reactive groups, as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with myristenaldehyde as a precursor of the hydrophobic tail,

[0265] (iv) a peptide according to the present invention or a salt thereof, which is preferably a cationic peptide selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69) and Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70). NO:70) or a salt thereof, a spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue or the γ-amino groups in the Dab residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least three glutaric acid monohydrazide molecules per peptide molecule) to obtain a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has three hydrazide-reactive groups, as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with myristenaldehyde as a precursor of the hydrophobic tail,

[0266] (v) According to the present invention, a peptide or a salt thereof, which is preferably a cationic peptide selected from the group consisting of Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQID NO:72) or a salt thereof, a spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue is formed by: reacting the peptide or a salt thereof with three aminooxy-acetic acid or succinic acid monohydrazide molecules per peptide molecule to obtain a (poly)aminooxy-activated peptide or a (poly)hydrazide-activated peptide, and then contacting the (poly)aminooxy-activated peptide or the (poly)hydrazide-activated peptide with myristenaldehyde as a precursor of the hydrophobic tail.

[0267] All terms and embodiments described elsewhere herein apply equally to these aspects of the invention.

[0268] Complex containing amphiphilic molecule and biomolecule of interest

[0269] In a third aspect, the present invention relates to a composite comprising:

[0270] a) at least one amphiphilic molecule according to the second aspect of the invention, and

[0271] b) at least one biomolecule of interest.

[0272] In a preferred embodiment, the biomolecule of interest is any molecule that forms a complex with an amphiphilic molecule of the invention when it is contacted with the amphiphilic molecule under suitable conditions, such as at physiological pH. In a specific embodiment, the pH is any one of those specified below, preferably 7.4.

[0273] In the context of the present invention, "physiological pH" refers to the pH of a body fluid, wherein the body fluid is preferably blood. In a specific embodiment, the physiological pH is 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.35, 7.4, 7.45, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, preferably 7.4. Methods for determining the pH of a body fluid are well known to experts in the field. A non-limiting example of the method comprises extracting a sample of the body fluid of interest, preferably blood, and measuring its pH with a pH meter. In addition, methods for determining whether a solution is at a specific pH (such as at a physiological pH) are well known to experts in the field and may simply consist of isolating a sample of the solution (with the material previously rinsed with milli-Q water and autoclaved) and determining the pH of the sample using a pH meter, which corresponds to the pH of the solution. Methods for adjusting the pH of a solution (e.g., to physiological pH) are also well known to experts in the field. The method includes gradually adding a hydroxide solution if the pH is too low, or adding hydrochloric acid if the pH is too high, until the pH of interest is reached. As used herein, the expression "contact at physiological pH" refers to any method that allows the biomolecule of interest to encounter the amphiphilic molecule of the present invention in a specific space at the same time in a solution of physiological pH. A non-limiting example of the method can be composed of placing a solution of the amphiphilic molecule of the present invention and a solution of the biomolecule of interest in a single recipient together, and adjusting the pH to physiological pH. Another non-limiting example of the method can be composed of contacting the amphiphilic molecule of the present invention and the biomolecule of interest in a buffer solution of physiological pH. Therefore, preferably, the amphiphilic molecule of the present invention can form a complex with one or more biomolecules of interest, preferably when the contact between the biomolecule of interest and the amphiphilic molecule of the present invention is carried out under conditions suitable for the combination of the amphiphilic molecule and the biomolecule of interest. In the context of the present invention, the formation of a complex between the amphiphilic molecule and the biomolecule of interest can be referred to as "the combination or compound of the amphiphilic molecule and the biomolecule of interest". This combination may also be referred to as supramolecular complexing, electrostatic interaction or packaging. This combination may occur through electrostatic interaction and / or hydrophobic interaction. Methods for determining whether a complex is formed between an amphiphilic molecule and a biomolecule of interest at a certain pH are well known to experts in the field. For example, electrophoretic mobility shift analysis (EMSA) or dynamic light scattering (DLS) may be used for this purpose.

[0274] In a preferred embodiment, the biomolecule of interest has a negative net charge. Reference herein to a "positive," "negative," or "neutral" charge means the overall charge state of the biomolecule of interest under specific conditions. Likewise, under some conditions, for example, under certain pH conditions, a portion may be referred to as "partially deprotonated" or "partially protonated" or "partially charged," meaning that a certain percentage of the overall portion of the composition is charged. It is contemplated that the zeta potential can be used to determine the net charge measured using, for example, laser Doppler microelectrophoresis techniques to measure the zeta potential (e.g., using a Zetasizer Nano ZS by Malvern Panalytical).

[0275] Preferably, the biomolecule of interest is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules. More preferably, the biomolecule of interest is selected from the group consisting of proteins, nucleic acids and nucleoproteins.

[0276] In a preferred embodiment, the biomolecule of interest is a nucleic acid. As used herein, the term "nucleic acid" or "polynucleotide" refers to a polymer having two or more deoxyribonucleotides, ribonucleotides, nucleotide analog molecules and / or molecules that are structurally similar to native nucleic acids, but are different from native nucleic acids (e.g., by chemical modification) in one or more of the nucleic acid backbone (e.g., phosphates in native nucleic acids), nucleic acid sugars (e.g., deoxyribose in native DNA and ribose in native RNA) and / or nucleic acid bases (e.g., adenine, cytosine, guanine, thymine or uracil in native nucleic acids) (e.g., modified nucleotides).

[0277] As used herein, the term "nucleic acid" or "polynucleotide" also refers to modified nucleic acids, i.e., synthetic genetic polymers, such as chemically modified nucleic acids or xeno nucleic acids (XNAs with modified backbones, sugars or nucleobases, and even new bases or base pairs, see, e.g., Pardi, N., Hogan, MJ, Porter, FW, and Weissman, D. (2018) mRNA vaccines-a new era in vaccinology, Nat. Rev. Drug Discov., 17(4), 261-279; Khvorova, A. and Watts, JK (2017) The chemical evolution of oligonucleotide therapies of clinical utility. Nat. Biotechnol., 35(3), 238-248; and Duffy, K., Arangundy-Franklin, S., and Holliger, P. (2020) Modified nucleic acids: replication, evolution, and next-generation therapeutics BMC Biol. 18, 112). Examples of chemically modified nucleic acids include those containing methoxyuridine, N1-methylpseudouridine, phosphorothioate, PNA or LNA.

[0278] The nucleic acid of the present invention can be a double-stranded or single-stranded oligonucleotide, including (but not limited to) plasmid DNA (pDNA), messenger RNA (mRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), micro RNA (miRNA), antisense oligonucleotide (ASO), aptamer, gene editing guide, self-amplifying RNA (saRNA, see, for example, Bloom, K., van den Berg, F. and Arbuthnot, P. (2021) Self-amplifying RNA vaccines for infectious diseases. Gene Ther 28, 117-129) or ribozyme. In a preferred embodiment, the nucleic acid is pDNA, siRNA or mRNA. The polynucleotide can also be a minicircle DNA. Minicircles are small (about 4kb) circular plasmid derivatives without any bacterial plasmid DNA backbone.

[0279] As described above, the nucleic acids of the present invention may include two or more deoxyribonucleotides, ribonucleotides, nucleotide analog molecules and / or modified nucleotides. In a specific embodiment, the transcription and translation of the above-mentioned nucleic acids are carried out by the transcription and translation mechanisms inside the cell into which the complex of the present invention has been introduced / delivered. In addition, the transcription of the nucleic acids of the present invention may result in functional nucleic acids, such as aptamers, ribozymes and / or shRNAs, inside the cell into which the complex of the present invention has been introduced / delivered.

[0280] In the context of the present invention, the term "small interfering RNA" or "siRNA" refers to a double-stranded RNA having a length of 20 to 25 nucleotides, which is highly specific to the nucleotide sequence of its target messenger RNA, thereby interfering with the expression of the respective gene.

[0281] As used herein, "shRNA" or "short hairpin RNA" or "small hairpin RNA" is an artificial RNA molecule with a tight hairpin bend that can be used to silence target gene expression via RNA interference (RNAi). shRNA typically comprises a double-stranded region and a loop region at one end that forms a hairpin loop. The double-stranded region is typically about 19 nucleotides to about 29 nucleotides in length on each side of the backbone, and the loop region is typically about 3 to about 10 nucleotides in length.

[0282] In the context of the present invention, the term "aptamer" refers to a single-stranded nucleic acid chain that adopts a specific tertiary structure that allows it to bind to a molecular target through interactions other than conventional Watson-Crick base pairing with high specificity and affinity, comparable to monoclonal antibodies.

[0283] The term antisense refers to the use of nucleic acids complementary to the coding (i.e., "sense") base sequences of the target gene. When an essentially antisense nucleic acid is incorporated into a cell, it can hybridize to complementary "sense" mRNA by normal Watson-Crick base pairing. Synthetic antisense DNA chains as short as 15 to 17 nucleotides in length can be used to block specific gene expression by physically blocking the translation of the target mRNA or causing its degradation.

[0284] In some embodiments, the nucleic acid of the present invention is an mRNA or pDNA, which, when delivered to a cell (and in the case of pDNA, transcribed), is translated into a protein of interest that can be directed to the cytoplasm or nucleus. It should be understood that the present invention contemplates that the complex of the present invention may contain an mRNA encoding any of the proteins mentioned below (including any of the immunogenic proteins mentioned below). In some embodiments, one or more of the uridine residues in the mRNA are replaced by 5-methoxyuridine (5-moU) or by N1-methyl pseudouridine.

[0285] In one embodiment, the nucleic acid forming part of the complex of the invention comprises an mRNA sequence encoding the prefusion stable spike protein (protein S, having SEQ ID NO: 27) of the coronavirus SARS-CoV-2. In a specific embodiment, the nucleic acid of the invention is a polymer of ribonucleotides and / or nucleotide analogs comprising an mRNA sequence encoding the prefusion stable spike protein (protein S) of SARS-CoV-2. In a preferred embodiment, the mRNA sequence (open reading frame, ORF) encoding the prefusion stable protein S of SARS-CoV-2 is a sequence having SEQ ID NO: 27.

[0286] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding ovalbumin (OVA). In a specific embodiment, the nucleic acid of the present invention is a polymer having ribonucleotides and / or nucleotide analogs comprising an mRNA sequence encoding ovalbumin. For example, the mRNA sequence encoding OVA can be obtained from TriLink (e.g., OVA mRNA (5moU)-(L-7210) or OVA mRNA-(L-7610)).

[0287] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding a detectable marker. Available detectable marker proteins that can be encoded by the mRNA and / or pDNA forming part of the complex of the present invention include luciferase, green fluorescent protein (GFP), DsRed, lacZ, thymidine kinase, etc.

[0288] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding a Cre recombinase (Cre). In a specific embodiment, the nucleic acid of the present invention is a polymer having ribonucleotides and / or nucleotide analogs comprising an RNA sequence encoding a Cre recombinase. For example, an mRNA sequence encoding a Cre recombinase can be obtained from TriLink (e.g., L-7211, Cre mRNA (5moU)).

[0289] In a preferred embodiment, the detectable marker is a luciferase protein, preferably firefly luciferase. The mRNA sequence (ORF) encoding the luciferase protein can be obtained from TriLink (e.g., FLuc (5-moU), L-7202). The mRNA sequence (ORF) encoding the GFP protein can be obtained from TriLink (e.g., EGFP mRNA (5moU, L-7201).

[0290] In a particular aspect, the nucleic acid is a ribozyme. Ribozymes (ribonucleases) are RNA molecules with the ability to catalyze specific biochemical reactions (RNA splicing comprising gene expression, similar to the action of proteases). Ribozymes have been proposed and developed for the treatment of diseases. For example, ribozymes have been proposed for the inhibition of RNA-based viruses, such as ribozymes for HIV infection or for hepatitis C virus RNA, SARS coronavirus (SARS-CoV), adenovirus, and influenza A and B virus RNA.

[0291] Therefore, in one embodiment, the complex of the invention comprises:

[0292] a) at least one amphiphilic molecule according to the second aspect of the invention, and

[0293] b) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA.

[0294] For example, the complex of the present invention comprises:

[0295] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, which has a length of 7 amino acids and comprises only basic amino acids selected from the group consisting of R and H and reactive basic amino acid residues containing a reactive group (i.e., the peptide or a salt thereof does not contain a hydrophobic amino acid), wherein the number of R amino acids in the peptide is at least 2, wherein the number of H amino acids in the peptide is 1 or 2, preferably 2, and wherein the number of reactive basic amino acid residues containing a reactive group in the peptide or a salt thereof is 3, preferably wherein the reactive group-containing basic amino acid residue is selected from K*, Dab* and O*, preferably K* and O*, even more preferably K*;

[0296] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0297] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or mRNA.

[0298] In another embodiment, the complex of the present invention comprises:

[0299] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, such as 7 amino acids, and comprising the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0300] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl, more preferably selected from myristenyl and phlegmyl; and

[0301] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or mRNA.

[0302] In another embodiment, the complex of the present invention comprises:

[0303] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L, and preferably wherein the peptide or salt has a length of at least 9 amino acids (such as 9, 13 or 21 amino acids);

[0304] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0305] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA.

[0306] In another embodiment, the complex of the present invention comprises:

[0307] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, such as 9 to 21 amino acids, preferably 9 to 17 amino acids, more preferably 9 to 13 amino acids, such as 9 amino acids, and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0308] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0309] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA.

[0310] In another embodiment, the complex of the present invention comprises:

[0311] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0312] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0313] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA.

[0314] In another embodiment, the complex of the present invention comprises:

[0315] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L;

[0316] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0317] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or siRNA.

[0318] In another embodiment, the complex of the present invention comprises:

[0319] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L;

[0320] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0321] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or siRNA.

[0322] In a preferred embodiment, the complex of the present invention comprises:

[0323] (i) cationic peptide 7.3 (LH) - SEQ ID NO: 1 or a salt thereof;

[0324] (ii) three hydrophobic moieties selected from the group consisting of myristenyl, palmityl and phellandrene; and

[0325] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is pDNA, siRNA or mRNA, preferably pDNA or mRNA.

[0326] In another preferred embodiment, the complex of the present invention comprises:

[0327] (i) cationic peptide 13.3(RH)-SEQ ID NO: 18 or a salt thereof;

[0328] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl, phellenyl and oleyl; and

[0329] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is mRNA, siRNA or pDNA, preferably pDNA.

[0330] In another preferred embodiment, the complex of the present invention comprises:

[0331] (i) cationic peptide 9.3-SEQ ID NO: 13 or a salt thereof;

[0332] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phellinenyl; and

[0333] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is siRNA, mRNA or DNA, preferably siRNA.

[0334] In another preferred embodiment, the complex of the present invention comprises:

[0335] (i) cationic peptide 13.3-SEQ ID NO: 14 or a salt thereof;

[0336] (ii) three hydrophobic moieties selected from a C12 aliphatic chain and a palmityl group; and

[0337] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is siRNA, mRNA or DNA, preferably siRNA.

[0338] In another preferred embodiment, the complex of the present invention comprises:

[0339] (i) cationic peptide 13.3 (Leu-His)-SEQ ID NO: 17 or a salt thereof;

[0340] (ii) three hydrophobic moieties selected from the group consisting of myristenyl, palmityl and phellandrene; and

[0341] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is siRNA.

[0342] In another preferred embodiment, the complex of the present invention comprises:

[0343] (i) cationic peptide NH2-7.3(LH)-SEQ ID NO:69 or a salt thereof;

[0344] (ii) three hydrophobic moieties selected from myristenyl, palmityl and pheltenyl, preferably myristenyl; and

[0345] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is DNA, preferably pDNA.

[0346] In another preferred embodiment, the complex of the present invention comprises:

[0347] (i) cationic peptide 7.3 (H, V) - SEQ ID NO: 66 or a salt thereof;

[0348] (ii) three hydrophobic moieties selected from myristenyl, palmityl and pheltenyl, preferably myristenyl; and

[0349] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is RNA, preferably mRNA.

[0350] In another preferred embodiment, the complex of the present invention comprises:

[0351] (i) cationic peptide 7.3 (LH, ONH2) - SEQ ID NO: 71 or a salt thereof;

[0352] (ii) three hydrophobic moieties selected from myristenyl, palmityl and pheltenyl, preferably myristenyl; and

[0353] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is RNA, preferably mRNA.

[0354] In another embodiment, the biomolecule of interest is a polypeptide or a protein. In a specific embodiment, the biomolecule of interest is a protein, such as a negatively charged protein at physiological pH, or a positively charged protein at physiological pH, or a non-charged protein at physiological pH.

[0355] As used herein, the term "negatively charged protein at physiological pH" refers to a protein with an isoelectric point (pI) below physiological pH. Similarly, as used herein, the term "positively charged protein at physiological pH" refers to a protein with an isoelectric point (pI) above physiological pH. As used herein, the term "uncharged protein at physiological pH" refers to a protein that does not present a net charge at physiological pH. Methods for determining the pI of a protein are well known to experts in the field. Non-limiting examples of the method include isoelectric focusing (IEF), free flow electrophoresis (FFE), capillary electrophoresis, or gel electrophoresis experiments using IPG bands or methods described in Audain E. et al. (2014) Curr. Top. Med. Chem., 14: 388-397 or Ramos Y. et al. (2008) J. Proteome Res., 7: 2427-2434.

[0356] The term "protein" is equivalent to the term "peptide" previously described in this application. Generally, proteins have a greater number of amino acids than peptides.

[0357] Therapeutic peptides generally act as hormones, growth factors, neurotransmitters, ion channel ligands or anti-infective agents. LeiWang et al. (Wang, L., Wang, N., Zhang, W. et al. (2022) Therapeutic peptides: current applications and future directions. Signal Transduct. Target Ther., 7: 48) provide a review of therapeutic peptides and their views. Peptides (such as the peptides described in the review) will benefit from the delivery of the amphiphilic molecules of the present invention. Peptides (such as protein-protein interaction inhibitors), anti-apoptotic peptides (such as the BH4 domain of Bcl-xL protein), pro-apoptotic peptides (such as KLAK), peptide probes (such as fluorophore-labeled cyclopeptide phalloidin) or hormones (such as insulin or fluorophore-labeled insulin) can also benefit from the delivery of the amphiphilic molecules of the present invention.

[0358] Therefore, in one embodiment, the complex of the invention comprises:

[0359] a) at least one amphiphilic molecule according to the second aspect of the invention, and

[0360] b) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a peptide, preferably a therapeutic peptide.

[0361] Therapeutic proteins are widely used to treat diseases such as cancer, infectious diseases, autoimmune diseases, and many other diseases. Antibodies, IFNs, enzymes, and cytokines are examples of therapeutic proteins. Preferred proteins for incorporation into the complexes of the present invention include, but are not limited to, hormones, antibodies (including monoclonal antibodies, antibody fragments, and antibody mimetics), and enzymes.

