MATV51 recombinant adenovirus vector, application, preparation method and HPV16 / 18 / 52 therapeutic vaccine

Abstract

The invention relates to the technical field of HPV therapeutic vaccines, in particular to an MATV51 recombinant adenovirus vector, application, a preparation method and an HPV 16 / 18 / 52 therapeutic vaccine. The MATV51 recombinant adenovirus vector comprises nucleotide sequences used for coding E6 and E7 antigens of HPV16, HPV18 and HPV52, and further comprises a nucleotide sequence used for coding CD40L. A nucleotide sequence of the recombinant adenovirus vector is designed aiming at an HPV16 / 18 / 52E6-E7 protein antigen and contains a nucleotide sequence for coding CD40L, and the expressed fusion protein takes CD40L as an adjuvant; the HPV 16 / 18 / 52 therapeutic vaccine can cover genotypes of three HPV viruses at the same time, and has good immune effect and memory effect, so that the effect of the vaccine is effectively improved, and the application range is wide.

Description

Technical Field

[0001] The present invention relates to the technical field of HPV therapeutic vaccines, and in particular to a MATV51 recombinant adenovirus vector, application, preparation method and HPV16 / 18 / 52 therapeutic vaccine. Background Art

[0002] According to statistics from the World Health Organization (WHO), there will be approximately 150,000 new cases of cervical cancer and 56,000 deaths in my country in 2022. The main cause of cervical cancer is persistent infection with high-risk HPV, and 99.7% of cervical cancers are related to HPV. The development from precancerous lesions to cancer is a long process, usually taking 10-15 years. At present, the market for drugs that turn HPV positive to negative is basically blank. Patients with persistent HPV infection are prone to tension, anxiety, fear, inferiority and even self-blame. There is an urgent need to develop new drugs to treat cervical precancerous lesions (HSIL), block their progression to cervical cancer, and change the current treatment method of HSIL, which is mainly cervical conization.

[0003] As one of the new tumor immunotherapy methods, tumor therapeutic vaccines have attracted much attention because they can induce or enhance the body's specific active immune response to tumor antigens, causing systemic regression of tumors and prolonging the survival of patients. Tumor specific antigens (TSA) of cervical cancer, such as HPV E6, E7 and E2, are relatively clear, so tumor therapeutic vaccines are developed for use in cervical precancerous lesions and cervical cancer to achieve the therapeutic effect of clearing HPV and inhibiting canceration.

[0004] High-risk HPV16 and HPV18 are the two most carcinogenic genotypes that have been clearly studied. HPV16 / 18 / 58 / 52 are the four main subtypes of CIN and cervical cancer in my country. Among them, the infection rate of HPV52 in CIN1 and CIN II is as high as about 20%. And the integration rate of HPV52 in HPV-infected patients is 14.1%, which is second only to HPV16. Studies have shown that with the aggravation of cervical lesions, the mixed infection rate of high-risk HPV increases, and multiple mixed infections of HPV are associated with a poor prognosis of cervical cancer. This may be related to the fact that the treatment failure rate of cervical cancer patients with multiple mixed infections of HPV is higher than that of patients with a single infection.

[0005] The antigens of existing preclinical HPV therapeutic vaccines are basically all concentrated on a single HPV16 E6-E7 or HPV18 E6-E7 and two types of HPV16 and HPV18. There is no targeting of other genotypes besides HPV16 and HPV18, especially HPV52 / 58 / 33 / 31, etc.

[0006] However, if we simply add antigens of other genotypes, it will not only reduce the immune effect of the existing HPV therapeutic vaccine, but also reduce the memory protection effect of the vaccine, making the use of the vaccine limited and the effect poor.

[0007] Therefore, developing therapeutic HPV vaccines targeting multiple types is equally important to improve the cure rate of high-grade cervical intracervical neoplasia. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide MATV51 recombinant adenovirus vector, application, preparation method and HPV16 / 18 / 52 therapeutic vaccine to solve the problems of single genotype coverage, poor immune effect and memory effect of vaccines in the prior art.

