Culture method of Weissella fusiformis RM125 and application of Weissella fusiformis RM125 in mandarin fish culture

Abstract

The invention provides a culture method of Weissella fusiformis RM125 and application of the Weissella fusiformis RM125 in mandarin fish culture, a probiotic strain is named as Weissella fusiformis RM125, is identified as Weissella, is preserved in China General Microbiological Culture Collection Center on November 11, 2024, and has a preservation number of CGMCC NO.32556. The invention further provides a preparation method of the Weissella fusiformis RM125. The strain can be stably planted in the intestinal tract of the feed siniperca chuatsi, can significantly improve the intestinal tract health of the siniperca chuatsi, significantly promotes the growth of the siniperca chuatsi, and reduces

Description

Technical Field

[0001] The invention belongs to the technical field of microbial engineering, and particularly relates to a cultivation method of fused Weissella RM125 and application of the method in mandarin fish breeding. Background Art

[0002] Siniperca chuatsi is one of the most important freshwater carnivorous economic fish in my country. It likes to eat live fish bait and is not easy to accept dead fish and artificial feed. Siniperca chuatsi has high requirements for protein and fat in feed. The most suitable protein content in feed is 46% to 50% and the fat content is 12% to ensure the maximum growth rate of Siniperca chuatsi. If the content is insufficient, it will inhibit the growth of Siniperca chuatsi. After excessive protein intake, Siniperca chuatsi cannot be fully utilized, which increases the ammonia nitrogen excretion of Siniperca chuatsi and affects the environment. The breeding of Siniperca chuatsi currently faces many challenges, among which the low domestication rate, high requirements for the domestication process, poor feed utilization ability and imbalanced feed ratio are key issues that need to be solved urgently. A kind of Weissella sinusoidalis SJ548 disclosed in the technical document with application number 202410357355.X, based on which the microbial preparation prepared is used as an additive in Siniperca chuatsi feed, has antibacterial and anti-free radical activity, can effectively improve the intestinal health of Siniperca chuatsi, and increase the survival rate and weight gain rate. On the basis of the existing technology, how to further develop and utilize microbial preparations to improve the effective utilization rate of artificial baits by mandarin fish is a technical problem that needs to be solved at present. Summary of the invention

[0003] In order to solve the above technical problems, the present invention proposes a culture method of fusion Weissella RM125 and applies the method to feed mandarin fish farming.

[0004] First, the present invention discloses a fusion Weissella RM125, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on November 11, 2024, with a deposit number of CGMCC NO.32556. The present invention also discloses a method for culturing the fusion Weissella RM125, comprising the following steps:

[0005] Obtain the fused Weissella RM125,

[0006] Set the culture temperature to 30-35°C and the pH value of the culture medium to 5-8.

[0007] The fused Weissella RM125 as claimed in claim 1 was cultured in a culture medium for 12-24 hours.

[0008] The present invention also discloses a microbial preparation, which comprises the above-mentioned Weissella RM125 or one or more components of its fermentation liquid, exosomes, and metabolites.

[0009] The invention also discloses the application of the fused Weissella RM125 in inhibiting Escherichia coli, Staphylococcus aureus, Aeromonas hydrophila, Salmonella, Harveyella, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio anguillarum.

[0010] The invention also discloses application of the fused Weissella RM125 in improving the utilization rate of mandarin fish feed.

[0011] The fused Weissella RM125 disclosed in the present invention is a fused Weissella, which has an inhibitory effect on Escherichia coli, Staphylococcus aureus, Aeromonas hydrophila, Salmonella, Harveyella, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio anguillarum, plays a role in preventing and treating bacterial diseases of mandarin fish, is resistant to high temperatures, and is suitable for strong acid and strong alkali environments. When the fused Weissella RM125 is added to mandarin fish feed to feed the mandarin fish, the mandarin fish can be stably colonized in the intestines of the feed mandarin fish, and the intestinal health of the mandarin fish can be significantly improved, and the growth of the mandarin fish can be promoted and the feed coefficient can be reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a photo of the colony morphology of the fused Weissella after separation and purification in Example 1 of the present invention;

[0013] Figure 2 This is a scanning electron microscope (SEM) microscopic photograph of the isolated and purified Weissella fusion in Example 1 of the present invention;

[0014] Figure 3 This is a Gram staining microscope observation image of the isolated and purified Weissella fusion in Example 1 of the present invention;

[0015] Figure 4 The phylogenetic tree of the isolated and purified fused Weissella in Example 1 of the present invention;

[0016] Figure 5 The figure is a growth curve of the isolated and purified Weissella fusion in Example 2 of the present invention, wherein the abscissa is time (h) and the ordinate OD600 is the absorbance at a wavelength of 600 nm;

[0017] Figure 6 This is a comparison diagram of Weissella fusion under different temperature conditions after separation and purification in the embodiment of the present invention;

[0018] Figure 7 This is a comparison diagram of the separated and purified Weissella fusion under different pH conditions in the embodiment of the present invention;

[0019] Figure 8 : is a graph showing the antibacterial test results of Weissella fusion after separation and purification in an embodiment of the present invention, A is Aeromonas hydrophila, B is Escherichia coli, C is Vibrio parahaemolyticus, D is Harveyella, E is Staphylococcus aureus, F is Vibrio anguillarum, G is Vibrio alginolyticus, and H is Salmonella;

[0020] Fig. 9 This is a comparison chart of the effects of different feeding methods on the growth performance of mandarin fish. A is the final weight gain, B is the weight gain rate, C is the specific growth rate, and D is the feed coefficient.