[0362] In another embodiment, the complex of the present invention comprises:

[0363] a) at least one amphiphilic molecule according to the second aspect of the invention, and

[0364] b) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably a therapeutic protein.

[0365] In some embodiments, the protein is an antibody and / or a functional fragment (characteristic portion) thereof. In some embodiments, the antibody is a polyclonal, monoclonal, chimeric (i.e., "humanized"), single chain (recombinant) or bispecific antibody. In some embodiments, the antibody may have reduced effector function and / or a bispecific molecule. In some embodiments, the antibody may comprise a Fab fragment and / or a fragment produced by a Fab expression library (e.g., Fab, Fab', F(ab')2, scFv, Fv, dsFv diabody and Fd fragment).

[0366] The term "antibody" means an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or a combination thereof, by at least one antigen recognition site in the variable region of an immunoglobulin molecule. As used herein, the term "antibody" includes complete polyclonal antibodies, complete monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2 and Fv fragments, dual affinity retargeting antibodies (DART)), single-chain Fv (scFv) mutants, multispecific antibodies (such as bispecific and trispecific antibodies produced by at least two complete antibodies), humanized antibodies, human antibodies, fusion proteins comprising the antigenic determinant of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site, as long as the antibody exhibits the desired biological activity. Since the first therapeutic antibody entered the market in 1986, various antibodies for different targets have been developed and more than 60 antibody therapeutics have been approved (Carter, PJ and Lazar, GA (2018) Nat. Rev. Drug Discov. 17: 197-223).

[0367] In some embodiments, the antibody can be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or its subclasses (isotypes) (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), based on recognition of its heavy chain constant domain (each referred to as α, δ, ε, γ, and μ). For example, the antibody can be IgG or labeled IgG.

[0368] The term "antigen binding fragment" or "antibody fragment" refers to a portion of an intact antibody and comprises the antigen-determining variable regions of an intact antibody. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single-chain antibodies, and multispecific antibodies formed from antibody fragments. In one embodiment, the antibody is an antibody fragment, such as Fab or scFv, for example, a labeled Fab or scFv.

[0369] "Monoclonal antibody" refers to a homogeneous antibody population that is involved in the high specific recognition and binding of a single antigenic determinant or antigenic determinants. This is in contrast to polyclonal antibodies, which typically include different antibodies against different antigenic determinants. The term "monoclonal antibody" includes both complete and full-length monoclonal antibodies as well as antibody fragments (such as Fab, Fab', F(ab')2, Fv), single-chain (scFv) mutants, fusion proteins comprising antibody portions, and any other modified immunoglobulin molecules comprising antigen recognition sites. In addition, "monoclonal antibody" refers to these antibodies prepared in various ways, including (but not limited to) by hybridoma, phage selection, recombinant expression, and transgenic animals. For example, the monoclonal antibody is an anti-nuclear pore complex protein monoclonal antibody (MAb414).

[0370] The term "humanized antibody" refers to a form of non-human (e.g., murine) antibody that is a specific immunoglobulin chain, chimeric immunoglobulin, or fragment thereof that contains minimal non-human (e.g., murine) sequence. Typically, a humanized antibody is a human immunoglobulin in which residues from a complementary determining region (CDR) are replaced with residues from a CDR of a non-human species (e.g., mouse, rat, rabbit, hamster) that has the desired specificity, affinity, and capacity (Jones et al., 1986, Nature, 321: 522-525; Riechmann et al. (1988), Nature, 332: 323-327; Verhoeyen et al. (1988), Science, 239: 1534-1536).

[0371] In another embodiment, the antibody is an antibody mimetic. Antibody mimetic is an organic compound that can specifically bind to an antigen like an antibody, but is not structurally related to an antibody. It is typically an artificial peptide or protein with a molar mass of about 3 to 20 kDa. It can also be a nucleic acid and a small molecule. Some examples of antibody mimetic are affinity antibodies (based on the Z domain of protein A), affilin, ubiquitin, affimer, affitin, alpha antibodies, anticalins (artificial lipocalin), avimer, fynomer, gastrobodies, Kunitz domain peptides, DARPins (designed ankyrin repeats), nanobodies, monoclonal antibodies, nanoCLAMP, optimizer, repebodies, Pronectin TM , centyrin or obodies.

[0372] In other embodiments, the protein is an enzyme. Enzymes include, but are not limited to, therapeutic enzymes and enzymes such as β-galactosidase, saporin, lysozyme, BSA, Cre-recombinase, ZFN, TALEN, and the like.

[0373] Therapeutic enzymes can be broadly divided into four categories, namely: enzymes involved in fibrinolysis, cancer treatment, enzyme replacement therapy, and treatment of other rare and common diseases (Siddhi Tandon et al., Therapeutic enzymes: Discoveries, production and applications, Journal of Drug Delivery Science and Technology, Vol. 63, 2021).

[0374] In another embodiment, the biomolecule of interest is a nucleoprotein (NP). A nucleoprotein is any protein structurally associated with a nucleic acid (DNA or RNA) or any other modified nucleic acid. Deoxyribonucleoprotein (DNP) is a complex of DNA and protein. Ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA binding protein. In a preferred embodiment, the nucleoprotein is a ribonucleoprotein. In a preferred embodiment, the nucleoprotein is a Cas9-RNP, wherein the protein is provided in association with a guide RNA (gRNA), which may be in the form of a single molecule (sgRNA) or a double helix consisting of crRNA:tracrRNA.

[0375] Cas9 is a dual RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) adaptive immune system of Streptococcus pyogenes. Cas9 protein has been widely used as a genome engineering tool for CRISPR to induce site-directed double-strand breaks in DNA. Cas9 can cleave almost any sequence that is complementary to the guide RNA. Nidhi S. et al. (2021) Int. J. Mol. Sci., 22: 3327 provides an overview of the CRISPR-Cas system, including its application in therapy.

[0376] Therefore, in another embodiment, the complex of the present invention comprises:

[0377] a) at least one amphiphilic molecule according to the second aspect of the invention, and

[0378] b) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably the protein is a nucleoprotein, more preferably Cas9-RNP.

[0379] For example, the complex of the present invention comprises:

[0380] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, which has a length of 7 amino acids and comprises only basic amino acids selected from the group consisting of R and H and reactive basic amino acid residues containing a reactive group (i.e., the peptide or a salt thereof does not contain a hydrophobic amino acid), wherein the number of R amino acids in the peptide or a salt thereof is at least 2, wherein the number of H amino acids in the peptide or a salt thereof is 1 or 2, preferably 2, and wherein the number of reactive basic amino acid residues containing a reactive group in the peptide or a salt thereof is 3, preferably wherein the reactive group-containing basic amino acid residue is selected from K*, Dab* and O*, preferably K* and O*, more preferably K*;

[0381] (ii) three hydrophobic moieties selected from the group consisting of a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, more preferably selected from the group consisting of myristenyl, palmityl and phlegmyl; and

[0382] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0383] In another embodiment, the complex of the present invention comprises:

[0384] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, such as 7 amino acids, and comprising the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0385] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl; and

[0386] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0387] In another embodiment, the complex of the present invention comprises:

[0388] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L, and preferably wherein the cationic peptide has a length of at least 9 amino acids (such as 9, 13 or 21 amino acids);

[0389] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl or selected from a C12 aliphatic chain and palmityl; and

[0390] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0391] In another embodiment, the complex of the present invention comprises:

[0392] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide having a length of 7 to 21 amino acids, such as 9 to 21 amino acids, preferably 9 to 17 amino acids, more preferably 9 to 13 amino acids, such as 9 amino acids, and comprising a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0393] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl or selected from a C12 aliphatic chain and palmityl; and

[0394] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0395] In another embodiment, the complex of the present invention comprises:

[0396] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, preferably wherein the hydrophobic amino acid is L;

[0397] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl or selected from a C12 aliphatic chain and palmityl; and

[0398] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0399] In another embodiment, the complex of the present invention comprises:

[0400] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L;

[0401] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl, more preferably selected from palmityl and phlegmyl; and

[0402] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0403] In another embodiment, the complex of the present invention comprises:

[0404] (i) a peptide or a salt thereof according to the present invention, which is preferably a cationic peptide of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, wherein the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, wherein preferably the hydrophobic amino acid is L;

[0405] (ii) three hydrophobic moieties selected from a C12 aliphatic chain, myristenyl, palmityl and phlegmyl, preferably selected from myristenyl, palmityl and phlegmyl, more preferably selected from palmityl and phlegmyl; and

[0406] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is a protein, preferably wherein the protein is a nucleoprotein, more preferably Cas9-RNP.

[0407] In a preferred embodiment, the complex of the present invention comprises:

[0408] (i) cationic peptide 7.3-SEQ ID NO: 11 or a salt thereof;

[0409] (ii) three hydrophobic moieties selected from palmityl and phelline; and

[0410] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is Cas9-RNP.

[0411] In another preferred embodiment, the complex of the present invention comprises:

[0412] (i) cationic peptide 7.3 (Leu-His) - SEQ ID NO: 1 or a salt thereof;

[0413] (ii) three palmitylene groups; and

[0414] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is Cas9-RNP.

[0415] In another preferred embodiment, the complex of the present invention comprises:

[0416] (i) cationic peptide 13.3-SEQ ID NO: 14 or a salt thereof;

[0417] (ii) three myristenyl groups; and

[0418] (iii) at least one biomolecule of interest, wherein the at least one biomolecule of interest is Cas9-RNP.

[0419] In another embodiment, the biomolecule of interest is an antigen or an immunogen.

[0420] The terms "antigen" or "immunogen" are used interchangeably to refer to a substance, usually a protein, that is capable of inducing an immune response in a subject. The term also refers to a protein that is immunologically active in the sense that upon administration to a subject (either directly in the form of a peptide or protein or by administering to a subject a nucleotide sequence or vector encoding the peptide or protein) it is capable of eliciting a hormonal and / or cell-type immune response against the protein.

[0421] The immunogen may be derived from pathogenic or non-pathogenic organisms, such as bacteria, viruses, fungi, molds, protists, parasites, etc. In another embodiment, the immunogen may be a tumor-associated antigen, a tumor-specific antigen, a cell-associated antigen, or an allergen.

[0422] The immunogen may be in the form of, for example, a lipid, a polysaccharide, a peptide, a protein, or a nucleotide sequence encoding a peptide or protein. Preferably, the immunogen is in the form of a peptide, a protein, or a nucleotide sequence encoding a peptide or protein. More preferably, the immunogen is a nucleotide sequence encoding a peptide or protein, and even more preferably an mRNA encoding a peptide or protein. Suitable nucleotide sequences encoding a peptide or protein of interest include, but are not limited to, plasmid DNA, minicircles, mRNA, and saRNA. In some embodiments, the nucleotide sequence encoding a peptide or protein is chemically modified or is a heterologous nucleic acid. In other embodiments, the nucleotide sequence is not chemically modified, and in the case of DNA, it contains standard deoxyribonucleotides (i.e., deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine) or in the case of RNA, it contains standard ribonucleotides (i.e., adenosine, guanosine, cytidine, uridine). In one embodiment, the immunogen is a modified mRNA encoding a pre-fusion stable spike protein (SEQ ID NO: 27) from SARS-CoV-2. In another embodiment, the immunogen is a modified mRNA encoding chicken ovalbumin (OVA).

[0423] Immunogenic synthetic peptides that mimic the sequence of the antigenic peptide are also available. These immunogens can be synthesized using solid phase techniques as described, for example, in Merrifield RB (1963) J. Am. Chem. Soc. 85: 2149-2154. In one embodiment, the synthetic peptide that mimics the sequence of the antigenic peptide is an immunogenic fragment of OVA having a SIINFEKL sequence (SEQ ID NO: 64).

[0424] Other immunogens include purified secreted antigenic virulence factors, such as toxins or cytotoxins. Examples of toxins that can be used as immunogens include bacterial endotoxins, exotoxins, and enterotoxins.

[0425] Method for preparing amphiphilic molecules

[0426] In another aspect, the invention relates to a method for preparing an amphiphilic molecule according to the invention, wherein the method comprises contacting a solution of a peptide according to the invention (preferably a cationic peptide) or a salt thereof in an organic solvent with a solution of at least three precursors of a hydrophobic tail containing a reactive group which reacts with a reactive group in a reactive basic amino acid side chain in the peptide under conditions suitable for forming a covalent bond between the precursor of the hydrophobic tail and the reactive group in the peptide.

[0427] The terms "amphiphilic molecule", "peptide", "hydrophobic tail", "precursor of the hydrophobic tail", "reactive group in the side chain of the peptide" and "reactive group in the precursor of the hydrophobic tail" have been described in detail in the previous aspects of the invention above and are equally applicable to the methods of the present invention.

[0428] Conditions suitable for forming a bond between a reactive group in the basic amino acid and a second reactive group in the precursor of the hydrophobic tail include:

[0429] - When the reactive group in the precursor of the hydrophobic tail is an aldehyde, an acidic medium, or

[0430] - When the reactive group in the precursor of the hydrophobic tail is an alcohol or a carboxylic acid, a basic medium and in the presence of a carboxylic acid activating reagent.

[0431] Preferably, suitable conditions for forming a bond between the reactive group in the basic amino acid and the second reactive group in the precursor of the hydrophobic tail include acidic media when the reactive group in the precursor of the hydrophobic tail is an aldehyde.

[0432] In a specific embodiment, the organic solvent is selected from dimethyl sulfoxide (DMSO), dimethyl sulfoxide / acetic acid mixture (DMSO / AcOH), methanol, ethanol and dimethylformamide (DMF). In a preferred embodiment, the organic solvent is DMSO containing 5% AcOH.

[0433] The expression "carboxylic acid activator reagent" refers to a chemical entity that can react with an equimolar amount (which means that for each mole of acid, 1 mole of coupling reagent is required) of a substrate having a carboxylic acid under mild reaction conditions to generate a so-called "activated ester" intermediate. Because of the electron-withdrawing effect incorporated from the activator reagent, the resulting activated ester is more inclined to react with a nucleophilic reagent, and therefore, the transient intermediate can then undergo a nucleophilic attack of an amino or alcohol group to give an amide or ester base. Typical carboxylic acid activator reagents for generating amide bonds are ammonium / urea salts (N-HBTU, N-HATU, N-TBTU) or carbodiimide reagents such as EDC, DIC, DCC, which are also suitable for generating ester bonds. A more comprehensive list of suitable coupling reagents can be found in: El-Faham A. Albericio F. (2011) Chem. Rev., 111: 6557-6602, which is about various nucleophilic reagents that can potentially be incorporated into the carboxylic acid group portion.

[0434] In one embodiment, the contacting step between a solution of a peptide (preferably a cationic peptide) of the present invention or a salt thereof in an organic solvent and a solution of at least three precursors of a hydrophobic tail containing a reactive group is carried out by contacting "n" reactive groups of a peptide or a salt thereof in an organic solvent with at least "1n" precursors of a hydrophobic tail, such as at least "1.5n" precursors of a hydrophobic tail, or at least "2n" precursors of a hydrophobic tail, or at least "3n" precursors of a hydrophobic tail, or at least "4n" precursors of a hydrophobic tail, or at least "5n" precursors of a hydrophobic tail, the precursor comprising a hydrophobic tail and a second reactive group that reacts with a reactive group in a side chain of a reactive basic amino acid in a peptide or a salt thereof, wherein the contacting is carried out under conditions suitable for forming a covalent bond between the precursor of the hydrophobic tail and the reactive group in the peptide or a salt thereof. For example, the contacting step is carried out by:

[0435] - contacting 1 equivalent of the reactive group in the peptide of the present invention or a salt thereof with 5 equivalents of a hydrophobic tail precursor;

[0436] - contacting 1 equivalent of the reactive group in the peptide of the present invention or a salt thereof with 4 equivalents of a hydrophobic tail precursor;

[0437] - contacting 1 equivalent of the reactive group in the peptide of the present invention or a salt thereof with 3 equivalents of a hydrophobic tail precursor;

[0438] - contacting 1 equivalent of the reactive group in the peptide of the present invention or a salt thereof with 2 equivalents of a hydrophobic tail precursor;

[0439] - contacting 1 equivalent of the reactive group in the peptide of the present invention or a salt thereof with 1.5 equivalents of a hydrophobic tail precursor;

[0440] - One equivalent of the reactive group in the peptide of the present invention or a salt thereof is contacted with one equivalent of the precursor of the hydrophobic tail.

[0441] In a preferred embodiment, the contacting step between a solution of the peptide of the present invention (preferably a cationic peptide) or a salt thereof in an organic solvent and a solution of at least three precursors of a hydrophobic tail containing a reactive group is carried out by contacting "n" reactive groups of the peptide or its salt in an organic solvent with at least "1n" precursors of the hydrophobic tail, such as at least "1.5n" precursors of the hydrophobic tail, or at least "2n" precursors of the hydrophobic tail, or at least "3n" precursors of the hydrophobic tail, or at least "4n" precursors of the hydrophobic tail, or at least "5n" precursors of the hydrophobic tail, preferably with "1n" precursors of the hydrophobic tail or "5n" precursors of the hydrophobic tail.

[0442] Method for preparing the composite

[0443] In another aspect, the present invention relates to a method for preparing a complex according to the present invention, comprising contacting a solution of at least one amphiphilic molecule according to the present invention with a solution of at least one biomolecule of interest in a suitable medium under conditions suitable for the formation of a complex between the at least one amphiphilic molecule and the at least one biomolecule of interest.

[0444] In a particular embodiment, the amphiphilic molecule is freshly prepared prior to preparing the complex for intracellular delivery of at least one biomolecule of interest. In another particular embodiment, the amphiphilic molecule is provided as a freeze-dried powder prior to dissolution, preferably in an organic solvent, prior to preparing the complex.

[0445] In a specific embodiment, the organic solvent is dimethyl sulfoxide (DMSO).

[0446] In certain embodiments, as used herein, the expression "a solution of at least one molecule x" refers to a solution comprising at least one molecule x.

[0447] In another specific embodiment, in addition to the at least one amphiphilic molecule, the solution of the at least one amphiphilic molecule comprises at least one precursor of the hydrophobic tail as defined in the present invention that is not associated with a peptide or a salt thereof. In another specific embodiment, in addition to the at least one amphiphilic molecule, the solution of the at least one amphiphilic molecule comprises at least one peptide of the present invention or a salt thereof that is not associated with a precursor of the hydrophobic tail (preferably a precursor of the hydrophobic tail as defined in the present invention). In another specific embodiment, in addition to the at least one amphiphilic molecule, the solution of the at least one amphiphilic molecule comprises at least one precursor of the hydrophobic tail as defined in the present invention that is not associated with a peptide (preferably a peptide of the present invention) and at least one peptide of the present invention or a salt thereof that is not associated with a precursor of the hydrophobic tail (preferably a precursor of the hydrophobic tail as defined in the present invention).

[0448] In one embodiment, the biomolecule of interest for use in the method of preparing the complex has a net negative charge.