[0009] The technical solution of the present invention to solve the above technical problems is as follows:

[0010] The present invention provides a MATV51 recombinant adenovirus vector, the MATV51 recombinant adenovirus vector comprising nucleotide sequences for encoding E6 and E7 antigens of HPV16, HPV18 and HPV52, and also comprising a nucleotide sequence for encoding CD40L. Based on the above technical solution, the present invention can also be improved as follows.

[0011] Furthermore, the nucleotide sequence of the coding region of the MATV51 recombinant adenovirus vector is shown in SEQ ID No.1.

[0012] Furthermore, the adenovirus is a replication-deficient human adenovirus type 5 with a combined deletion of the E1 region and the E3 region, and the nucleotide sequence shown in SEQ ID No. 1 is located in the E1 region.

[0013] The present invention also provides a method for preparing the MATV51 recombinant adenovirus vector as described above, which comprises constructing a recombinant plasmid containing the nucleotide sequence as described above, and then cloning, screening, identifying and transfecting to obtain the recombinant adenovirus vector.

[0014] Furthermore, the construction includes the step of amplifying the nucleotide sequence as shown in SEQ ID No.1 using a primer pair, wherein the forward primer is shown in SEQ ID No.3 and the reverse primer is shown in SEQ ID No.4.

[0015] Furthermore, the transfected cells are HEK293A cells.

[0016] The present invention also provides a fusion protein, characterized in that the fusion protein is prepared using the MATV51 recombinant adenovirus vector as described above.

[0017] Furthermore, the amino acid sequence of the fusion protein is shown in SEQ ID No.2.

[0018] The present invention also provides the use of the above-mentioned MATV51 recombinant adenovirus vector in the preparation of HPV16 / 18 / 52 therapeutic vaccines.

[0019] The present invention also provides a HPV16 / 18 / 52 therapeutic vaccine, comprising the above-mentioned MATV51 recombinant adenovirus vector or the above-mentioned fusion protein.

[0020] The beneficial effects of the present invention are:

[0021] (1) The MATV51 recombinant adenovirus vector of the present invention has a nucleotide sequence designed for HPV16 / 18 / 52E6-E7 protein antigens and also contains a nucleotide sequence for encoding CD40L, so that the fusion protein expressed by it uses CD40L as an adjuvant, thereby improving the immune effect and memory effect of the vaccine;

[0022] (2) The MATV51 recombinant adenovirus vector of the present invention is a replication-deficient human adenovirus type 5 with a combined deletion of the E1 and E3 regions. The early genes in the E1 and E3 regions of the Ad5 vector are deleted, resulting in replication defects. However, the vector can transfect host cells without killing the host cells, thus expanding the gene loading space. The vector is highly safe and suitable for community populations.

[0023] (3) The HPV16 / 18 / 52 therapeutic vaccine of the present invention can cover the three HPV virus genotypes at the same time and has good immune and memory effects, which effectively improves the effect of the vaccine and has a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is a schematic diagram of the nucleotide sequence structure of the MATV51 recombinant adenovirus vector of the present invention;

[0025] Figure 2 The MATV51 recombinant adenovirus vector of the present invention is a schematic diagram of the MATV51 plasmid structure of Example 1;

[0026] Figure 3 The MATV51 recombinant adenovirus vector of the present invention is a schematic diagram of the structure of the MATV51 non-replicating adenovirus vector of Example 1;

[0027] Figure 4 The MATV51 recombinant adenovirus vector of the present invention, in Example 2, WB detection of the expression of antigens and the expression of P53 and RB proteins after A549 was transfected with MATV51, Figure 4A in the middle is the result of WB detection of CD40L expression after A549 cells were transfected with MATV51 at different MOIs. Figure 4 Middle B is the result of WB detection of P53 and RB protein expression after A549 was transfected with MATV51. Figure 4 Middle C shows the expression results of HPV16 E6, HPV16 E7, HPV18 E6 and HPV18 E7 antigens after A549 was transfected with MATV51;