[0449] Methods for delivering a biomolecule of interest to a cell population in vitro

[0450] Furthermore, the present invention provides a method for delivering a biomolecule of interest to a cell population in vitro, wherein the method comprises the following steps:

[0451] (i) contacting a first solution of at least one amphiphilic molecule of the invention in a suitable solvent with a second solution containing a biomolecule of interest in a suitable solvent under conditions suitable for forming a complex between the at least one amphiphilic molecule and the at least one biomolecule of interest, and

[0452] (ii) adding the complex obtained in step (i) to the cell population under conditions suitable for delivering the biomolecule of interest to the cell population.

[0453] Preferably, the contacting step (i) is carried out in the same medium in which the cells are cultured and wherein the amphiphilic molecule is provided by a stock solution in an organic solvent. In another preferred embodiment, the biomolecule of interest has a negative net charge at the pH at which the contacting step (i) is carried out. In another embodiment, the biomolecule of interest for use in the method of delivering the biomolecule of interest to a cell population in vitro has a neutral net charge or a positive charge at physiological pH, as described above.

[0454] Use as a transfection agent and method for in vitro delivery

[0455] In another aspect, the invention relates to the use of a peptide according to the invention, preferably a cationic peptide, or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for the intracellular delivery of a biomolecule of interest (in vitro).

[0456] In the context of the present invention, the term "transfection" refers to a method of intentionally introducing a biomolecule of interest into a cell. This may also be referred to as "delivery" or "intracellular delivery". The cell may be of any origin. In a particular embodiment, the cell is a eukaryotic cell. In a more particular embodiment, the cell is a mammalian cell. In an even more particular embodiment, the cell is a human cell. The biomolecule of interest has been described in detail above. Specifically, the molecule of interest may be selected from the group consisting of proteins, nucleic acids, nucleoproteins, immunogens and small molecules, as described in detail above. In a preferred embodiment, the nucleic acid is pDNA, siRNA or mRNA, and the nucleoprotein is a ribonucleoprotein, as described in detail above. In a preferred embodiment, the nucleic acid is mRNA. In a particular embodiment, the transfection is a transient transfection. In a particular embodiment, the transfection is a stable transfection. If stable transfection is desired, i.e., the transfected gene is actually retained in the genome of the cell and is passed on to its daughter cells, a marker gene may be co-transfected. The marker gene may be a fluorescently detectable gene, or it may provide resistance to a specific toxin.

[0457] The use of the molecules of the invention as transfection agents and / or delivery vectors allows for the in vitro delivery of molecules of interest as described above to a cell population of interest.

[0458] Libraries and methods of obtaining them

[0459] The present invention further provides a method for obtaining a library of amphiphilic molecules as defined in the present invention, the method comprising contacting "n" peptides (preferably cationic peptides) or salts thereof according to the present invention in an organic solvent with at least "3n" precursors of hydrophobic tails, the precursors comprising a hydrophobic tail and a second reactive group that reacts with a reactive group in the side chain of a reactive basic amino acid in the peptide or its salt, wherein the contacting is carried out under conditions suitable for forming a covalent bond between the precursor of the hydrophobic tail and the reactive group in the peptide or its salt. "n" corresponds to a natural number, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. For example, in a method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, at least 2 peptides or salts thereof as defined in the present invention are contacted in an organic solvent with at least 6 precursors of hydrophobic tails as described above. Preferably, the peptide is selected from any one of SEQ ID NOs 1-19, 21, 23, 49, 52-59, 65-66, 68-72.

[0460] In another preferred embodiment, the hydrophobic tail contained in the precursor of at least "3n" hydrophobic tails is selected from aldehydes, carboxylic acids or alcohols, preferably aldehydes, wherein the aldehyde is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristenol, palmitoleic acid, phellinenol, oleylene aldehyde, linoleylene aldehyde, eicosene aldehyde and tetracosene aldehyde; wherein the carboxylic acid is selected from the group consisting of hexanoic acid, octanoic acid, decanal, dodecanal, myristoleic acid, palmitoleic acid, phellinenol, oleic acid, linoleic acid, eicosene aldehyde and tetracosene aldehyde; and wherein the alcohol is selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristenol, palmitoleic acid, phellinenol, oleyl alcohol, linoleyl alcohol, eicosene aldehyde and tetracosene aldehyde. More preferably, the hydrophobic tail contained in the precursor of at least "3n" hydrophobic tails is selected from the group consisting of dodecanal, myristenol, palmitoleic acid, phellinenol, oleylene aldehyde, eicosene aldehyde and tetracosene aldehyde.

[0461] In another preferred embodiment, the reactive group in the peptide of the present invention or a salt thereof is a hydrazide group or a hydroxylamine group, and the reactive groups in the precursors of at least three hydrophobic tails are aldehyde groups.

[0462] Preferably, the contacting step of the method for obtaining a library of amphiphilic molecules is performed by contacting a peptide or a salt thereof with a precursor of a hydrophobic tail alone, as described herein.

[0463] The present invention further provides a library comprising at least two different amphiphilic molecules, each amphiphilic molecule comprising:

[0464] (i) a peptide according to the invention or a salt thereof, which is preferably a cationic peptide according to the invention, and

[0465] (ii) three hydrophobic tails,

[0466] wherein the hydrophobic tail is linked to the peptide or its salt by a bond formed by reaction between a reactive group in the side chain of a reactive basic amino acid residue in the peptide or its salt and a precursor of the hydrophobic tail, wherein each precursor of the hydrophobic tail contains the hydrophobic tail and a second reactive group that can react with the reactive group in the side chain of a reactive basic amino acid residue in the peptide or its salt, and

[0467] One of the amphiphilic molecules is different from at least one of the other amphiphilic molecules in the peptide or its salt and / or in the hydrophobic tail.

[0468] Preferably, the bond formed by the reaction between the reactive group in the side chain of the reactive basic amino acid residue in the peptide or its salt and the precursor of the hydrophobic tail is an amide bond, an ester bond, a hydrazone bond or an oxime bond, the precursor comprising the hydrophobic tail and a second reactive group that can react with the reactive group in the side chain of the reactive basic amino acid residue in the peptide or its salt.

[0469] In another preferred embodiment, each amphiphilic molecule of the library is obtained by reacting "n" peptides or salts thereof with at least "3n" hydrophobic tail precursors, the precursors comprising a second reactive group that reacts with a reactive group in a reactive basic amino acid residue to form a covalent bond. Preferably, one peptide or salt thereof is contacted and reacted with one hydrophobic tail precursor, i.e., each peptide in the amphiphilic molecule comprises a single type of hydrophobic tail.

[0470] Methods for identifying amphiphilic molecules

[0471] The present invention further provides a method for identifying an amphiphilic molecule suitable for delivering a biomolecule of interest into a cell, the method comprising, or consisting of:

[0472] (i) contacting a biomolecule of interest with a library according to the present invention under conditions suitable for binding / complexation of the amphiphilic molecule and the biomolecule of interest;

[0473] (ii) optionally, selecting amphiphilic molecules that bind / complex with the biomolecule of interest and excluding those amphiphilic molecules that do not bind / complex with the biomolecule of interest, and / or

[0474] (iii) Screening for amphiphilic molecules suitable for delivering biomolecules of interest into cells.

[0475] Preferably, the biomolecule of interest is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules, as described in detail in the description above.

[0476] All terms and embodiments described elsewhere in relation to previous aspects of the invention apply equally to the current aspects of the invention.

[0477] Use in pharmaceuticals

[0478] In still another aspect, the present invention relates to a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for use in a medicament / as a medicament. Therefore, the present invention also relates to the use of a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention in medicine and / or for the manufacture of a medicament.

[0479] In a further aspect, the present invention relates to a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for use as a vaccine or as an immunogenic composition. Therefore, the present invention also relates to the use of a peptide according to the invention, preferably a cationic peptide, or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for the manufacture of a vaccine. Therefore, the present invention provides a vaccine comprising a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention.

[0480] As used herein, the term "vaccine" refers to a substance or composition that establishes or improves immunity to a specific disease by inducing an adaptive immune response (including immune memory). Non-limiting examples of this specific disease include infectious diseases and cancer. Non-limiting examples of infectious diseases include those caused by HIV, HIV-1, SARS-CoV-1, SARS-CoV-2, rabies virus, cytomegalovirus, Zika virus, hepatitis C virus, human papillomavirus, respiratory syncytial virus, Streptococcus spp., Moloney murine leukemia virus, Ebola virus, Toxoplasma gondii or influenza virus. Non-limiting examples of cancers to be treated with the product of the present invention include acute myeloid leukemia, chronic myeloid leukemia, multiple solid tumors, mesothelioma, glioblastoma, renal cell carcinoma, pancreatic cancer, breast cancer, non-small cell lung cancer, prostate cancer, metastatic prostate cancer, malignant glioma, brain cancer, brain metastasis, ovarian cancer, colorectal cancer, myelodysplastic syndrome, metastatic lung cancer, renal cell carcinoma or melanoma. In a specific embodiment, the infectious disease or cancer is Pardi N. et al. (2018), Nature Reviews, 17: Any of those mentioned in 261-279. Vaccines generally contain agents similar to microorganisms or parts thereof that cause disease (e.g., polypeptides or nucleic acids encoding polypeptides). Vaccines may be preventive or therapeutic. In another aspect, the present invention relates to vaccines comprising a peptide or salt thereof of the present invention, an amphiphilic molecule according to the present invention, or a complex according to the present invention. As used herein, the term "adjuvant" refers to a substance that, when added to an immunogenic agent, non-specifically enhances or strengthens the immune response to the immunogenic agent in a recipient host after exposure to a mixture. As used herein, the term "immunogenic agent" or "immunogen" refers to an antigen that, if injected by itself, can provoke an adaptive immune response. All immunogens are also antigens, but not all antigens are immunogens.

[0481] The vaccine of the present invention can be a tolerogenic vaccine. Tolerogenic vaccines are used to re-establish immune tolerance, restore immune balance, and thus reverse autoimmune diseases and / or allergic reactions. Tolerogenic vaccines induce long-term antigen-specific inhibitory memory that blocks pathogenic T cell responses by losing effector T cells and gaining regulatory T cell function (see, for example, Mannie, MD, Curtis II, AD, (2013). "Tolerogenic vaccines for Multiplesclerosis." Human vaccines & immunotherapeutics 9, 1032-1038).

[0482] It is also envisaged that the peptide according to the invention, preferably a cationic peptide, or a salt thereof, the amphiphilic molecule according to the invention, or the complex according to the invention is suitable for use as a nucleic acid vaccine (NAV), in particular an mRNA vaccine. Nucleic acid vaccines (NAV) are described in detail, for example, in patent US 9,872,900 B2.

[0483] As used herein, the term "therapy" or "treatment" refers to any type of therapy that is intended to terminate, prevent, improve or reduce susceptibility to a clinical condition as described herein. In a preferred embodiment, the term treatment refers to the preventive treatment of a disorder or condition as defined herein (i.e., a therapy that reduces susceptibility to a clinical condition). Therefore, "treatment" and its equivalent terms refer to obtaining a desired pharmacological or physiological effect, covering any treatment of a pathological condition or disorder in a mammal (including humans). The effect may be preventive in terms of completely or partially preventing a disorder or its symptoms, and / or may be therapeutic in terms of partially or completely curing a disorder and / or an adverse effect attributable to a disorder. That is, "treating" includes (1) preventing the occurrence or recurrence of a disorder in a subject, (2) inhibiting a disorder, such as inhibiting its development, (3) stopping or terminating the disorder or at least the symptoms associated therewith, for example, by restoring or repairing a lost, missed or defective function so that the host no longer suffers from the disorder or its symptoms, such as causing regression of the disorder or its symptoms, or (4) alleviating, alleviating or ameliorating the disorder or symptoms associated therewith, where improvement is used in a broad sense to refer to a decrease in at least the magnitude of a parameter (such as inflammation, pain or immune deficiency).

[0484] The peptide (preferably a cationic peptide) or a salt thereof according to the present invention, the amphiphilic molecule according to the present invention or the complex according to the present invention can be provided as a pharmaceutical composition comprising the peptide, amphiphilic molecule or complex and a pharmaceutically acceptable carrier.

[0485] As used herein, the term "pharmaceutical composition" refers to a composition comprising a therapeutically effective amount of a peptide or a salt thereof, an amphiphilic molecule or a complex and at least one pharmaceutically acceptable excipient. The pharmaceutical composition according to the present invention can be prepared, for example, in the form of an injection, such as a liquid solution, a suspension, and an emulsion. The terms "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier", "pharmaceutically acceptable diluent" or "pharmaceutically acceptable vehicle" used interchangeably herein refer to non-toxic solid, semi-solid or liquid fillers, diluents, encapsulating materials or any conventional type of formulation adjuvant. The pharmaceutically acceptable carrier is substantially non-toxic to the recipient at the dose and concentration employed and is compatible with the other ingredients of the formulation. Suitable carriers include, but are not limited to, water, dextrose, glycerol, saline, ethanol, and combinations thereof. The carrier may contain additional agents, such as wetting or emulsifying agents, pH buffers, or adjuvants that enhance the effectiveness of the formulation. Specifically for injectable solutions, water or saline solutions and aqueous dextrose and glycerol solutions are preferably used as vehicles. Suitable pharmaceutical vehicles are described in "Remington: the science and practice of pharmacy", (21st edition, Lippincott Williams & Wilkins, 2006).

[0486] As used herein, the term "therapeutically effective amount" with respect to a peptide, amphiphilic molecule or complex comprised by a pharmaceutical composition of the present invention refers to a sufficient amount of a peptide or salt thereof, amphiphilic molecule or complex to provide the desired effect, i.e., to achieve a significant prevention, cure, delay, reduction in severity or improvement of one or more symptoms from a disease and, the sufficient amount will generally be determined by the characteristics of the agent itself and the therapeutic effect to be achieved and other reasons. It also depends on the subject to be treated, the severity of the disease suffered by the subject, the selected dosage form, etc. For this reason, the dosages mentioned in the present invention must be considered only as a guide for those skilled in the art, who must adjust the dosage depending on the variables previously described. In one embodiment, an effective amount produces an improvement in one or more symptoms of the disease being treated. Those skilled in the art are familiar with the principles and procedures discussed in widely known and available resources, such as Remington's Pharmaceutical Science (17th edition, Mack Publishing Co., Easton, Pa., 1985) and Goodman and Gilman's The Pharmaceutical Basis of Therapeutics (8th edition, Pergamon Press, Elmsford, NY, 1990).

[0487] The compound or pharmaceutical composition for use according to the present invention can be administered to the subject by any suitable route of administration, for example, parenteral (e.g., intramuscular, intravenous, subcutaneous, nasal, etc.), enteral (i.e., oral, rectal, etc.), topical, etc. In a specific embodiment, the composition for use in the present invention is administered via intraperitoneal, intrathecal, intravesical, intrapleural, intravenous, intramuscular, subcutaneous, nasal or topical routes. In the case of solid tumors, the compound or pharmaceutical composition for use according to the present invention can be directly administered to the tumor. In another specific embodiment, the compound or pharmaceutical composition for use according to the present invention is administered parenterally, preferably by intravenous or intramuscular routes. In a preferred embodiment, the compound or pharmaceutical composition for use according to the present invention is administered by intravenous routes. The compound or pharmaceutical composition for use according to the present invention can be directly administered to the subject by conventional methods. Alternatively, the pharmaceutical composition for use according to the present invention can be used for ex vivo transfection of cells, for example, mammalian cells, including humans, which are then implanted into the human body or animal to obtain the desired therapeutic effect. For administration to the human body or animal, the cell will be formulated in a suitable medium that does not have an adverse effect on cell viability. The terms "subject", "patient" or "individual" are used interchangeably herein to refer to any member of the animal kingdom and may be a vertebrate (e.g., fish, birds), reptile, amphibian or mammal, including humans, non-human primates, horses, pigs, rabbits, dogs, sheep, goats, cows, birds, cats, guinea pigs or rodents. Preferably, the subject is a mammal, more preferably a human.

[0488] All terms and embodiments described elsewhere herein apply equally to these aspects of the invention.

[0489] Pharmacological composition of the present invention

[0490] In another aspect, the present invention relates to a pharmaceutical composition comprising a therapeutically effective amount of a peptide according to the invention (preferably a cationic peptide) or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention, together with at least one pharmaceutically acceptable excipient. Therefore, the present invention further provides a pharmaceutical composition comprising a peptide according to the invention, an amphiphilic molecule according to the invention or a complex according to the invention and a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable excipient. The present invention further provides a pharmaceutical composition according to the invention for use in therapy / as a medicament.

[0491] All terms and embodiments described elsewhere herein apply equally to these aspects of the invention.

[0492] In vivo delivery methods

[0493] In another aspect, the invention relates to a method of delivering a biomolecule of interest to a subject comprising administering to the subject a complex according to the invention.

[0494] Amino Acids of the Present Invention

[0495] In another aspect, the present invention provides amino acids suitable for synthesizing the peptides and amphiphiles of the present invention. The amino acids of the present invention have the following formula (Formula III) or formula (IV):

[0496]

[0497] in:

[0498] -X is an N-terminal protecting group,

[0499] -Y is a hydrazide (Formula III) or aminooxy (Formula IV) reactive group protecting group,

[0500] - n is the length of the side chain of the amino acid (n = 2 to 4; Dab, Orn and Lys), and

[0501] - m is the length of the linker containing the reactive group (m = 1 to 10, preferably 1 to 5, more preferably 1 to 3).

[0502] Preferably, the amino acid is selected from lysine (Lys, K; n=4), ornithine (Orn, O; n=3) or 2,4-diaminobutyric acid (Dab; n=2).

[0503] In addition, as shown in the above formulas (III) and (IV), the amino acid comprises a reactive group connected to the amino acid side chain, wherein the reactive group is selected from hydrazide (Hyd) (Formula III) or aminooxy (Formula IV). The reactive group is directly or via a linker connected to the amino acid side chain. The linker may comprise 1 to 10 carbon atoms (m may be a natural number selected from 1 to 10, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10). In a preferred embodiment, m is a natural number selected from 1 to 5, such as 1, 2, 3, 4 or 5. More preferably, m is selected from 1 to 3, such as 1, 2 or 3.

[0504] In a preferred embodiment, the amino acid of the present invention is selected from Lys(Hyd)-OH, Orn(Hyd)-OH and Dab(Hyd)-OH, wherein "Hyd" refers to hydrazide. Thus, the amino acid of the present invention may comprise lysine (Lys, K), ornithine (Orn, O) or 2,4-diaminobutyric acid (Dab) and a hydrazide connected to the side chain of K, O or Dab. As described above, the hydrazide group may be connected to the side chain of K, O or Dab directly or via a linker. For example, when the reactive group is a hydrazide, the linker may be a carboxylic acid, such as glutaric acid or succinic acid.

[0505] In one embodiment, K, O or Dab of the present invention is a modified K, O or Dab, which comprises a hydrazide carboxylic acid, preferably glutaric acid monohydrazide, succinic acid monohydrazide, see, for example, "Hydrazone-modulated peptides for efficient gene transfection" (J. Mater. Chem. B (2017), 5: 4426-4434).

[0506] The amino acids of the present invention contain two protecting groups, X and Y, in Formula III and IV. Amino acid protecting groups are described, for example, in Isidro-Llobet et al., "Amino acid-protecting groups", Chem. Rev., 2009, 109: 2455-2504. For example, the N of the amino acids of the present invention α -amino (NH3) is blocked by a suitable protecting group X, an N-terminal protecting group, such as 9-fluorenylmethoxycarbonyl (Fmoc) or tert-butyloxycarbonyl (Boc). In a preferred embodiment, X is Fmoc. For example, the terminal amine in a reactive group (e.g., hydrazide or aminooxy), Y in formula (III) or (IV) is blocked by a suitable protecting group, such as 2-chlorobenzyloxycarbonyl (Cl-Z), tert-butyloxycarbonyl (Boc) and 4-methyltrityl (Mtt). In a preferred embodiment, Y is Boc.

[0507] In a preferred embodiment, the amino acid of the present invention has the following formula V:

[0508]

[0509] (Also known as Fmoc-Lys(Boc-glutaric acid monohydrazide)-OH)

[0510] As shown in the examples (Example 1), the use of the amino acids of the present invention in the synthesis of the peptides and amphiphiles of the present invention provides advantages for the synthesis. The synthesis is simplified, for example, the synthesis time can be significantly shortened when the amino acids of the present invention are used compared to the standard synthesis protocol (see Example 1).

[0511] All terms and embodiments described elsewhere in relation to previous aspects of the invention are equally applicable to the current aspects of the invention.

[0512] As used herein, the terms "comprising" or "comprises" also disclose "consisting of," in accordance with generally accepted patent practice.

[0513] Example

[0514] The following invention is described by the following examples, which should be construed as merely illustrative and not limiting the scope of the invention.

[0515] Example 1: Materials and Methods

[0516] Peptide synthesis

[0517] Figure 1 Show the schematic overview of the synthesis procedure. In brief, all peptides are synthesized by manual Fmoc solid phase peptide synthesis using Rink amide (LL) ProTide resin (load 0.2mmol / g). Resin (0.1mmol) is expanded in DMF (peptide synthesis grade, 2mL) for 10 minutes in peptide synthesis container before synthesis. The coupling cycle consists of the following: the piperidine solution (20%, 2mL) used in DMF removes the Fmoc protecting group and continues for 10 minutes and then the mixture is filtered, and the resin is washed with DMF (3x 2mL, 1 minute). Amino acid coupling is carried out by the solution treatment of α-amino acid (3 equivalents) and N-HBTU (2.95 equivalents) used in DMF (2mL), and the solution is mixed with DIEA (0.195M solution in DMF, 1.2 equivalents) for 1 minute before adding, and the resulting mixture is passed through N2 bubbling vibration 15 minutes. Finally, the resin is washed with DMF (3x 2mL, 1 minute). The protected amino acids used (in their L- or D-form, depending on the peptide) were the following:

[0518] Fmoc-Arg(Pbf)-OH;

[0519] Fmoc-Leu-OH;

[0520] Fmoc-His(Trt)-OH;

[0521] Fmoc-Lys(Mtt)-OH; and

[0522] Fmoc-Orn(Mtt)-OH.

[0523] Once the linear peptide is complete, acetylation of the N-terminus is performed by standard Fmoc removal conditions (20% piperidine in DMF), followed by treatment with a solution of acetic anhydride and 2,6-lutidine (1:1, 1 mL) for 20 minutes. The resin is washed with DCM (2x2 mL, 5 minutes) and the Mtt protecting group is selectively removed by mechanical shaking of the resin with a mixture of DCM / HFIP / TFE / TIS (6.5:2:1:0.5, 3x2 mL, 2 hours). Finally, the mixture is filtered and the resin is washed with DCM (2x 2 mL, 2 minutes) and DMF (2 mL, 10 minutes). Boc-aminooxyacetic acid ( Figure 1; Linker C), Boc-protected succinic acid monohydrazide ( Figure 1 ; Linker B) or Boc-protected glutaric acid monohydrazide ( Figure 1 A solution of (10 equiv.; linker A) (2.5 equiv. / free amine) and N-HATU (2.5 equiv. / free amine) was added to the resin, followed by dropwise addition of a solution of DIEA (10 equiv.). The resin was bubbling with N2 for 30 min and finally washed with DMF (3 x 2 mL, 2 min) and DCM (3 x 2 mL, 2 min).

[0524] Peptide reference Peptide sequence SEQ ID NO: 7.2 <![CDATA[Ac-RK*LRRK*L-NH2]]> SEQ ID NO:26 7.3 <![CDATA[Ac-RK*LRK*K*L-NH2]]> SEQ ID NO:11 7.3 (Leu-Arg) <![CDATA[Ac-RK*RRK*K*R-NH2]]> SEQ ID NO:12 7.3(Leu-His) or 7.3(LH) <![CDATA[Ac-RK*HRK*K*H-NH2]]> SEQ ID NO:1 7.3(LH)(KO) <![CDATA[Ac-RO*HRO*O*H-NH2]]> SEQ ID NO:52 R+7.3(LH)–H <![CDATA[Ac-RRK*HRK*K*-NH2]]> SEQ ID NO:53 R+7.3(LH) <![CDATA[Ac-RRK*HRK*K*H-NH2]]> SEQ ID NO:54 R+7.3–L <![CDATA[Ac-RRK*LRK*K*-NH2]]> SEQ ID NO:55 R+7.3 <![CDATA[Ac-RRK*LRK*K*L-NH2]]> SEQ ID NO:56 RR+7.3 <![CDATA[Ac-RRRK*LRK*K*L-NH2]]> SEQ ID NO:57 V3-7.3(LH) <![CDATA[Ac-RO*HRK*K*H-NH2]]> SEQ ID NO:58 V4-7.3(LH) <![CDATA[Ac-RK*HRK*O*H-NH2]]> SEQ ID NO:59 7.3(H,I) <![CDATA[Ac-RK*IRK*K*H-NH2]]> SEQ ID NO:65 7.3(H,V) <![CDATA[Ac-RK*VRK*K*H-NH2]]> SEQ ID NO:66 7.3(LH)-OH Ac-RK*HRK*K*H-OH SEQ ID NO:68 <![CDATA[NH2-7.3(L-H)]]> <![CDATA[NH2-RK*HRK*K*H-NH2]]> SEQ ID NO:69 7.3 (LH, K-Dab) <![CDATA[Ac-RDab*HRDab*Dab*H-NH2]]> SEQ ID NO:70 <![CDATA[7.3(L-H,ONH2)]]> <![CDATA[Ac-RK*(ONH2) 1 HRK*(ONH2)K*(ONH2)H-NH2]]> SEQ ID NO:71 7.3(LH,C4Hyd) <![CDATA[Ac-RK*(C4Hyd) 2 HRK*(C4Hyd)K*(C4Hyd)H-NH2]]> SEQ ID NO:72 9.2 <![CDATA[Ac-RK*LRRLLRK*-NH2]]> SEQ ID NO:31 9.3 <![CDATA[Ac-RK*LRRK*LRK*-NH2]]> SEQ ID NO:13 13.2 <![CDATA[Ac-RRLK*RLLRRLK*RL-NH2]]> SEQ ID NO:34 13.3 <![CDATA[Ac-RRLK*RLK*RRLK*RL-NH2]]> SEQ ID NO:14 13.3(2+1) <![CDATA[Ac-RRLK*RK*LRRLK*RL-NH2]]> SEQ ID NO:15 13.3(3b) <![CDATA[Ac-RRK*K*RK*LRRLLRL-NH2]]> SEQ ID NO:16 13.3 (Leu-His) <![CDATA[Ac-RRHK*RLK*RRLK*RL-NH2]]> SEQ ID NO:17 13.3(RH) <![CDATA[Ac-RHLK*RLK*RRLK*RL-NH2]]> SEQ ID NO:18 13.3(3His) <![CDATA[Ac-RHLK*RHK*RRLK*RH-NH2]]> SEQ ID NO:19 17.3 <![CDATA[Ac-RRLK*RLLRRLK*RLK*RRL-NH2]]> SEQ ID NO:21 21.3 <![CDATA[Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2]]> SEQ ID NO:23

[0525] 1 (ONH2) represents an aminooxy group, specifically an aminooxyacetic acid group

[0526] 2 *(C4Hyd) represents succinic acid monohydrazide

[0527] Finally, the peptide was deprotected and cleaved from the resin by a standard TFA cleavage procedure at room temperature for 2 hours using TFA / DCM / H2O / TIS (90:5:2.5:2.5, 1 mL / 70 mg resin). Then, the mixture was filtered, washed with TFA (1 mL), and the peptide was precipitated with ice-cold Et2O (25 mL). The precipitate was centrifuged and dissolved in H2O (4 mL). Purification was performed by C18 RP-HPLC [Phenomenex Luna C18(2)100A column, H2O (0.1% TFA) / CH3CN (0.1% TFA) 95:5→5:95 (0→5 min), 95:5→5:95 (5→35 min)] with a binary gradient of solvent A and solvent B, and the collected fractions were lyophilized and stored at -20°C. The peptide was purified by analytical HPLC-MS and 1 H-NMR confirmed purity and identity.

[0528] In addition, peptide 7.3 (Leu-His) (Ac-RK*HRK*K*H-NH2, SEQ ID NO: 1) was synthesized using D-amino acids.

[0529] It should be noted that, unless otherwise specified, all synthetic peptides are N-acetylated and C-amidated. For example, peptide 7.3(LH)-OH (SEQ ID NO.: 68) is not C-amidated. For example, peptide NH2-7.3(LH) (SEQ ID NO.: 69) is not N-acetylated.

[0530] Preparation of amphiphilic molecules

[0531] A solution of neat peptide in DMSO (10 mM) was mixed with a solution of the hydrophobic aldehyde tail in 15% AcOH / DMSO (1 to 5 equivalents per reactive basic amino acid residue containing a reactive group in its side chain; 5 equivalents per reactive basic amino acid residue was used unless otherwise specified, see e.g., Fig.30 , where different stoichiometric conditions were used). The mixture was stirred at 60°C for 2 hours, the resulting pool of amphiphiles was tested for robotic screening and combined with the corresponding cargo without further purification steps, in this way minimizing the time required for synthetic work and identification of new candidates for polynucleotide delivery.

[0532] The hydrophobic aldehyde tail is as follows (chemical structure shown below):

[0533] Hex Hexanal CAS:66-25-1 Dec Decanal CAS:112-31-2 Dod(DO) Dodecanal CAS:112-54-9 Myr(M) Myristenal From myristenol Pal(PA) Palmitoyl aldehyde From palmitole Pet(PE) phellandrenal From phellandrene Ole(O) Olealdehyde From oleyl alcohol Lin Linolenic acid From linoleyl alcohol Eic Eicosenal From cis-11-eicosenoic acid Tet Tetracosenoic aldehyde From cis-15-isotetraenoic acid methyl ester

[0534]

[0535] DLS and zeta potential measurements

[0536] DLS and zeta potential measurements were performed in a Malvern Zetasizer NanoZS using standard disposable cuvettes. All experiments were performed in triplicate at 25°C. Freshly prepared amphiphile solutions in AcOH / DMSO were diluted with MQ water, complexed with pDNA or mRNA, and after the complexation step, the pH was adjusted with diluted NaOH (initial pH = 4).

[0537] NMR characterization

[0538] The amphiphile 7.3(LH)M was prepared according to the protocol described in Example 1 (Preparation of Amphiphilic Molecules) and then washed with Et2O to remove the excess aldehyde tail employed in the reaction. The resulting gel was then dissolved in DMSO-d6 at a final concentration of 6.6 mM and the NMR spectrum was recorded on a Varian Inova 500 MHz spectrometer. Fig. 22 show 1 H NMR spectroscopy: The presence of a set of singlet signals above 10 ppm and the corresponding integrated signal ratios confirmed the successful attachment of the three hydrophobic tails to the peptide scaffold.

[0539] Synthesis of SPPS-compatible artificial amino acids containing a glutaric acid monohydrazide linker [Fmoc-Lys(Boc-Hyd)-OH]

[0540] Fmoc-Lys(Boc-Hyd)-OMe. A solution of Boc-protected glutaric acid monohydrazide (0.88 g) in anhydrous CH2Cl2 (40 mL) was treated with diisopropylethylamine (2.44 mL, 4 equivalents) and N-HATU (2.04 g, 1.5 equivalents). Then, Fmoc-Lys(HCl)-OMe (1.5 g, 1 equivalent) was added and the mixture was stirred at room temperature under an inert gas for 2 hours. After this time, the resulting organic phase was washed with dilute HCl (2 x 25 mL) and saturated NaHCO3 solution (2 x 25 mL). The organic phase was dried over anhydrous MgSO4 and concentrated under vacuum. The crude mixture was purified by flash chromatography (0 to 6% MeOH / CH2Cl2) to obtain the desired compound as a clear oil, which was foamy under high vacuum (1.81 g, 82% yield). The product was purified by analytical HPLC-MS and 1 H-NMR confirmed purity and identity.

[0541] Fmoc-Lys(Boc-Hyd)-OH. Fmoc-Lys(Boc-Hyd)-OMe (1.5 g) was dissolved in 0.8 M CaCl2iPrOH / H2O solution (7:3 ratio; total volume 27 mL). Then, NaOH (0.12 g, 1.2 eq.) was added and the mixture was stirred for 6 hours. 20 mL of H2O was added to the reaction vessel and the iPrOH was concentrated under vacuum. The resulting aqueous phase was acidified with 5% aqueous HCl solution until pH 2 and extracted with CH2Cl2 (4 x 15 mL). The combined organic phases were dried over anhydrous MgSO4 and concentrated under vacuum to give the target compound as a clear thick oil (1.1 g, 78% yield). The product was purified by analytical HPLC-MS and 1 H-NMR confirmed purity and identity.

[0542] Peptide Synthesis Using Fmoc-Lys(Boc-Hyd)-OH

[0543] Fig.28Schematic overview showing peptide synthesis procedures. Briefly, 7.3 (LH) peptides are synthesized using Rink amide (LL) ProTide resin (load 0.2mmol / g) by manual or robot-assisted Fmoc solid phase peptide synthesis. Resin (0.05mmol) was expanded in DMF (peptide synthesis grade, 2mL) for 10 minutes in a peptide synthesis vessel before synthesis. The coupling cycle consists of the following: the Fmoc protecting group is removed in a piperidine solution (20%, 2mL) in DMF for 10 minutes and then the mixture is filtered, and the resin is washed with DMF (3x 2mL, 1 minute). Amino acid coupling was performed by treating with a solution of α-amino acid (3 equiv. for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH; 2 equiv. for Fmoc-Lys(Boc-Hyd)-OH) and N-HBTU (2.95 equiv. for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH; 1.95 equiv. for Fmoc-Lys(Boc-Hyd)-OH) in DMF (2 mL) mixed with DIEA (0.195 M solution in DMF, 3 equiv. for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH; 2 equiv. for Fmoc-Lys(Boc-Hyd)-OH), and the resulting mixture was shaken by bubbling N2 for 15 min. Finally, the resin was washed with DMF (3 x 2 mL, 1 min).

[0544] Once the linear peptide was complete, acetylation of the N-terminus was performed by standard Fmoc removal conditions (20% piperidine in DMF), followed by treatment with a solution of acetic anhydride and 2,6-lutidine (1:1, 1 mL) for 20 min. The resin was washed with DCM (2 x 2 mL, 5 min).

[0545] Finally, the peptide was deprotected and cleaved from the resin by a standard TFA cleavage procedure at room temperature for 2 hours using TFA / DCM / H2O / TIS (90:5:2.5:2.5, 1 mL / 70 mg resin). Then, the mixture was filtered, washed with TFA (1 mL), and the peptide was precipitated with ice-cold Et2O (25 mL). The precipitate was centrifuged and dissolved in H2O (4 mL). Purification was performed by C18 RP-HPLC [Phenomenex Luna C18(2)100A column, H2O (0.1% TFA) / CH3CN (0.1% TFA) 95:5→5:95 (0→5 min), 95:5→5:95 (5→35 min)] with a binary gradient of solvent A and solvent B, and the collected fractions were lyophilized and stored at -20°C. The peptide was purified by analytical HPLC-MS and 1 H-NMR confirmed purity and identity.

[0546] It should be noted that synthetic attempts using this protocol allow saving operator time up to 8 hours (about 35% of the total synthesis time), as opposed to the previously mentioned "Peptide synthesis" protocol (first item in the "Materials and Methods" section), in which Fmoc-Lys(Mtt)-OH is used for the peptide extension phase. In addition, the purity of the crude compound can be enhanced using this methodology, which provides an improved overall yield and a simpler purification process.

[0547] Example 2: In vitro transfection protocol

[0548] Cells expressing EGFP

[0549] To generate HeLa cell lines expressing EGFP, HeLa cells were transfected with EGFP pDNA (pEGFP-C1, Clontech) and selected for stable transfection using 400 μg / mL G-418 (Millipore). Green clones were selected by epifluorescence microscopy and EGFP expression stability was tested by several passages. For further experiments, clones with highly stable EGFP expression (about 90% EGFP positive cells) were selected, and for further details, see I. Lostalé-Seijo et al. (Peptide / Cas9 nanostructures for ribonucleoprotein cell membrane transport and gene edition, Chem. Sci., 2017). All other cell lines expressing EGFP were obtained in a similar manner from parental non-expressing EGFP cell lines.

[0550] The following cell lines were used in the examples:

[0551] HeLa, corresponding to ATCC number CCL-2 (https: / / www.atcc.org / products / ccl-2);

[0552] A549, corresponding to ATCC number CCL-185 (https: / / www.atcc.org / products / ccl-185);

[0553] HepG2, corresponding to ATCC number HB-8065 (https: / / www.atcc.org / products / hb-8065);

[0554] HCT116, corresponding to ATCC number CCL-247 (https: / / www.atcc.org / products / ccl-247);

[0555] ARPE19, corresponding to ATCC No. CRL-2302 (https: / / www.atcc.org / products / crl-2302); and

[0556] HEK293, corresponding to ATCC number CRL-1573 (https: / / www.atcc.org / products / crl-1573).