[0028] Figure 5 The MATV51 recombinant adenovirus vector of the present invention is a comparison chart of the results of antigen-specific IFN-γ production by mouse lymphocytes in the single-injection intramuscular injection experimental group and the control group in Example 3;

[0029] Figure 6 The MATV51 recombinant adenovirus vector of the present invention, in Example 3, after a booster injection one month apart, the results of the production of antigen-specific IFN-γ by mouse lymphocytes in the experimental group and the control group are compared;

[0030] Figure 7 The MATV51 recombinant adenovirus vector of the present invention is a comparison chart of the secretion of IFN-γ, TNF and IL-2 of specific CD8+T cells or CD4+T cells in the spleen lymphocytes of mice in the experimental group and the control group in Example 3;

[0031] Figure 8 The MATV51 recombinant adenovirus vector of the present invention is a growth curve of TC-1 subcutaneous tumor of mice in the experimental group and the control group in Example 4;

[0032] Fig. 9 The MATV51 recombinant adenovirus vector of the present invention, in Example 4, the growth inhibition curve of subcutaneous TC-1 mice inoculated with different doses of MATV51;

[0033] Fig.10 This is the MATV51 recombinant adenovirus vector of the present invention, and the regrowth curve of the TC-1 subcutaneous tumor of mice in the experimental group and the control group in Example 4. DETAILED DESCRIPTION

[0034] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0035] The MATV51 recombinant adenovirus vector of the present invention comprises nucleotide sequences for encoding E6 and E7 antigens of HPV 16, HPV18 and HPV52, and also comprises a nucleotide sequence for encoding CD40L.

[0036] The MATV51 recombinant adenovirus vector of the present invention has a nucleotide sequence designed for HPV16 / 18 / 52E6-E7 protein antigens and also contains a nucleotide sequence for encoding CD40L, so that the fusion protein expressed by it uses CD40L as an adjuvant, thereby improving the immune effect and memory effect of the vaccine.

[0037] The MATV51 recombinant adenovirus vector of the present invention exerts an immune effect in the body after intramuscular injection by presenting the antigen encoded by the adenovirus vaccine to T cells via antigen presenting cells. Activated CD4+ cells differentiate into specific Th1 cells, activated CD8+ cells differentiate into specific CTL cells, and under the action of secreted IFN-γ, IL-4 and other cytokines, specifically attack the free viruses of HPV16 / 18 / 52 and the cervical epithelial cells integrated with HPV16 / 18 / 52E6 and E7 genes, and finally eliminate the virus and reverse the progression of CIN. The main application population is HPV persistent infection, cervical, anal and vulvar neoplasia.

[0038] TNFSFL molecule CD40L, which is the natural ligand of CD40, participates in the activation of dendritic cells (DC). CD40L, also known as gp39, tumor necrosis factor-associated activation protein (TNF associated activation protein, TRAP), T cell-B cell-activating molecule (T-BAM), is a 33kDa type II transmembrane glycoprotein with a total of 266aa, including 214 amino acids in the extracellular membrane region, which has a high homology with TNF at the amino acid level. CD40L can induce dendritic cells to produce interleukin-12p70 (IL-12p70) and other cytokines, and promote the differentiation of effector T cells.

[0039] Adenovirus is a non-enveloped, double-stranded DNA virus with a size of 80-100nm. It is one of the most promising vaccine vector platforms. Adenovirus vector vaccines have good safety and efficacy. Type 5 recombinant adenovirus vectors have the advantages of a wide range of host cells, large insertable fragments, high viral titers, and a mature industrial production system. Adenovirus vectors include replicative and non-replicative. The main advantages of non-replicative adenovirus vectors are high titer growth ability, easy operation, no integration into the human genome, strong immunogenicity, and easy clinical large-scale production.