[0557] siRNA

[0558] One day before the experiment, cells expressing EGFP were seeded in 96-well plates at a concentration of 50,000 cells / mL (100 μL / w) in DMEM+10% FBS+1% Gln-Abt. For robotic library screening, siRNA targeting EGFP (EGFP: enhanced green fluorescent protein, Delivery of GFP positive control siRNA (siGFP) (AM4626). Prior to the transfection experiment, the amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the siRNA stock solution in DMEM to obtain several complexes at different amphiphile concentrations (2 to 10 μM) while maintaining a constant final siRNA concentration of 30 nM. The mixture was shaken at room temperature (rt) for 30 minutes before adding to the cells. The cell culture medium was aspirated and the cells were washed twice with PBS. Finally, 50 μL of the solution of siRNA / amphiphile complex was added to the cells and incubated for 4 hours. After transfection, the culture medium was replaced with 100 μL fresh DMEM supplemented with 10% FBS. After 72 hours, the cells were plated in a plate reader by comparing the control transfected non-targeting siRNA (siMOCK, Silencer TM Fluorescence knockdown was quantified by comparing cells treated with negative control siRNA No. 1 (siMOCK) (AM4611). Comparison of RNAiMAX silencing efficiency (30 to 60% depending on the cell line, defined using the values ​​in the table below). All experiments were performed in triplicate.

[0559] As shown in Tables 1 to 5 and 7, the tested amphiphiles were able to deliver siRNA into cells, outperforming the gold standard. In addition, as shown in Tables 20 to 25, amphiphiles incorporating three hydrophobic tails into their structure exhibit improved delivery performance (EGFP fluorescence decreases with percentage of siMOCK transfection) compared to amphiphiles containing less than three hydrophobic tails. Amphiphilic molecules comprising peptides with 9 or 13 amino acids express particularly well for siRNA delivery, especially when combined with DO, M, PA or PE hydrophobic tails, specifically with PE hydrophobic tails. For example, peptide 13.3 in combination with DO or PA hydrophobic tails or 13.3 (LH) in combination with PE, PA or M hydrophobic tails express particularly well for delivery of siRNA to the cell lines tested.

[0560] For the analysis based on cytometry, the delivery of siRNA (siGFP) in A549-GFP cells was carried out. Before the transfection experiment, the amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the siRNA stock solution in DMEM to obtain several complexes under different amphiphile concentrations (5 to 10 μM), while maintaining the constant final siRNA concentration of 100 nM. The mixture was vibrated at room temperature for 30 minutes and then added to the cells. The cell culture medium was sucked out, and the solution of 50 μL of the complex was added to the cells and incubated for 4 hours. After incubation, the culture medium was replaced with 100 μL fresh DMEM supplemented with 10% FBS. After transfection for 72 hours, DMEM was removed and cells were cultured with 100 μL trypsin for 5 minutes. Then, 100 μL PBS (2% FBS and 1% EDTA 0.5M) was added. Finally, GFP fluorescence measurement and quantitative GFP positive percentage were carried out by flow cytometry. The transfection efficiency of amphiphiles (i.e., GFP silencing) was compared with that of controls (untreated cells; normalized to 100% GFP expression) and cells transfected with siMOCK ( Fig.29 All experiments were performed in triplicate. Quantification of GFP positive percentage is shown in Fig.29 middle.

[0561] pDNA

[0562] One day before the experiment, cells were inoculated into 96-well plates at a concentration of 60,000 cells / mL (100 μL / w) in DMEM+10% FBS+1% Gln-Abt. For robot library screening, delivery of pDNA encoding Renilla luciferase gene (Rluc, pRL-CMV (Promega, #E2261)) expression was performed in six different cell lines. Before the transfection experiment, the amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the pDNA stock solution in DMEM to obtain several complexes at different amphiphilic concentrations (2 to 10 μM), while maintaining a constant final pDNA concentration of 2 ng / μL. The mixture was vibrated at room temperature for 30 minutes and then added to the cells. The cell culture medium was aspirated and the cells were washed twice with PBS. Finally, a solution of 50 μL of the complex was added to the cells and incubated for 4 hours. After incubation, the culture medium was replaced with 100 μL fresh DMEM supplemented with 10% FBS. 72 hours after transfection, DMEM was removed, cells were washed once with HBSS, and 90 μl HBSS was added to each well. Cells were incubated at 37°C for 30 minutes. Baseline luminescence levels were then read in a plate reader. Next, 10 μl HBSS containing coelenterazine was added to each well (5 μM final concentration) and cells were incubated at 37°C for 10 minutes. Finally, total luminescence measurement of the plate was performed. Amphiphile transfection efficiencies were compared and normalized to 2000 efficiency (in Tables 1 to 5 and 7, value is 1; bold numbers). All experiments were performed in triplicate.

[0563] As shown in Tables 1 to 5 and 7, the amphiphiles tested were able to deliver pDNA into cells, outperforming the gold label. 2000. In addition, amphiphiles incorporating three hydrophobic tails into their structure exhibit improved delivery performance compared to amphiphiles containing two hydrophobic tails. Examples are illustrated in Tables 8 to 13, specifically for cell lines A549, ARPE19, HCT116, HEK293, HeLa and HepG2, where various three-tail amphiphilic molecules with various hydrophobic tails outnumber their two-tail counterparts. The best candidates are amphiphiles containing cationic peptides with a range of 7 to 17 amino acid numbers. Although not exclusive, the most popular hydrophobic tails are M and PE. Particularly good candidates are peptide 7.3 (LH) (Ac-RK*HRK*K*H-NH2, SEQ ID NO: 1) in combination with M, PA or PE tails, which presented the best transfection results for pDNA delivery across all cell lines tested, or peptide 13.3 (RH) (Ac-RHLK*RLK*RRLK*RL-NH2, SEQ ID NO: 18) with various aldehyde tails (DO, M, PA, PE, O), which were highly effective in many cell lines. In addition, peptide 9.3 (Ac-RK*LRRK*LRK*-NH2, SEQ ID NO: 13) provided a diffuse efficacy for delivering pDNA.

[0564] For the determination based on cytometry, the delivery of pDNA encoding eGFP gene (GFP) expression was carried out in HeLa and A549 cells. Before the transfection experiment, the amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the mRNA stock solution in DMEM, so as to obtain several complexes under different amphiphilic concentrations (2.5 to 10 μM), while maintaining the constant final mRNA concentration of 2ng / μL. The mixture was vibrated at room temperature for 30 minutes and then added to the cells. The cell culture medium was sucked out and the cells were washed twice with PBS. Finally, the solution of 50 μL complexes was added to the cells and incubated for 4 hours. After incubation, the culture medium was replaced with 100 μL fresh DMEM supplemented with 10% FBS. After 72 hours of transfection, DMEM was removed and the cells were cultured with 100 μL trypsin for 5 minutes. Then, 100 μL PBS (supplemented with 2% FBS and 1% EDTA0.5M) was added. Finally, GFP fluorescence was measured by flow cytometry and the percentage of GFP-positive (i.e., transfected cells) was quantified. The transfection efficiency of the amphiphiles was compared to control untreated cells, and all experiments were performed in triplicate. The quantification of the percentage of GFP-positive cells is presented in Fig.24 , Fig.25 and Fig.26 middle.

[0565] mRNA

[0566] The day before the experiment, cells were seeded into 96-well plates at a concentration of 50,000 cells / mL (100 μL / w) in DMEM+10% FBS+1% Gln-Abt. For robotic library screening, EGFP-mRNA (from TriLink, fully substituted with 5-methoxyuridine, capped and polyadenylated; TriLink, Delivery of EGFP mRNA (5 moU, ref. L-7201). Amphiphile stock solutions were prepared in DMSO as described above and diluted in DMEM to obtain a range of concentrations. Solutions of EGFP-mRNA / amphiphile complexes were freshly prepared before transfection experiments. 35 μL of the corresponding amphiphile was added to 10 μL of a solution of 10 ng / μL EGFP-mRNA in DMEM. The mixture was shaken at room temperature for 30 minutes before adding to the cells. The cell culture medium was aspirated and the cells were washed twice with PBS. The cells were covered with 39 μL DMEM, 11 μL of the solution of the complex was added to the cells and incubated for 4 hours (final concentration of peptide = 2.5, 5 and 10 μM; final concentration of EGFP-mRNA = 25 ng / well). After incubation, the culture medium was replaced with 100 μL fresh DMEM supplemented with 10% FBS. Total EGFP fluorescence was quantified in a plate reader after 72 hours. Comparison of amphiphile transfection efficiency and normalization to MessengerMax efficiency (value 1 in Tables 1 to 5 and 7; double underlined numbers). All experiments were performed in triplicate.

[0567] As shown in Tables 1 to 5 and 7, the tested amphiphiles were able to deliver mRNA into cells, outperforming the reagents MessengerMax. In addition, amphiphiles with three hydrophobic tails incorporated into their structure outperformed amphiphiles with two hydrophobic tails incorporated into their structure, see Tables 14 to 19. Amphiphiles comprising 7 amino acid peptides and three hydrophobic tails expressed best in mRNA delivery. For example, peptide 7.3 presented good mRNA delivery results with various hydrophobic tails. Specifically, peptide 7.3 (LH) in combination with M, PA or PE tails presented the best transfection results for mRNA delivery throughout all cell lines tested. Amphiphiles comprising 13 amino acid peptides and three hydrophobic tails also had excellent performance for mRNA delivery.

[0568] For cytometry-based analysis, HeLa and A549 cells were stained with a gene encoding eGFP (GFP, TriLink, EGFP mRNA (5moU), ref. L-7201). Prior to the transfection experiment, the amphiphile stock solution in DMSO was diluted with DMEM and freshly mixed with the mRNA stock solution in DMEM to obtain several complexes at different amphiphile concentrations (2.5 to 10 μM) while maintaining a constant final mRNA concentration of 1 ng / μL. The mixture was shaken at room temperature for 30 minutes before being added to the cells. The cell culture medium was aspirated and the cells were washed twice with PBS. Finally, 50 μL of the complex solution was added to the cells and incubated for 4 hours. After incubation, the culture medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. After 72 hours of transfection, the DMEM was removed and the cells were incubated with 100 μL of trypsin for 5 minutes. Then, 100 μL of PBS (supplemented with 2% FBS and 1% EDTA 0.5M) was added. Finally, GFP fluorescence measurements and quantification of the percentage of GFP positive (i.e., transfected cells) were performed by flow cytometry. The transfection efficiency of amphipathies was compared to control untreated cells and all experiments were performed in triplicate. Quantification of the percentage of GFP-positive cells is presented in Fig.23 and Fig. 27 middle.

[0569] Cas9-RNP (ribonucleoprotein)

[0570] One day before the experiment, cells expressing EGFP were inoculated into 96-well plates at a concentration of 50,000 cells / mL (100 μL / w) in DMEM+10% FBS+1% Gln-Abt. For robot library screening, Cas9-RNPs (RNPs designed to knock out genes encoding enhanced green fluorescent protein (EGFP)) were delivered against EGFP. For RNP assembly, 9.2 μL crRNA and 9.2 μL tracrRNA were mixed in 211.6 μL nuclease-free Duplex buffer (IDT), incubated at 95 ° C for 5 minutes and slowly cooled at room temperature (see I. Lostalé-Seijo et al., Peptide / Cas9 nanostructures forribonucleoprotein cell membrane transport and gene edition, Chem. Sci., 2017). Cas9 protein was dissolved in DMEM at a final concentration of 4 μM, and an equal volume of RNA complex was mixed with Cas9 and incubated at room temperature for 5 minutes. 75 μL of the corresponding amphiphile concentrate was added to 5 μL of 2 μM RNP. The mixture was shaken at room temperature for 30 minutes and then added to the cells. The cell culture medium was aspirated and the cells were washed twice with PBS. 30 μL of DMEM was used to cover the cells, and 20 μL of RNP / amphiphile complexes were added to the cells (final peptide concentration = 2.5, 5 and 10 μM; final Cas9-RNP concentration = 50 nM) and incubated for 4 hours. After incubation, the culture medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. Total EGFP fluorescence was quantified in a plate reader after 72 hours ( Figure 2 , Table 1 (right) and Table 6). All experiments were performed in triplicate.

[0571] As shown in Tables 1 and 6, the tested amphiphiles were able to deliver Cas9-RNP into cells, outperforming CRISPRMAX. Tables 26 to 31 show that amphiphiles that incorporate three hydrophobic tails into their structure outperform amphiphiles that incorporate two hydrophobic tails into their structure.

[0572] The following table shows the transfection and gold labeling of the cargos discussed above in several cell lines. The results of the series comparison.

[0573] Tables 1 to 7: RLuc (pDNA) or EGFP (mRNA) expression levels were normalized to Lipofectamine reagent (value = 1) and expressed as signal increase fold. In the case of siRNA, the fluorescence of cells treated with siRNA was compared with the fluorescence of siMOCK control, while Cas9-RNP-mediated knockdown was measured for the fluorescence of untreated cells. In both siRNA and Cas9-RNP, the values ​​are expressed as % fluorescence reduction. In all cases, the amphiphile concentration was 5 μM. All experiments were performed in triplicate.

[0574] Table 1. pDNA, mRNA , siRNA (left part of the table) and Cas9-RNP (right part of the table) delivery in A549 cells. For siRNA delivery, Values ​​represent 50% knockdown of fluorescence and 50% reduction for Cas9-RNP, LipofectamineCRISPRMax.

[0575]

[0576] For the three nucleic acid cargoes tested (pDNA, mRNA and siRNA), peptides with three tails were able to effectively deliver nucleic acids.See also Tables 8 to 31.

[0577] For pDNA delivery, from all the hydrophobic tails tested, amphiphiles containing dodecanal, myristenyl, palmitoyl, phellinenyl and oleenal in their structure were able to transfect pDNA with good efficiency. Amphiphiles containing peptide 7.3 (Leu-His) with palmitoyl or phellinenyl were the best candidates for delivering pDNA into this cell line, with expression 30 times better than Lipofectamine 2000.

[0578] For mRNA delivery, amphiphiles containing peptide 7.3 (Leu-His) with palmitoyl aldehyde outperform MessengerMAX was twice as active in this cell line.

[0579] For siRNA delivery, amphiphiles containing peptides with 9 and 13 amino acids provided GFP silencing levels of 60 to 75%, while Lipofectamine RNAiMAX silencing levels were approximately 50%.

[0580] For Cas9-RNP delivery, when the protein was complexed with an amphiphile containing 7.3 (Leu-His) and myristenyl, palmitoyl or selenoic acid, the efficiency of GFP silencing was about 60 to 70%. Cells transfected with the above specified complexes exhibited cell viability greater than 80%. Viability analysis was performed using CellTiter Aqueous non-radioactive cell proliferation assay (MTS) and according to the manufacturer's instructions. Briefly, 20 μL of the combined MTS / PMS solution was added to each well of a 96-well assay plate containing cells in a culture medium (100 μl). The plate was incubated for 4 hours at 37°C and 5% CO2 in a humidified atmosphere. Then, absorbance (490 nm) was recorded in an INFINITE M1000 PRO (TECAN).

[0581] Table 2. pDNA, mRNA , siRNA Delivery in ARPE19 cells. For siRNA delivery, Values ​​represent 40% knockdown of fluorescence.

[0582]

[0583] Peptides with three tails were effective in delivering nucleic acids for the three cargoes tested. See also Tables 8 to 31.

[0584] For pDNA delivery, from all the hydrophobic tails tested, amphiphilic molecules containing dodecanal, myristenyl, palmitoyl, or phellandrenal delivered pDNA in this cell line with higher pDNA delivery than the gold standard. Specifically, complexes containing amphiphiles formed from cationic peptide 7.3 (Leu-His) with palmitoyl or phellandrenal were the best candidates for delivering pDNA to this cell line, each being 10 times and 7 times of 2000 are better.

[0585] For mRNA delivery, the complex containing an amphiphile formed by a peptide having 7 amino acids can deliver mRNA better than MessengerMAX, in which the amphiphile containing myristenyl, palmityl and phellandrene is MessengerMAX is up to six times better.

[0586] For siRNA delivery, amphiphiles containing peptides with 7, 9, and 13 amino acids achieved GFP silencing levels of 50 to 65%, while The RNAiMAX silencing efficiency was approximately 40%.

[0587] Table 3. pDNA, mRNA, siRNA Delivery in HCT116 cells. For siRNA delivery, Values ​​represent 40% knockdown of fluorescence.

[0588]

[0589] For the three cargoes tested, the amphiphile comprising a peptide with three hydrophobic tails was able to effectively deliver nucleic acids. See also Tables 8 to 31.

[0590] For pDNA delivery to HCT116 cells, the pDNA delivery from amphiphiles with all hydrophobic tails tested, including dodecanal, myristenyl, palmityl, phellenyl, oleyl, and eicosenal, was higher than that of the gold standard. Specifically, an amphiphile comprising a 7.3 (Leu-His) peptide with palmitolein and an amphiphile comprising a 13 amino acid peptide with histidine (13.3 (Leu-His), 13.3 (Arg-His), or 13.3 (3His)) and palmitolein were the best candidates for pDNA delivery in these cells, each being 2000's are 10 times as much and 9 times better.

[0591] For mRNA delivery, amphiphiles containing a peptide having 7 amino acids can deliver mRNA better than MessengerMAX, wherein the amphiphile containing a peptide having a myristenyl group or a palmitoleic acid group is MessengerMAX is three to six times better.

[0592] For siRNA delivery, amphiphiles containing peptides with 7, 9, and 13 amino acids achieved GFP silencing levels ranging from 51% to 63%, while The RNAiMAX silencing activity was about 40%. When delivering siRNA to HCT116 cells, the amphiphile containing a peptide having 13 amino acids was most effective.

[0593] Table 4. pDNA, mRNA , siRNA Delivery in Hek293 cells. For siRNA delivery, Values ​​represent 30% knockdown of fluorescence.

[0594]

[0595] Against this cell line, a wide variety of peptides in combination with a variety of hydrophobic tails were effective for delivery of the three cargoes tested. See also Tables 8 to 31.

[0596] For pDNA delivery, myristenol was found to be the gold standard among all the hydrophobic tails tested for the best expression of pDNAs with a wide range of peptide lengths. 7 times better delivery efficiency than 2000.

[0597] For mRNA delivery, amphiphiles containing a peptide having 7 amino acids can deliver mRNA better than MessengerMAX, wherein the amphiphile comprising a peptide having a myristenyl group or a selenoic acid group is MessengerMAX is two to three times better.

[0598] For siRNA delivery, amphiphiles containing peptides with 9, 13, and 17 amino acids achieved GFP silencing levels ranging from 40% to 62%, while The silencing activity of RNAiMAX was approximately 30%.

[0599] Table 5. pDNA, mRNA , siRNA Delivery in HeLa cells. For siRNA delivery, Values ​​represent 60% knockdown of fluorescence.

[0600]

[0601] A variety of peptides in combination with a variety of hydrophobic tails were effective for delivery of the three cargoes tested. See also Tables 8 to 31.

[0602] For pDNA delivery, from all the hydrophobic tails tested, palmitoyl and phelgenal were the hydrophobic tails that, when present in amphiphilic molecules along with peptides of different lengths, expressed best for pDNA delivery to HeLa cells. Using these hydrophobic tails, amphiphiles were made the gold standard The efficiency was up to 25 times better than that of 2000. Amphiphiles containing 9 and 13 amino acid peptides and dodecanal as the hydrophobic tail were also able to effectively deliver pDNA to HeLa cells.

[0603] For mRNA delivery, amphiphiles containing 7.3 (Leu-His) peptides can deliver mRNA, which is superior to MessengerMAX, wherein the amphiphile having myristenyl, palmityl or phellandrenal is MessengerMAX is two to three times better.

[0604] For siRNA delivery, amphiphiles containing a peptide having 13 amino acids achieved the best level of GFP silencing, achieving more than 80% silencing activity in some cases, while The silencing activity of RNAiMAX was about 60%.

[0605] For Cas9 delivery (see Table 6 below), the efficiency of GFP silencing was about 80%, where the amphiphile contained a 9 amino acid peptide with three hydrophobic tails and with dodecanal or palmitolenal. Amphiphiles containing 13 amino acid peptides with three hydrophobic tails were also very effective for intracellular delivery of Cas9 in HeLa cells. When used at a concentration of 5 μM (transfection experiments were performed at this concentration), all tested amphiphiles showed cell viability above 80%.

[0606] Table 6. Cas9-RNP delivery in HeLa cells. The table shows the % GFP silencing due to gene editing. Lipofectamine CRISPRMax silenced up to 70% in this case.

[0607]

[0608] Table 7. pDNA, mRNA , siRNA Delivery in HepG2 cells. For siRNA delivery, Values ​​represent 30% knockdown of fluorescence.

[0609]

[0610] For the three cargoes tested, the amphiphilic molecules comprising a peptide and three tails were able to effectively deliver nucleic acids. See also Tables 8 to 31.

[0611] For pDNA delivery, from all the hydrophobic tails tested among the amphiphilic molecules described in the table, myristenol was the hydrophobic tail that expressed best in combination with a 7 amino acid peptide when delivering pDNA in HepG2 cells, with a transfection efficiency of Six times better than 2000.

[0612] Amphiphiles containing the 7.3 (Leu-His) peptide and myristenyl or phlorothenal outperformed MessengerMAX activity.

[0613] For siRNA delivery, the amphiphiles containing a 13 amino acid peptide and palmitoyl or phlorothenal achieved GFP silencing levels of 41% to 46%, while The silencing activity of RNAiMAX was approximately 30%.

[0614] Example 3: In vitro transfection results

[0615] Tables 8 to 31 show the results of pDNA, mRNA, siRNA and Cas9 delivery in different cell lines using the indicated amphiphiles at the indicated concentrations. All experimental details are the same as explained in Example 2.

[0616] pDNA delivery

[0617] Tables 8 to 13 show the average (triplicate) luminescence intensity (RLU) measured after transfection of RLuc pDNA in various cell lines at different concentrations by different amphiphiles. Background luminescence values ​​occupied by non-transfected control cells were subtracted for processing.

[0618] Table 8. pDNA delivery in A549 cells

[0619]

[0620] Table 9. pDNA delivery in ARPE19 cells

[0621]

[0622] Table 10. pDNA delivery in HCT116 cells

[0623]

[0624] Table 11. pDNA delivery in Hek293 cells

[0625]

[0626] Table 12. pDNA delivery in HeLa cells

[0627]

[0628] Table 13. pDNA delivery in HepG2 cells

[0629]

[0630] mRNA delivery

[0631] Tables 14 to 19 show the mean (triplicate) fluorescence intensities measured after transfection of EGFP mRNA in various cell lines at different concentrations by different amphiphiles. Background fluorescence values ​​occupied by untreated control cells were subtracted for processing.

[0632] Table 14. mRNA delivery in A549 cells

[0633]

[0634] Table 15. mRNA delivery in ARPE19 cells

[0635]

[0636] Table 16. mRNA delivery in HCT116 cells

[0637]

[0638] Table 17. mRNA delivery in Hek293 cells

[0639]

[0640] Table 18. mRNA delivery in HeLa cells

[0641]

[0642] Table 19. mRNA delivery in HepG2 cells

[0643]

[0644] siRNA delivery

[0645] Tables 20 to 25 show the average (triplicate) percentage of GFP silencing measured after transfection of siRNA in various cell lines by different amphiphiles at different concentrations, calculated by the reduction of fluorescence intensity relative to the non-targeting siRNA (siMOCK) control. Background values ​​occupied by untreated control cells were subtracted for processing.

[0646] Table 20. siRNA delivery in A549 cells

[0647]

[0648] Table 21. siRNA delivery in ARPE19 cells

[0649]

[0650] Table 22. siRNA delivery in HCT116 cells

[0651]

[0652]

[0653] Table 23. siRNA delivery in Hek293 cells

[0654]

[0655] Table 24. siRNA delivery in HeLa cells

[0656]

[0657]

[0658] Table 25. siRNA delivery in HepG2 cells

[0659]

[0660] Cas9 delivery

[0661] Tables 26 to 31 show the average (triplicate) percentage of gene editing measured after transfection of Cas9-RNP in various cell lines by different amphipathies at different concentrations, calculated by the reduction in GFP fluorescence intensity (% reduction). The background value occupied by untreated control cells was subtracted for processing.

[0662] Table 26. Cas9 delivery in A549 cells

[0663]

[0664]

[0665] Table 27. Cas9 delivery in ARPE19 cells

[0666]

[0667] Table 28. Cas9 delivery in HCT116 cells

[0668]

[0669]

[0670] Table 29. Cas9 delivery in Hek293 cells

[0671]

[0672] Table 30. Cas9 delivery in HeLa cells

[0673]

[0674] Table 31. Cas9 delivery in HepG2 cells

[0675]

[0676]

[0677] Example 4: Intracellular delivery of Cas9 ribonucleoprotein

[0678] The inventors evaluated the use of amphiphilic molecules comprising peptide 7.3 (Leu-His) in combination with myristenyl, palmityl or selene aldehyde to intracellularly deliver Cas9 ribonucleoprotein with EGFP targeting gRNA to HeLa-EGFP cells. After 3 days, EGFP negative cells were quantified by flow cytometry.

[0679] Figure 2 Display and use The amphiphilic molecules containing peptide 7.3 (Leu-His) and either myristenyl or palmitolein achieved 70% editing, compared to 30% editing achieved by the CRISPRMAX control. In addition, the concentrations of cells obtained with both amphiphiles were on average 2.5 times that of cells obtained with the The concentration of cells obtained was three times higher, showing In comparison, both amphiphiles achieved enhanced levels of cell viability.

[0680] Example 5: Transfection experiment using D-peptide

[0681] A 7.3 (Leu-His) peptide with D-amino acids was synthesized. This peptide will be more resistant to degradation by proteases. The inventors studied EGFP pDNA delivery using amphiphiles containing enantiomers (7.3 (Leu-His) peptide with D-amino acids or L-amino acids) and myristenaldehyde to compare their transfection activity in HeLa cells. The number of cells expressing EGFP was measured by flow cytometry. Figure 3 Both peptides were shown to be expressed equally efficiently.

[0682] Example 6: Transfection experiments in confluent cells

[0683] Experiments were performed in cultured cells at different confluence levels to examine the effect of this parameter on the activity of the amphiphile 7.3(Leu-His)M. As described above, transfection experiments were typically performed on cells seeded the day before at a cell concentration of 60,000 cells / mL (100 μL / well). In the current example, transfection experiments using EGFP pDNA were performed in HeLa cells at two-fold and four-fold concentration (120,000 and 240,000 cells / mL, respectively). Figure 4 The above mentioned amphiphiles were shown to express equally well at all cell concentrations tested. However, for this experiment, as cell concentration increased, more volume of complex amphiphile / pDNA was required (50, 100 and 200 μL complex was used for 60000, 120000 and 240000 cells / mL respectively).

[0684] Example 7: Transfection experiment in chicken embryonic fibroblasts

[0685] The amphiphile (7.3(Leu-His)M) obtained by combining the peptide 7.3(Leu-His) with myristenaldehyde was used to deliver EGFP pDNA in primary chicken embryonic fibroblasts (CEFs, obtained from 9- to 10-day-old chicken embryos), which are non-immortal cells that are difficult to transfect. The transfection efficiency of the amphiphile 7.3(Leu-His)M was compared with that of Comparison between 2000 (LF) and trans-IT-LT1 transfection reagent (Mirus). Figure 5 The results show that the transfection efficiency of the amphipathic 7.3(Leu-His)M is better than that of the two controls (LF and Mirus), wherein the amphipathic of the present invention is It is twice as good as 2000 (LF) and up to 5 times better than the trans-IT-LT1 transfection reagent (Mirus).

[0686] Example 8: Cell viability of amphiphile 7.3(Leu-His)M

[0687] To determine the IC of the amphiphile containing the 7.3(Leu-His) peptide and myristenaldehyde (7.3(Leu-His)M) in six cell lines 50 , and MTT analysis was performed. Fig.18 As shown in 50 The IC values ​​of all cell lines except 50 Between 13 and 24 μM.

[0688] Example 9: Short Peptides

[0689] Several structural modifications were made on peptide 7.3 (Leu-His). EGFP pDNA delivery using amphiphiles containing these peptides and myristene aldehyde was tested in HeLa cells. The modifications consisted of modifications of approximately amino acids, replacement of 1 to 3 K* residues with O* residues and addition of 1 or 2 R residues on the N-terminus. In SEQ ID NO:53 and SEQ ID NO:55, the final residue (H or L) was eliminated in each case. All peptides had the same number of reactive basic amino acids (K* or O*) modified with hydrazide. Some structures can be found in Table 32 below. Synthetic short peptides with L-amino acids are as follows:

[0690] 7.3 (Leu-His) <![CDATA[Ac-RK*HRK*K*H-NH2]]> SEQ ID NO:1 V1-7.3 (Leu-His) <![CDATA[Ac-RHK*K*K*HR-NH2]]> SEQ ID NO:2 V2-7.3 (Leu-His) <![CDATA[Ac-RK*HHK*K*R-NH2]]> SEQ ID NO:3 7.3(LH)(KO) <![CDATA[Ac-RO*HRO*O*H-NH2]]> SEQ ID NO:52 R+7.3(LH)–H <![CDATA[Ac-RRK*HRK*K*-NH2]]> SEQ ID NO:53 R+7.3(LH) <![CDATA[Ac-RRK*HRK*K*H-NH2]]> SEQ ID NO:54 R+7.3–L <![CDATA[Ac-RRK*LRK*K*-NH2]]> SEQ ID NO:55 R+7.3 <![CDATA[Ac-RRK*LRK*K*L-NH2]]> SEQ ID NO:56 RR+7.3 <![CDATA[Ac-RRRK*LRK*K*L-NH2]]> SEQ ID NO:57 V3-7.3(LH) <![CDATA[Ac-RO*HRK*K*H-NH2]]> SEQ ID NO:58 V4-7.3(LH) <![CDATA[Ac-RK*HRK*O*H-NH2]]> SEQ ID NO:59

[0691] Table 32. Peptide sequence modifications derived from 7.3 (Leu-His). (K* = hydrazide-modified lysine, see general synthesis scheme; O* = hydrazide-modified ornithine).

[0692]

[0693] As compared to the amphiphile 7.3(Leu-His)M, the amphiphile comprising peptide V1-7.3(Leu-His) and myristenaldehyde generally showed the same transfection efficiency, with the exception of the A549 cell line, where the efficiency was approximately half (see Figure 6 ). The amphiphile comprising the peptide V2-7.3(Leu-His) and myristenaldehyde showed approximately 50% of the transfection efficiency of the amphiphile V1-7.3(Leu-His)M or 7.3(Leu-His)M, with the exception of the A549 cell line, where V2-7.3(Leu-His)M showed enhanced efficiency, matching the transfection efficiency of V1-7.3(Leu-His)M. In all of these cases, myristenaldehyde was used as the hydrophobic tail, as described above.

[0694] Example 10: In vivo transfection protocol

[0695] In vivo bioluminescence imaging (BLI) enables the localization and quantification of mRNA expression following delivery in living animals.

[0696] Pre-diluted preparations

[0697] The inventors used BLI to evaluate the mRNA delivery efficiency of amphiphiles by IM injection of amphiphile-complexed FLuc mRNA in anesthetized mice. Amphiphile stock solutions were prepared in DMSO as described above and diluted in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts). A solution of mRNA / amphiphile complex was freshly prepared before in vivo experiments. The amphiphile solution in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts) was mixed with an mRNA solution in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts) (1: 1 volume ratio, final amount of mRNA / mouse = 5 μg / mouse). The mixture was shaken at room temperature for 30 minutes before injection. For each mouse, 5 μg of mRNA was mixed with the best candidate 7.3 (Leu-His) obtained from in vitro experiments and myristenaldehyde (7.3 (Leu-His) M) ( Figure 7 ) or with palmitoleic acid (7.3(Leu-His)PA)( Figure 8 ) complex, administered by im injection in the right abdomen in 50 μL of a suitable buffer (such as PBS or phosphate buffered saline enriched with inorganic salts). As a control, 5 μg of naked mRNA was injected in three mice. Luciferase expression was evaluated over 48 hours, starting 1 hour after administration of the mRNA complex. High levels of luciferase activity were observed at the injection site for both amphipathies. This expression was at 7.3 (Leu-His) M ( Figure 7) peaked at 7 h using all concentrations tested, whereas 7.3(Leu-His)PA showed a fluctuation in the amphiphile concentration for optimal expression over time, with the 2.5 μM formulation being more effective at shorter times after injection and the 10 μM formulation being more effective at longer observation times ( Figure 8 ). In contrast, im injection of naked mRNA resulted in only low levels of luciferase expression as measured by photon flux in all mice. Experiments were performed at least in triplicate (3 mice / condition).

[0698] After obtaining the conditions that gave the highest expression, a second round of im delivery of FLuc mRNA was performed to further optimize the formulation of the complex. Under completely similar experimental conditions, the optimal observed concentration of the amphiphile 7.3(Leu-His)M was fixed (2.5 μM), and complexes with increasing amounts of FLuc mRNA (1.25, 3, or 5 μg / mouse) were prepared and administered im as described above ( Fig. 9 ). This experiment revealed that the highest bioluminescence, and therefore the highest level of Fluc expression, was achieved with the complex formed by 2.5 μM of the amphiphile and 5 μg / mouse of FLuc mRNA.

[0699] In addition, these optimized conditions were further screened for use with other routes of administration, such as intradermal (id) and subcutaneous (sc) ( Fig.14 , 5 μg FLuc mRNA was used in both cases) or intravenously (iv) ( Fig.10 ) for FLuc mRNA delivery. For id and sc injections, previously optimized conditions were less effective than im delivery ( Fig.14 ).

[0700] In case of iv administration (tail vein), luciferase expression was evaluated over 24 hours, starting 1 hour after administration of the mRNA complexes. After this time, the specimens were sacrificed and each organ was analyzed individually for quantitative expression using BLI. In this case, the preferred conditions involved the injection of 50 μL of a complex solution containing 2.5 μM 7.3(Leu-His)M and 1.3 μg / mouse FLuc mRNA in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts). Under all conditions tested, bioluminescence was observed to preferentially biodistribute to the spleen, followed by liver expression and, to a lesser extent, distribution in the lungs ( Fig.10 ).

[0701] Concentrated preparations

[0702] The amphiphile stock solution was prepared in DMSO as described above, but in this case the amphiphile was directly contacted with a solution of the nucleic acid cargo in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts) without any pre-dilution step of the DMSO solution of the amphiphile in a suitable aqueous buffer. The delivery efficiency of mRNA via the iv administration route was determined by bioluminescence imaging (BLI). Fluc mRNA (5 μg / mouse) was incubated with concentrated 7.3 (LH) M amphiphile-DMSO solutions at various aqueous-organic volume ratios ( Fig.16 , 125 μM amphiphile concentration) for 30 minutes, administered in the tail vein at 200 μL (5 μg mRNA / mouse). Luciferase expression was evaluated over 24 hours, starting 1 hour after administration of the mRNA complexes. After this time, the mice were sacrificed and each organ was analyzed individually for quantitative expression using bioluminescence imaging (BLI). Under all conditions tested, a bioluminescence-preferred spleen biodistribution was observed. From all volume ratios tested, the complex prepared using a 1:100 (DMSO:aqueous solution) ratio showed the highest bioluminescence values, with up to an order of magnitude of luminescence enhancement compared to a 1:200 ratio. Transfection results and expression quantification in organs using the optimal volume ratios (125 or 250 μM final amphiphile concentration) for candidates 7.2DO, 7.2M, 9.2DO and 9.2M are each presented in Fig.12 , Fig.11 , Fig.13 and Fig. 20 middle.

[0703] Fig.19 In vivo transfection experiments using an amphiphile (13.2O) comprising peptide 13.2 and oleyl aldehyde in mice are shown. The figure shows representative bioluminescent images of mice and extracted organs at different times (1 hour, 4 hours, 7 hours and 24 hours) after iv (intravenous) injection of FLuc mRNA / amphiphile 13.2O complexes (125 and 250 μM 13.2O were used as indicated). Quantification of bioluminescence of the organs is shown in Fig.19 In B, 5 μg of FLuc mRNA was used to form complexes as described above. Fig.19 As can be seen from the results, compared with the amphiphile 7.3(Leu-His)M( Fig.16 ) delivered the same amount of mRNA, the amphiphile comprising peptide 13.2 (ie, having two hydrophobic tails) showed extremely limited in vivo delivery.

[0704] Fig.30The effect of using amphiphile stock solutions prepared using different ratios of peptide to hydrophobic tail aldehyde is shown. Specifically, a DMSO solution of peptide 7.3 (LH) was reacted independently with solutions containing 0, 1, 2, 3, 4, or 5 equivalents of myristenaldehyde in 15% AcOH / DMSO at 60°C for 2 hours, followed by a concentrated formulation protocol of FLuc mRNA / amphiphile prior to in vivo administration. Fig.30 Similar amphiphile in vivo delivery efficiencies were shown across the range of 1 to 5 equivalents of hydrophobic tail in the amphiphile formation step.

[0705] Example 11: DLS measurement of complexes containing 7.3M or 7.3(LH)M and pDNA (100 ng, in vitro conditions) or mRNA (50 ng, in vitro conditions)

[0706] The complexes formed after mixing EGFP pDNA (100 ng) or mRNA (50 ng) with 7.3 M or 7.3 (LH) M amphiphile at a range of concentrations (2.5 to 10 μM) and pH values ​​(4 to 10) were characterized by DLS to calculate their size (average diameter) and surface charge (zeta potential), as shown in Fig.15 Specifically, Fig.15 Displays the following:

[0707] A) Top: 7.3M + pDNA complexes show average diameters ranging from 70 to 200 nm, with results for 2.5 and 10 μM amphiphile concentrations being very similar (70 to 100 nm) and constant across the pH range. Results for 5 μM show larger particles, with diameters peaking at neutral pH (200 nm). These results confirm the optimal size for cellular delivery.