[0040] Preferably, the order of the nucleotide sequences encoding E6 and E7 antigens of HPV 16, HPV18 and HPV52 of the present invention is not particularly limited, but the nucleotide sequence encoding CD40L is located at the most downstream position.

[0041] Further preferably, the nucleotide sequence of the coding region of the MATV51 recombinant adenovirus vector is as shown in SEQ ID No.1.

[0042] Specifically, the nucleotide sequence structure diagram of the MATV51 non-replicating adenovirus vector of the present invention is as follows: Figure 1 It can be seen that the adenovirus of the present invention is a replication-deficient human adenovirus type 5 (Ad5) with a combined deletion of the E1 region and the E3 region, and the nucleotide sequence shown in SEQ ID No. 1 is located in the E1 region.

[0043] The early genes in the E1 region of the Ad5 vector are deleted, resulting in replication defects, but it can transfect host cells without killing the host cells, expand the gene loading space, and has high safety, making it suitable for community populations.

[0044] The method for preparing the MATV51 recombinant adenovirus vector of the present invention comprises constructing a recombinant plasmid containing the nucleotide sequence as described above, and then cloning, screening, identifying and transfecting to obtain the recombinant adenovirus vector.

[0045] Preferably, the construction includes the step of amplifying the nucleotide sequence as described above using a primer pair, wherein the forward primer is shown as SEQ ID No.3 and the reverse primer is shown as SEQ ID No.4.

[0046] Preferably, the transfected cells are HEK293A cells.

[0047] A fusion protein of the present invention is prepared by using the above-mentioned MATV51 recombinant adenovirus vector.

[0048] Preferably, the amino acid sequence of the fusion protein is shown as SEQ ID No.2.

[0049] The MATV51 recombinant adenovirus vector of the present invention can be used to prepare HPV16 / 18 / 52 therapeutic vaccines.

[0050] The HPV16 / 18 / 52 therapeutic vaccine of the present invention comprises the MATV51 recombinant adenovirus vector as described above or the fusion protein as described above.

[0051] The present invention is described below by means of specific examples.

[0052] Example 1 Construction of MATV51 non-replicating adenoviral vector

[0053] This example constructs a non-replicative adenovirus type 5 vector of MATV51 based on gene synthesis technology and in vitro ligation technology. The specific steps are as follows:

[0054] (1) Resuscitate pad-CMV-BstBI strains and extract plasmids.

[0055] (2) The nucleotide sequence shown in SEQ ID No. 1 was synthesized in vitro and loaded into the pUC57 sequence (HPVE6E7-51_pUC57).

[0056] (3) Construction of MATV51 plasmid:

[0057] a.BstBI digested pad-CMV-BstBI plasmid;

[0058] b. Using HPVE6E7-51_pUC57 as a template, PCR was performed to obtain the in vitro ligation fragment, and the primers were shown in SEQ ID No.3 and SEQ ID No.4:

[0059] SEQ ID No.3 (MATV51-F):

[0060] GCTCGAGCCTAAGCTTCGA GCCACCATGCACGGCGACAC

[0061] SEQ ID No.4 (MATV51-R):

[0062] GATCGGATATCTTAT TTCGTCACAGCTCATCTTTCGCTT

[0063] The bold part is the PCR primer HPVE6E7-51 segment, and the marked line is the homologous recombination overlap segment.

[0064] c. The products of a and b above are connected in vitro, and the system is shown in Table 1:

[0065] Table 1

[0066] Material Name volume Pad-CMV-BSTBI Plasmid 2μl HPVE6E7-51 PCR purification 5μl NEBuilder HiFi DNA Assembly Master Mix 10μl <![CDATA[Deionized H2O]]> 3μl Total Volume 20μl

[0067] d. Take 5ul of the above product and transfer it into T1 for clone screening and identification;

[0068] e. Obtaining MATV51 plasmid, the nucleotide sequence of which is shown in SEQ ID No.5, and the structure of which is shown in Figure 2 shown.