[0708] Lower panel: For 2.5 and 5 μM, increasing pH leads to a decrease in the surface charge of the particles (-5 to -40 mV and +35 to -30 mV, respectively), whereas the zeta potential results for 10 μM remain positive independent of pH; +20 to +30). Thus, the concentration of cationic amphiphile present in the formulation is a key factor in the proper surface charge balance of the formulated pDNA / amphiphile complexes.

[0709] B) Upper panel: 7.3(LH)M+pDNA complexes increase their average diameter as pH increases at all concentrations tested, nearly doubling in size from pH 4 to pH 10 values.

[0710] Bottom: The surface potential of the complex preparations was found to decrease when increasing pH at all concentrations tested. The higher the amphiphile concentration, the greater the drop in zeta potential observed, ranging from +60 to -45 mV at 10 μM and pH 4 and 10, respectively.

[0711] C) Upper panel: 7.3M+mRNA complexes present very low variations in their mean diameter over the entire range of concentrations and pH values ​​tested. All recorded values ​​between 50 and 100 nm make it an optimal candidate for intracellular delivery.

[0712] Bottom: Surface potential results are positive in all cases (+5 to +30 mV), promoting interaction with the negatively charged cell membrane environment. There is a trend of increasing zeta potential with amphiphile concentration and pH.

[0713] D) Upper panel: 7.3(LH)M+mRNA complexes exhibit very low variation in their mean diameter (100 to 150 nm) over the entire range of concentrations and pH values ​​tested, with the only exception being particles formulated at pH 7 and lower amphiphile concentrations, which grew considerably in mean diameter, up to (i.e.) 500 nm.

[0714] Bottom panel: As expected, increasing the amphiphile concentration leads to an increase in the cationic character of the particle's surface potential, a trend also observed when increasing the pH of the medium.

[0715] Example 12: SARS-CoV-2 vaccination

[0716] Encodes the coronavirus SARS-CoV-2 spike protein (protein S, of which residues 986 KV 987 through 986 PP 987 Substitution, furin cleavage site 682 RRAR 685 pass 682 GSAS 685A codon-optimized (based on the previously described sequence) mRNA (custom RNA synthesized by TriLink, capped, polyadenylated, and fully substituted with N1-methyl pseudouridine) pre-fusion stabilized form of amphiphile 7.3 (LH) M and formulated with or without the well-known adjuvant TLR9 agonist CpG (Invivogen ODN2395, 5'TCGTCGTTTTCGGCGCGCGCCG3' (SEQ ID NO: 60), bases are phosphorothioate) (concentrated formulations, Example 10). For concentrated formulations, amphiphile stock solutions were prepared in DMSO as described above. Mice were injected with 5 μg of mRNA formulated with 2 μL of amphiphile (50 mM) or 5 μg of mRNA formulated with 2.8 μL of amphiphile (50 mM) plus 2 μg of CpG. Mice were vaccinated by iv injection and boosted 21 days after the first injection (using the same formulation). For iv administration, 200 μL of formulated mRNA / amphiphile was administered by tail vein injection. Blood was collected in Eppendorf tubes 14 and 35 days after injection and allowed to stand at room temperature for 3 to 4 hours. After centrifugation at 10000 g for 10 minutes, supernatants were collected and frozen at -80 ° C until IgG quantification by ELISA.

[0717] ELISA: Nunc-Immuno microplate 96-well ELISA plates were coated overnight with 100 μL / well of 1 μg / mL SARS-CoV-2 spike S1-His recombinant protein (from Sinobiological) in PBS buffer pH 7.2. After 3 washes in ELISA wash buffer (PBS with 0.05% Tween-20, PBS-T), the wells were blocked with 200 μL of 3% skim milk diluted in PBS-T for 1 hour at room temperature. Serum dilutions (1:50 and 1:250) were prepared in PBS-T containing 1% skim milk. The blocking solution was removed and the wells were washed twice with 200 μL PBS-T. Then, 100 μL of each serum dilution was added to the plate under shaking (70 rpm) and at room temperature for 2 hours. The wells were washed three times with 200 μL PBS-T and incubated with goat anti-mouse IgG Fc, human / cow / horse SP ads-HRP (Southern Biotech) (1:2000) in 1% skim dry milk at room temperature and shaking (70 rpm) for 1 hour. The wells were washed three times with PBS-T and 100 μL SureBlue TMB microwell peroxidase substrate was added to each well. The color was developed for 30 minutes and then the reaction was stopped with 100 μL HCl 1M. The optical density (OD450) at 450 nm was measured using a Tecan Infinite F200Pro microplate reader ( Fig.17 ). The OD450 of the serum sample collected on day 14 after injection showed a value above the background (three times the blank) value at the lowest serum dilution factor for the formulation containing CpG adjuvant only. The sample from day 35 after injection revealed positive results for the formulation with and without CpG adjuvant at two serum dilution factors.

[0718] Example 13: OVA immunization

[0719] The mRNA encoding ovalbumin (OVA; from TriLink, capped, polyadenylated, and completely substituted with 5-methoxyuridine, OVA mRNA (5moU)-(L-7210)) was administered iv, the mRNA was formulated with amphiphile 7.3(LH)M with or without the well-known adjuvant TLR9 agonist CpG (Invivogen ODN2395, 5'TCGTCGTTTTCGGCGCGCGCCG3' (SEQ ID NO:60), bases are phosphorothioate) (concentrated formulations, Example 10). For concentrated formulations, amphiphile stock solutions were prepared in DMSO as described above. Mice were injected with 5μg of mRNA formulated with amphiphile (125μM) or 5μg of mRNA formulated with amphiphile (175μM) plus 2μg of CpG. Mice were vaccinated by iv injection and boosted 21 days after the first injection (using the same formulation). For iv administration, 200μL of formulated mRNA / amphiphile was administered by tail vein injection. At 14 and 35 days after injection, blood was collected in Eppendorf tubes and allowed to stand at room temperature for 3 to 4 hours. After centrifugation at 10000 g for 10 minutes, the supernatant was collected and frozen at -80 °C until IgG quantification by ELISA.

[0720] ELISA: Nunc-Immuno microplate 96-well ELISA plate was coated with 100 μL / well of 1 μg / mL OVA (Sigma-Aldrich, CAS: 9006-59-1) in PBS buffer pH 7.2 overnight. After 3 washes in ELISA wash buffer (PBS with 0.05% Tween-20, PBS-T), the wells were blocked with 200 μL of 3% skim milk diluted in PBS-T for 1 hour at room temperature. Serum dilutions (1:50 and 1:250) were prepared in PBS-T containing 1% skim milk. The blocking solution was removed and the wells were washed twice with 200 μL PBS-T. Then, 100 μL of each serum dilution was added to the plate at room temperature for 2 hours under shaking (70 rpm). The wells were washed three times with 200 μL PBS-T and incubated with goat anti-mouse IgG Fc, human / cow / horse SPads-HRP (Southern Biotech) (1:2000) in 1% skim milk at room temperature and shaking (70 rpm) for 1 hour. The wells were washed three times with PBS-T and 100 μL SureBlue TMB microwell peroxidase substrate was added to each well. The color was developed for 10 minutes and then the reaction was stopped with 100 μL HCl 1M. The optical density (OD450) at 450 nm was measured using a Tecan Infinite F200Pro microplate reader ( Fig.21 A).

[0721] In addition, serial dilutions of serum obtained on day 35 (102 Up to 10 9 ) were analyzed by ELISA using goat anti-mouse IgG1 or IgG2c human / bovine / horse SP ads-HRP secondary antibodies (1:2000, Southern Biotech) to determine the titers of different isotypes and the types of immune responses ( Fig.21 B).

[0722] 5 μg of mRNA encoding ovalbumin (OVA; from TriLink, blocked, polyadenylated, unmodified, Trilink, OVAmRNA-(L-7610)) which was boosted 21 days after the first injection (using the same formulation) and a long-term titer quantification experiment was performed ( Fig.31 ). Sera were extracted monthly (month 1 refers to 35 days after the first administration; 30 days were elapsed between serum collections). Both routes of administration resulted in similar IgG levels and in both cases, the maximum titers occurred in the 3 month readout.

[0723] The type of immune response induced after immunization can be classified as Th1, Th2, or mixed, which differ in the CD4+ T-cell subsets involved, the cytokines secreted, and the class of antibodies induced. Th1 responses are generally associated with delayed-type allergic reactions and cell-mediated immunity, while Th2 is associated with the induction of hormonal responses and the production of antibodies.

[0724] High titers of IgG2c relative to IgG1 indicate a Th1 -biased immune response, which is generally preferred for cancer therapy and most viral infections.

[0725] Example 14: In vivo gene editing (Cre mRNA) in Ai14 mice (Cre reporter gene model)

[0726] In vivo gene editing enabled localization and quantification of Cre recombinase expression following mRNA delivery in Ai14 mice, a reporter line that expresses tdTomato fluorescence following Cre-mediated recombination.

[0727] The present inventors evaluated the amphipathic effect of Cre recombinase mRNA ( Cre mRNA (5moU), TriLink, L-7211) mRNA delivery efficiency. Amphiphilic molecule stock solution was prepared in DMSO as described above. A solution of mRNA / amphiphilic complex was freshly prepared before in vivo experiments. The amphiphilic solution in DMSO was mixed with an mRNA solution in a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts) (1: 1 and 5: 1 mass ratio, final amount of mRNA / mouse = 7 μg / mouse). The mixture was vibrated at room temperature for 30 minutes before injection. For each mouse, 7 μg mRNA was compounded with 7.3 (Leu-His) and myristene aldehyde (7.3 (Leu-His) M) and administered by iv injection in the tail vein in 100 μL of a suitable buffer (such as PBS or phosphate buffer enriched with inorganic salts). As a control, 7 μg naked mRNA was injected in three mice. After 2 days, the mice were killed and imaged to confirm tdTomato expression. In all conditions, expression of tdTomato protein was preferentially observed in spleen and lung, and more strongly when a 5:1 mass ratio of amphipathic:mRNA was used ( Fig.32 , light grey bars).

[0728] The present invention provides the following provisions.

[0729] 1. A peptide or a salt thereof, preferably a cationic peptide

[0730] ● wherein the peptide or its salt has a length of 7 to 21 amino acids,

[0731] wherein the peptide or a salt thereof comprises a basic amino acid residue selected from the group consisting of arginine (R), histidine (H) and a reactive basic amino acid residue having a reactive group on its side chain,

[0732] wherein the peptide or its salt optionally comprises one or more hydrophobic amino acids selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), wherein, if present, the hydrophobic amino acids account for less than 50% of the total number of amino acids in the peptide,

[0733] ● wherein the number of arginine in the peptide or its salt is from 2 to 10,

[0734] ● wherein the number of histidine in the peptide or its salt is 0 to 3,

[0735] ● wherein the number of reactive basic amino acid residues having a reactive group in their side chains in the peptide or a salt thereof is 3,

[0736] ● wherein the number of hydrophobic amino acids in the peptide or its salt is from 0 to 8; and

[0737] wherein in the peptide amino acid sequence, there are no more than two consecutive amino acids of the same residue, with the exception of reactive basic amino acid residues containing a reactive group in their side chains and the amino acid arginine, in which case there may be up to three consecutive arginine residues and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains; and

[0738] ●The amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all the amino acids contained in the peptide or its salt are L-amino acids or all the amino acids contained in the peptide or its salt are D-amino acids.

[0739] 2. A peptide or a salt thereof according to claim 1, wherein the three reactive basic amino acid residues containing reactive groups in their side chains are reactive lysine (K*), reactive ornithine (O*), reactive 2,4-diaminobutyric acid (Dab*) or a mixture thereof, and / or wherein the amino acid at the N-terminus of the peptide is R.

[0740] 3. A peptide or a salt thereof according to claim 2, wherein the reactive lysine (K*) is native lysine or modified lysine, wherein the modified lysine is characterized in that the reactive group is linked to the ε-amino group of the reactive lysine via an amide bond, and the reactive group and the amide bond are linked via a spacer group, preferably wherein the spacer group has 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, preferably 2 to 6 carbon atoms, more preferably 4 carbon atoms.

[0741] 4. A peptide or a salt thereof according to claim 2, wherein the reactive ornithine (O*) is native ornithine or modified ornithine, wherein the modified ornithine is characterized in that the reactive group is linked to the δ-amino group of ornithine via an amide bond, and the reactive group and the amide bond are linked via a spacer group, preferably wherein the spacer group has 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, preferably 2 to 6 carbon atoms, more preferably 4 carbon atoms.

[0742] 5. The peptide or salt thereof according to any one of clauses 3 or 4, wherein the reactive group is selected from the group consisting of hydrazide, amino, carboxylic acid and aminooxy-carboxylic acid groups, preferably wherein the reactive group is a hydrazide.

[0743] 6. A peptide or a salt thereof according to any one of clauses 3 to 5, wherein the modified lysine or the modified ornithine or the modified Dab is obtained by reacting the peptide with a hydrazide carboxylic acid or with an aminooxy-carboxylic acid, preferably glutaric acid monohydrazide or succinic acid monohydrazide or aminooxy-acetic acid, thereby obtaining the modified lysine or the modified ornithine or the modified Dab, wherein the reactive group is a hydrazide group or an aminooxy group, preferably a hydrazide group.

[0744] 7. A peptide or a salt thereof as described in any one of clauses 1 to 6, wherein the peptide has a length of 7 amino acids, wherein the peptide consists of basic amino acids selected from arginine, histidine and reactive basic amino acid residues containing reactive groups, wherein the number of arginine in the peptide is at least 2, wherein the number of histidine in the peptide is 2 or less, and wherein the number of reactive basic amino acid residues containing reactive groups in their side chains in the peptide is 3.

[0745] 8. A peptide or a salt thereof according to clause 7, wherein the peptide sequence is selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59).

[0746] 9. A peptide or a salt thereof as described in any one of clauses 1 to 6, wherein the peptide has a length of at least 9 amino acids, wherein the peptide comprises the core sequence RX1X2R (SEQ ID NO: 9) or RX1X2RRX3X4 (SEQ ID NO: 4), and wherein any one of X1 to X4 is an amino acid selected from the group consisting of H, K*, O* and a hydrophobic amino acid, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I.

[0747] 10. The peptide or salt thereof of clause 9, wherein the peptide is a peptide of sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7), RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8) or RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, K*, O* and hydrophobic amino acids, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I.

[0748] 11. A peptide or a salt thereof according to clause 10, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21), Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 22). NO:23).

[0749] 12. A peptide or salt thereof according to any one of clauses 1 to 6, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*HK*HK*R-NH2 (SEQ ID NO: 49), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K* (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66). NO:66), Ac-RK*HRK*K*H-OH (SEQ ID NO:68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO:69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO:70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2, (SEQ ID NO:72).

[0750] 13. The peptide or salt thereof according to any one of clauses 1 to 12, wherein the peptide is N-acetylated and / or C-amidated.

[0751] 14. An amphiphilic molecule comprising or consisting of:

[0752] a) a peptide as defined in any one of clauses 1 to 13, or a salt thereof, and

[0753] b) three hydrophobic tails,

[0754] wherein each hydrophobic tail is linked to the peptide by a bond, the bond being formed by reaction between (i) a reactive group in the side chain of a reactive basic amino acid residue and (ii) a precursor of the hydrophobic tail, wherein the precursor of the hydrophobic tail comprises the hydrophobic tail and a second reactive group that can react with the reactive group in the side chain of the reactive basic amino acid residue of the peptide.

[0755] 15. The amphiphilic molecule according to clause 14, wherein the amphiphilic molecule is obtained by reacting the peptide or a salt thereof with a precursor of the hydrophobic tail, the precursor comprising a second reactive group that reacts with the reactive group in the reactive basic amino acid residue to form a covalent bond.

[0756] 16. The amphiphilic molecule of clause 14 or 15, wherein the bond formed by the reaction between the reactive group in the side chain of the reactive basic amino acid residue and the second reactive group in the precursor of the hydrophobic tail is an amide bond, an ester bond, a hydrazone bond or an oxime bond, preferably a hydrazone bond.

[0757] 17. An amphiphilic molecule according to clause 16, wherein the second reactive group in the precursor of the hydrophobic tail is an aldehyde, a carboxylic acid or an alcohol, preferably an aldehyde, and wherein the aldehyde is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristenal, palmitenal, phellandrenal, oleenal, linoleenal, eicosenal and tetracosenal, preferably selected from myristenal, palmitenal and phellandrenal.

[0758] 18. An amphiphilic molecule according to clauses 14 to 17, wherein the reactive basic amino acid residue containing a primary amine in its side chain is a reactive lysine (K*) or a reactive ornithine (O*) or a reactive 2,4-diaminobutyric acid (Dab*) and wherein the covalent bond is formed between the second reactive group in the precursor of the hydrophobic tail and the native lysine or the native ornithine or the native Dab (i.e., the primary amine in the side chain of the native lysine or the native ornithine or the native Dab), or between the second reactive group in the precursor of the hydrophobic tail and the (first) reactive group in the modified lysine or the modified ornithine or the modified Dab.

[0759] 19. The amphiphilic molecule of clause 17 or 18, wherein the second reactive group in the precursor of the hydrophobic tail is an aldehyde, and wherein the aldehyde is selected from the group consisting of myristenal, palmitenal and phellandrenal.

[0760] 20. The amphiphilic molecule of clause 19, wherein:

[0761] - the peptide is Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, and the spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residues is formed by reacting the peptide with at least three glutaric acid monohydrazide molecules per peptide molecule, thereby obtaining a (poly)hydrazide activated peptide, and then contacting the (poly)hydrazide activated peptide with palmitoleic aldehyde or myristoleic aldehyde as a precursor of the hydrophobic tail; or

[0762] - the peptide is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof, and the spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue is formed by reacting the peptide with at least three glutaric acid monohydrazide molecules per peptide molecule, thereby obtaining a (poly)hydrazide activated peptide, and then contacting the (poly)hydrazide activated peptide with myristenol, palmitenol or phloroglucinol as a precursor of the hydrophobic tail; or

[0763] - The peptide is selected from the group consisting of Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59). NO:59) or a salt thereof, a spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino group in the lysine residue or the δ-amino group in the ornithine residue is formed by reacting the peptide with at least three glutaric acid monohydrazide molecules per peptide molecule to obtain a (poly)hydrazide activated peptide, and then contacting the (poly)hydrazide activated peptide with myristenaldehyde as a precursor of the hydrophobic tail; or

[0764] - the peptide is selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO:65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO:66), Ac-RK*HRK*K*H-OH (SEQ ID NO:68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO:69) and Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO:70) or a salt thereof, and the spacer group linking each of the reactive groups in the side chain of the peptide and each of the ε-amino group in the lysine residue, the δ-amino group in the ornithine residue or the γ-amino group in the Dab residue is formed by reacting the peptide with at least three molecules of glutaric acid monohydrazide per molecule of peptide to obtain a (poly)hydrazide activated peptide, and then contacting the (poly)hydrazide activated peptide with myristenaldehyde as a precursor of the hydrophobic tail; or

[0765] -The peptide is selected from the group consisting of Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO:72) or their salts, and the spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residue is formed by reacting the peptide with at least three aminooxy-acetic acid molecules or three succinic acid monohydrazide molecules per peptide molecule to obtain a (poly)aminooxy-activated peptide or a (poly)hydrazide-activated peptide, and then contacting the (poly)aminooxy-activated peptide or the (poly)hydrazide-activated peptide with myristenaldehyde as a precursor of the hydrophobic tail.