[0069] (4) The MATV51 plasmid was digested with PacI and purified, and then transfected into HEK293A cells to finally obtain the MATV51 non-replicating adenovirus vector, i.e., the MATV51 recombinant adenovirus vector of the present invention, whose structure is as follows: Figure 3 shown.

[0070] Example 2 Expression of MATV51 antigen

[0071] A549 cells were infected with MOI=50 in vitro, and the expression of MATV51 fusion protein was detected by WB. The order of loading was PBS, MATV0 and MATV51. Figure 4 As shown, the results showed that the fusion proteins detected by HPV16 E6, HPV16 E7, HPV18 E and HPV18 E7 antibodies were basically in the same position and were around 130KD in size.

[0072] Example 3 Identification of the immune effect of MATV51 in C57BL / 6J mice

[0073] (1) Immune response after a single intramuscular injection of MATV51 in healthy C57BL / 6J mice.

[0074] Healthy 8-week-old C57BL / 6J female mice were injected intramuscularly with MATV51 virus at a dose of 10^8 pfu / mouse. The control group was given an empty virus MATV0. The mice were killed 1 week after the injection. Splenic lymphocytes were isolated, and the lymphocytes were stimulated with peptide pools. The Elispot experiment was used to detect the production of specific IFN-γ by lymphocytes against antigens. The results are shown in Figure 2. Figure 5 As shown, the experimental group KDTV001 can produce specific immune responses against antigens in mice, among which HPV16 E6, HPV16 E7, HPV18 E6 and HPV52 E7 reached the positive standard, with the most significant being HPV16 E7 and HPV18 E6, which are similar to the responses of HPV therapeutic vaccines in C57BL / 6J mice reported in other literatures.

[0075] (2) Immune response of healthy C57BL / 6J mice after intramuscular injection of MATV51 and booster injection one month later.

[0076] Healthy 8-week-old C57BL / 6J female mice were injected intramuscularly with MATV51 virus at a dose of 10^8 pfu / mouse, and then given a booster injection of the same dose of virus one month later. The control group was given an empty virus MATV0. The mice were killed one week after the booster injection. Splenic lymphocytes were isolated, and the lymphocytes were stimulated with a peptide pool. The Elispot assay was used to detect the production of specific IFN-γ by lymphocytes against antigens. The results are shown in Figure 2. Figure 6 As shown, the experimental group KDTV001 can produce specific immune responses against antigens in mice, among which HPV16 E6, HPV16 E7, HPV18 E6 and HPV52 E7 reached the positive standard, with the most significant being HPV16 E7 and HPV18 E6, which are similar to the responses of HPV therapeutic vaccines in C57BL / 6J mice reported in other literatures.

[0077] (3) MATV51 induces specific cellular immune response in C57BL / 6J mice.

[0078] Healthy 8-week-old C57BL / 6J female mice were intramuscularly injected with MATV51 vaccine at a dose of 10^8 pfu / mouse, and then received a booster shot of the same dose one month later. The control group was given an empty virus MATV0. The mice were killed one week after the booster shot. Splenic lymphocytes were isolated, and the secretion of intracellular factors IFN-γ, TNF, and IL-2 by specific CD8+T cells or CD4+T cells was detected by multicolor flow cytometry. The results are shown in Figure 2. Figure 7 As shown. MATV51 can increase the proportion of HPV16 E7-specific CD8+IFN-γ+T cells and CD8+TNF+T cells in mice, as well as the proportion of HPV18 E7-specific CD8+IFN-γ+T cells and HPV18 E6-specific CD8+IFN-γ+T cells.

[0079] Example 4 Anti-tumor effect of MATV51 on TC-1 in C57BL / 6J mice

[0080] (1) Comparison of tumor inhibition rates between the MATV51 group and the MATV0 group:

[0081] TC-1 cells are transgenic mouse lung epithelial cells with HPV16 E6 and HPV16 E7 and ras genes. A subcutaneous tumor model of the buttocks was established and randomly divided into MATV51 group and MATV0 group. MATV51 vaccine was administered around the 10th day after the inoculation of subcutaneous tumors, with a dose of 10^8 pful / mouse. The size of the subcutaneous tumor was measured and recorded every other day. Figure 8 As shown in Figure 2, MATV51 can effectively inhibit the growth of TC-1 tumors at 10^8 pfu / mouse. One week after vaccination, the tumors in the experimental group were significantly reduced, and the volume of all mice in the control group exceeded 2000 mm. 3 , the tumor inhibition rate of MATV51 can reach 100%.

[0082] (2) Comparison of tumor inhibition rates of different doses of MATV51 vaccine:

[0083] The TC-1 buttocks subcutaneous tumor model was established. The groups were inoculated with 10^6 pfu / mouse, 10^7 pfu / mouse, 10^8 pfu / mouse and 10^9 pfu / mouse of MATV51. The size of TC-1 tumor was measured and recorded. The tumor growth curve is shown in Fig. 9 shown.

[0084] according to Fig. 9It can be seen that when the dosage of MATV51 is 10^7pfu / mouse, 10^8pfu / mouse and 10^9pfu / mouse, the tumor inhibition rate of TC-1 is basically 100%. When it is 10^6pfu / mouse, the tumor inhibition rate of MATV51 can reach about 83%.

[0085] (3) Memory protection effect of MATV51:

[0086] Establish the TC-1 memory model. Figure 7 In the MATV51 group without tumor formation, TC-1 cells were inoculated again, and the size of the tumor was observed and measured. Fig.10 As shown, the memory effect of MATV51 vaccine can protect 100% of mice from tumor recurrence.

[0087] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A MATV51 recombinant adenovirus vector, characterized in that: The MATV51 recombinant adenovirus vector includes nucleotide sequences for encoding E6 and E7 antigens of HPV 16, HPV18 and HPV52, and also includes a nucleotide sequence for encoding CD40L.

2. A MATV51 recombinant adenovirus vector according to claim 1, characterized in that: The nucleotide sequence of the coding region of the recombinant adenovirus vector is shown in SEQ ID No.

1.

3. A MATV51 recombinant adenovirus vector according to claim 2, characterized in that: The adenovirus is a replication-deficient human adenovirus type 5 with a combined deletion of the E1 region and the E3 region, and the nucleotide sequence shown in SEQ ID No. 1 is located in the E1 region.

4. A method for preparing the MATV51 recombinant adenovirus vector according to claim 3, characterized in that: A recombinant plasmid containing the nucleotide sequence shown in SEQ ID No. 1 is constructed, and then cloned, screened, identified and transfected to obtain the MATV51 recombinant adenovirus vector.

5. The method for preparing the MATV51 recombinant adenovirus vector according to claim 4, characterized in that: The construction comprises the step of amplifying the nucleotide sequence shown in SEQ ID No.1 using a primer pair, wherein the forward primer is shown in SEQ ID No.3 and the reverse primer is shown in SEQ ID No.

4.

6. The method for preparing the MATV51 recombinant adenovirus vector according to claim 4, characterized in that: The transfected cells are HEK293A cells.

7. A fusion protein, characterized in that The fusion protein is prepared using the MATV51 recombinant adenovirus vector as described in any one of claims 1 to 3.

8. A fusion protein according to claim 7, characterized in that: The amino acid sequence of the fusion protein is shown in SEQ ID No.

2.

9. Use of the MATV51 recombinant adenovirus vector according to any one of claims 1 to 3 in the preparation of HPV16 / 18 / 52 therapeutic vaccines.

10. A HPV16 / 18 / 52 therapeutic vaccine, characterized in that: It comprises the MATV51 recombinant adenovirus vector as described in any one of claims 1 to 3 or the fusion protein as described in any one of claims 7 to 8.

Images