[0766] 21. A composite comprising:

[0767] a) at least one amphiphilic molecule as defined in any one of clauses 14 to 20, and

[0768] b) at least one biomolecule of interest.

[0769] 22. The complex of clause 21, wherein the biomolecule of interest is selected from the group consisting of proteins, nucleic acids, nucleoproteins, small molecules and immunogens.

[0770] 23. The complex of clause 21 or 22, wherein the biomolecule of interest has a negative net charge.

[0771] 24. The complex of clause 22, wherein the nucleic acid is pDNA, siRNA or mRNA, and wherein the nucleoprotein is a ribonucleoprotein.

[0772] 25. Use of a peptide as defined in any one of clauses 1 to 13 or a salt thereof, an amphiphilic molecule as defined in any one of clauses 14 to 20 or a complex as defined in any one of clauses 21 to 24 for delivering a biomolecule of interest to a cell in vitro.

[0773] 26. The use according to clause 25, wherein the biomolecule of interest is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules.

[0774] 27. The use according to clause 25 or 26, wherein the nucleic acid is pDNA, siRNA or mRNA, and wherein the nucleoprotein is a ribonucleoprotein.

[0775] 28. A peptide as defined in any one of clauses 1 to 13 or a salt thereof, an amphiphilic molecule as defined in any one of clauses 14 to 20 and / or a complex as defined in any one of clauses 21 to 24 for use as a medicament.

[0776] 29. A vaccine comprising a peptide as defined in any one of clauses 1 to 13 or a salt thereof, an amphiphilic molecule as defined in any one of clauses 14 to 20 and / or a complex as defined in any one of clauses 21 to 24.

[0777] 30. A method for preparing an amphiphilic molecule as defined in any one of clauses 14 to 20, wherein the method comprises contacting a solution of a peptide as defined in any one of clauses 1 to 13 or a salt thereof in an organic solvent with a solution of a precursor of the hydrophobic tail comprising a second reactive group which reacts with a reactive group in a side chain of the peptide under conditions suitable for forming a covalent bond between the second reactive group of the precursor of the hydrophobic tail and the reactive group in the peptide, wherein the conditions are the following:

[0778] (i) when the reactive group in the precursor of the hydrophobic tail is an aldehyde, an acidic medium, or

[0779] (ii) When the reactive group in the precursor of the hydrophobic tail is an alcohol or a carboxylic acid, a basic medium and in the presence of a carboxylic acid activating reagent.

[0780] 31. A method for preparing a complex as defined in any one of clauses 21 to 24, wherein the method comprises contacting a solution of at least one amphiphilic molecule as defined in any one of clauses 14 to 20 with a solution of at least one biomolecule of interest in a suitable medium under conditions suitable for formation of a complex between the at least one amphiphilic molecule and the at least one biomolecule of interest.

[0781] 32. A method for delivering a biomolecule of interest to a cell population in vitro, comprising

[0782] (i) contacting a first solution of at least one amphiphilic molecule as defined in any one of clauses 14 to 20 in a suitable solvent with a second solution containing the biomolecule of interest in a suitable solvent under conditions suitable for formation of a complex between the at least one amphiphilic molecule and the at least one biomolecule of interest, and

[0783] (ii) adding the complex obtained in step (i) to the cell population under conditions suitable for delivering the biomolecule of interest to the cell population.

[0784] 33. The method of clause 32, wherein the contacting step (i) is performed in the same medium in which the cells are cultured, and wherein the amphiphilic molecule is provided from a stock solution in an organic solvent.

[0785] 34. The method of any one of clauses 31 to 33, wherein the biomolecule of interest has a negative net charge at the pH at which the contacting step (i) is performed.

[0786] 35. A method for obtaining a library of amphiphilic molecules as defined in any one of clauses 14 to 20, the method comprising contacting "n" peptides or their salts as defined in clauses 1 to 13 in an organic solvent with at least "3n" precursors of a hydrophobic tail, the precursor comprising a hydrophobic tail and a second reactive group reactive with a reactive group in a side chain of a reactive basic amino acid in the peptide or its salt, wherein the contacting is carried out under conditions suitable for forming a covalent bond between the precursor of the hydrophobic tail and the reactive group in the peptide or its salt.

[0787] 36. The method of clause 35, wherein the at least two peptides or salts thereof are independently selected from any one of SEQ ID NOs 1-19, 21, 23, 49, 52-59, 65-66, 68-72.

[0788] 37. A method as described in clause 35 or 36, wherein the hydrophobic tail contained in the precursor of at least "3n" hydrophobic tails is selected from aldehydes, carboxylic acids or alcohols or mixtures thereof, preferably aldehydes, wherein the aldehydes are selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristenal, palmitoleic acid, phellandrenal, oleal, linoleal, eicosene aldehyde, tetracosene aldehyde or mixtures thereof; wherein the carboxylic acids are selected from the group consisting of hexanoic acid, octanoic acid, decanoic acid, dodecanoic acid, myristoleic acid, palmitoleic acid, phellandrenic acid, The alcohol is selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristenol, palmitenol, phellandrene alcohol, oleyl alcohol, linoleyl alcohol, eicosenol, tetracosenol or a mixture thereof, preferably the hydrophobic tail contained in the precursor of at least "3n" hydrophobic tails is selected from dodecanal, myristenal, palmitenal, phellandrene alcohol, oleyl alcohol, eicosenol, tetracosenol or a mixture thereof.

[0789] 38. The method of any one of clauses 35 to 37, wherein the reactive group of the peptide as defined in clauses 1 to 13 is a hydrazide group or an aminooxy-carboxylic acid group, and wherein the reactive group in the precursor of the hydrophobic tail is an aldehyde group.

[0790] 39. A library comprising at least two different amphiphilic molecules, each amphiphilic molecule comprising:

[0791] (i) a peptide as defined in any one of clauses 1 to 13, or a salt thereof, and

[0792] (ii) three hydrophobic tails,

[0793] wherein the hydrophobic tail is linked to the peptide via a bond, the bond being formed by reaction between a reactive group in the side chain of a reactive basic amino acid residue of the peptide and a precursor of the hydrophobic tail, wherein each precursor of the hydrophobic tail contains the hydrophobic tail and a second reactive group that can react with the reactive group in the side chain of the reactive basic amino acid residue of the peptide, and wherein one amphiphilic molecule is different from at least another amphiphilic molecule in the peptide and / or the hydrophobic tail.

[0794] 40. The library of clause 39, wherein each amphiphilic molecule is obtained by reacting the peptide or a salt thereof with at least three precursors of the hydrophobic tail, the precursors comprising a second reactive group reactive with the reactive group in the reactive basic amino acid residue, thereby forming a covalent bond.

[0795] 41. A library as described in clause 39 or 40, wherein the bond formed by the reaction between the reactive group in the side chain of the reactive basic amino acid residue of the peptide or its salt and the precursor of the hydrophobic tail containing the hydrophobic tail and a second reactive group reactive with the reactive group in the side chain of the reactive basic amino acid residue of the peptide or its salt is an amide bond, an ester bond, a hydrazone bond or an oxime bond.

[0796] 42. A method for identifying an amphiphilic molecule suitable for delivering a biomolecule of interest into a cell, the method comprising:

[0797] (i) contacting the biomolecule of interest with a library as defined in any one of clauses 39 to 41 under conditions suitable for binding of the amphiphilic molecule to the biomolecule of interest;

[0798] (ii) optionally, selecting amphiphilic molecules that bind to the biomolecule of interest and excluding those amphiphilic molecules that do not bind to the biomolecule of interest, and / or

[0799] (iii) Screening for amphiphilic molecules suitable for delivering the biomolecule of interest into cells.

[0800] 43. The method of clause 42, wherein the biomolecule of interest is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules.

[0801] 44. An amino acid having formula (III) or formula (IV):

[0802]

[0803] in:

[0804] -X is an N-terminal protecting group,

[0805] -Y is a hydrazide (Formula III) or aminooxy (Formula IV) reactive group protecting group,

[0806] - n is the length of the side chain of the amino acid (n = 2 to 4; Dab, Orn and Lys), and

[0807] - m is the length of the linker containing the reactive group (m = 1 to 10, preferably 1 to 5, more preferably 1 to 3).

[0808] 45. The amino acid according to clause 44, wherein the amino acid is selected from lysine (Lys, K), ornithine (Orn, O) or 2,4-diaminobutyric acid (Dab).

[0809] 46. ​​The amino acid of any one of clauses 44 to 45, wherein m is a natural number selected from 1 to 10, preferably 1 to 5, even more preferably 1 to 3.

[0810] 47. The amino acid of any one of clauses 44 to 46, wherein the amino acid comprises glutaric acid monohydrazide, succinic acid monohydrazide or aminooxy-acetic acid attached to the amino acid side chain.

[0811] 48. The amino acid of any one of clauses 44 to 47, wherein X is selected from 9-fluorenylmethoxycarbonyl (Fmoc) and tert-butyloxycarbonyl (Boc), preferably Fmoc.

[0812] 49. The amino acid of any one of clauses 44 to 48, wherein Y is selected from 2-chlorobenzyloxycarbonyl (Cl-Z), tert-butyloxycarbonyl (Boc) and 4-methyltrityl (Mtt), preferably Boc.

[0813] 50. An amino acid according to any one of clauses 44 to 49, wherein the amino acid has the following formula (V):

[0814]

Claims

1. An amphiphilic molecule comprising: a) Peptide or its salt: in The peptide or its salt has a length of 7 to 21 amino acids, wherein the peptide or a salt thereof comprises a basic amino acid residue selected from the group consisting of arginine (R), histidine (H) and a reactive basic amino acid residue having a reactive group on its side chain, wherein the peptide or its salt optionally comprises one or more hydrophobic amino acid residues selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), wherein, if present, the hydrophobic amino acid residues account for less than 50% of the total number of amino acids in the peptide, wherein the number of arginine in the peptide or its salt is 2 to 10, wherein the number of histidine in the peptide or its salt is 0 to 3, wherein the number of reactive basic amino acid residues having reactive groups in their side chains in the peptide or its salt is 3, wherein the number of hydrophobic amino acids in the peptide or its salt is 0 to 8; wherein in the peptide amino acid sequence, there are no more than two consecutive identical residues of amino acids, with the exception of reactive basic amino acid residues containing a reactive group in their side chain and the amino acid arginine, in which case there may be up to three consecutive arginine residues and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chain; wherein the amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all the amino acids contained in the peptide are L-amino acids or all the amino acids contained in the peptide are D-amino acids; The reactive basic amino acid residue containing a reactive group on its side chain is defined as in formula (I): in: B may be present or absent; if B is absent, A is a reactive group, preferably a primary amine; if B is present, A is selected from an amide bond, a secondary amine or any other functional group, and B is a spacer group attached to the reactive group; n is 1, 2, 3, 4, 5, 6, 7, 8 or more, preferably 1, 2, 3 or 4; and b) three hydrophobic tails, wherein each hydrophobic tail is linked to the peptide or a salt thereof by a bond, wherein the bond is formed by reaction between (i) the reactive group in the side chain of the reactive basic amino acid residue of the peptide and (ii) a precursor of the hydrophobic tail, wherein the precursor of the hydrophobic tail comprises the hydrophobic tail and a second reactive group capable of reacting with the reactive group in the side chain of the reactive basic amino acid residue of the peptide.

2. The amphiphilic molecule according to claim 1, wherein the three reactive basic amino acid residues having reactive groups in their side chains contained in the peptide or its salt are reactive lysine (K*), reactive ornithine (O*), reactive 2,4-diaminobutyric acid (Dab*) or a mixture thereof.

3. The amphiphilic molecule according to claim 2, wherein: (i) the reactive lysine (K*) contained in the peptide or its salt is native lysine or modified lysine, wherein the modified lysine is characterized in that the reactive group is linked to the ε-amino group of the reactive lysine via an amide bond, and the reactive group and the amide bond are linked via a spacer group; (ii) the reactive ornithine (O*) contained in the peptide or its salt is native ornithine or modified ornithine, wherein the modified ornithine is characterized in that the reactive group is linked to the δ-amino group of ornithine via an amide bond, and the reactive group and the amide bond are linked via a spacer group; and (iii) the reactive 2,4-diaminobutyric acid (Dab*) contained in the peptide or its salt is native Dab or modified Dab, wherein the modified Dab is characterized in that the reactive group is linked to the γ-amino group of Dab via an amide bond, and the reactive group and the amide bond are linked via a spacer group. 4 . The amphiphilic molecule according to claim 1 , wherein the reactive group contained in the side chain of the reactive basic amino acid residue in the peptide or the salt thereof is a hydrazide or an aminooxy-carboxylic acid group.

5. The amphiphilic molecule according to any one of claims 1 to 4, wherein the peptide or its salt contained therein has a length of 7 amino acids, wherein the peptide or its salt consists of a basic amino acid selected from arginine, histidine and a reactive basic amino acid residue containing a reactive group, wherein the number of arginine in the peptide or its salt is at least 2 and wherein the number of histidine in the peptide or its salt is 2 or less.

6. The amphiphilic molecule according to claim 5, wherein the peptide sequence is selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58), Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59), Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69). NO:69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO:70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO:71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO:72) or their salts.

7. The amphiphilic molecule according to any one of claims 1 to 4, wherein the peptide or salt thereof contained therein has a length of at least 9 amino acids, wherein the peptide or salt thereof comprises a core sequence RX1X2R (SEQ ID NO: 9) or RX1X2RRX3X4 (SEQ ID NO: 4), and wherein any one of X1 to X4 is an amino acid selected from the group consisting of H, K*, O* and hydrophobic amino acids, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I.

8. The amphiphilic molecule according to claim 7, wherein the peptide or salt thereof contained therein is a peptide of sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7), RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8) or RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, K*, O* and hydrophobic amino acids, wherein the hydrophobic amino acid is selected from the group consisting of A, V, L and I.

9. The amphiphilic molecule of claim 8, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21), and Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 22). NO:23) or a salt thereof.

10. The amphiphilic molecule according to any one of claims 1 to 4, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*HK*HK*R-NH2 (SEQ ID NO: 49), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56) and Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57) or a salt thereof.

11. The amphiphilic molecule according to any one of claims 1 to 10, wherein the peptide contained therein is N-acylated and / or C-amidated.

12. The amphiphilic molecule according to any one of claims 1 to 11, wherein the bond formed by the reaction between the reactive group in the side chain of the reactive basic amino acid residue and the second reactive group in the precursor of the hydrophobic tail is a hydrazone bond.

13. The amphiphilic molecule according to any one of claims 1 to 12, wherein the second reactive group in the precursor of the hydrophobic tail is an aldehyde, and wherein the aldehyde is selected from hexaldehyde, octanal, decanal, dodecanal, myristenal, palmitenal, phellandrenal, oleenal, linoleenal, eicosenal and tetracosenal, preferably selected from myristenal, palmitenal and phellandrenal.

14. The amphiphilic molecule according to any one of claims 1 to 13, wherein - the peptide is selected from Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, and the spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residues is formed by reacting the peptide with glutaric acid monohydrazide to obtain a hydrazide-activated peptide, and then reacting with palmitoleic acid aldehyde or myristoleic acid aldehyde as a precursor of the hydrophobic tail; or - the peptide is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof, and the spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino groups in the lysine residues is formed by reacting the peptide with glutaric acid monohydrazide to obtain a hydrazide-activated peptide, and then reacting with palmitoleic acid aldehyde or phlorothalene aldehyde as a precursor of the hydrophobic tail; or - the peptide is selected from Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59). NO:59) or a salt thereof, wherein the spacer group connecting each of the reactive groups in the side chain of the peptide and each of the ε-amino group in the lysine residue or the δ-amino group in the ornithine residue is formed by reacting the peptide with glutaric acid monohydrazide to obtain a hydrazide-activated peptide, and then reacting with myristenaldehyde as a precursor of the hydrophobic tail.

15. A composite comprising: (i) at least one amphiphilic molecule as defined in any one of claims 1 to 14, and (ii) at least one biomolecule of interest, Preferably, the biomolecule of interest is selected from proteins, nucleic acids, nucleoproteins, immunogens and small molecules, preferably, the nucleic acid is pDNA, siRNA or mRNA, and the nucleoprotein is a ribonucleoprotein.

16. A peptide or a salt thereof suitable for forming an amphiphilic molecule as defined in any one of claims 1 to 14: wherein the peptide or its salt has a length of 7 to 21 amino acids, wherein the peptide or a salt thereof comprises a basic amino acid residue selected from the group consisting of arginine (R), histidine (H) and a reactive basic amino acid residue having a reactive group on its side chain, The peptide or its salt optionally comprises one or more hydrophobic amino acids selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), wherein, If present, the hydrophobic amino acids constitute less than 50% of the total number of amino acids in the peptide, wherein the number of arginine in the peptide or its salt is 2 to 10, wherein the number of histidine in the peptide or its salt is 0 to 3, wherein the number of reactive basic amino acid residues having reactive groups in their side chains in the peptide or its salt is 3, wherein the number of hydrophobic amino acids in the peptide or its salt is 0 to 8; wherein in the peptide amino acid sequence, there are no more than two consecutive identical residues of amino acids, with the exception of reactive basic amino acid residues containing a reactive group in their side chain and the amino acid arginine, in which case there may be up to three consecutive arginine residues and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chain; wherein the amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all the amino acids contained in the peptide are L-amino acids or all the amino acids contained in the peptide are D-amino acids; The reactive basic amino acid residue containing a reactive group on its side chain is defined as in formula (I): in: B may be present or absent; if B is absent, A is a reactive group, preferably a primary amine; if B is present, A is selected from an amide bond, a secondary amine or any other functional group, and B is a spacer group attached to the reactive group; n is 1, 2, 3, 4, 5, 6, 7 or 8, preferably 1, 2, 3 or 4.

17. An amphiphilic molecule as defined in any one of claims 1 to 14, a complex as defined in claim 15 and / or a peptide as defined in claim 16 for use as a medicament.

18. A vaccine comprising an amphiphilic molecule as defined in any one of claims 1 to 14, a complex as defined in claim 15 and / or a peptide as defined in claim 16.

19. An amino acid having formula (III): Formula (III), X-Aa(Hyd-Y)-OH in: -X is an N-terminal protecting group, -Y is a hydrazide reactive group protecting group, -n is the length of the side chain of the amino acid, wherein n is selected from 2 to 4, and -m is the length of the linker containing the reactive group, wherein m is selected from 1 to 10, preferably from 1 to 5, more preferably from 1 to 3.

Images