[0021] Fig.10 Comparison of intestinal sections of mandarin fish in different feeding methods (40×), AC is the foregut, midgut and hindgut of the feeding group, DF is the foregut, midgut and hindgut of the Weissella-added feeding group;

[0022] Fig.11 This is a comparison chart of the effects of feeding methods on the species composition of the intestinal flora of mandarin fish. DETAILED DESCRIPTION

[0023] It should be noted that, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0024] The cultured mandarin fish in the following embodiments is Siniperca chuatsi (Siniperca chuatsi), commonly known as mandarin fish and sweet-scented osmanthus fish, belonging to the family Serranidae of the order Perciformes.

[0025] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments. Without departing from the spirit and essence of the present invention, any modification or replacement of the method, steps or conditions of the present invention shall fall within the scope of the present invention.

[0026] Example 1 Isolation, purification and identification of fusion Weissella RM125

[0027] 1.1 Isolation and purification of intestinal bacteria

[0028] The collected intestinal contents of the mandarin fish were rinsed with 1 mL of sterile saline and the stock solution was collected. The stock solution was diluted 10 times to 10-1, 10-3, and 10-5 gradients. 0.1 mL of liquid was applied to MRS solid medium for each gradient, and 3 replicates were set for each gradient. The culture was kept at 30°C under anaerobic conditions for 12 hours until colonies appeared, and a single strain was picked and transferred and streaked 3 times for purification.

[0029] 1.2 Identification of dominant bacteria morphology

[0030] Observe the colony morphology and color of MRS solid culture medium. Figure 1 As shown in the figure, the colonies are milky white, round, with a plump and smooth surface and rounded edges. The pure colonies were inoculated into MRS liquid culture medium and cultured at 30°C and 200 rpm for 12 hours. The morphology was observed under a scanning electron microscope. Figure 2As shown, the bacteria have regular shape, short rods or double rods, no flagella, and a relatively smooth surface.

[0031] 1.3 Biochemical characterization

[0032] Prepare slides, gram stain and observe under a microscope. Figure 3 As shown, the observation result is Gram-positive. Physiological and biochemical tests were performed using the VITEK2 method, and the results are shown in Table 1 below. Conventional biochemical characteristics were determined. The bacteria can grow in a medium containing 6.5% NaCl, can utilize sucrose, maltose, mannose and xylose, and cannot use glucose, trehalose, lactose, galactose and mannitol as carbon sources. It is tolerant to neomycin, optoxin, O / 129, polymyxin B, and bacitracin, and can produce arginine dihydrolase.

[0033] Table 1. Biochemical characteristics and results

[0034]

[0035]

[0036] Note: In Table 1: “+”, positive; “-”, negative.

[0037] 1.3 DNA extraction and sequencing:

[0038] The strain DNA was extracted using the Omega bacterial genome extraction kit, and the 16S rDNA sequence was amplified with 27F (5'-AGAGTTTGATCMTGGCTCAG-3') and 1492R (5'-TACGGYTACCTTGTTACGACTT-3'). PCR amplification reaction system (25μL): 2×Taq PCR MasterMix*, 12.5μL; template DNA, 1μL; primer 1, 1μL; primer 2, 1μL; ddH2O was added to 25μL. Reaction conditions: 94℃ pre-denaturation for 5min, 94℃, 30s, 53℃ annealing for 90s, 72℃ extension for 10min, a total of 35 cycles; stored at 4℃. The amplified products were detected by 1% agarose gel electrophoresis, and the samples with bright and clear target bands were sent to Beijing Zhixu Biotechnology Co., Ltd. for sequencing.

[0039] The sequencing results were analyzed by NCBI BLAST software, and the results showed that the bacteria had a 99.93% similarity to Weissella fusion 2879 (MT611841.1). Combined with the morphology, it was identified as Weissella fusion and named Weissella fusion RM125.

[0040] Using MEGA11 to build a system such as Figure 4 Developmental tree shown.

[0041] Sequencing results:

[0042] >RM125

[0043] CAAGTCGAACGCTTTGTGGTTCAACTGATTTGAAGAGCTTGCTCAGATATGACGATGGA

[0044] CATTGCAAAGAGTGGCGAACGGGTGAGTAACACGTGGGAAACCTACCTCTTAGCAGGGG

[0045] ATAACATTTGGAAACAGATGCTAATACCGTATAACAATGACAACCGCATGGTTGTTATT

[0046] TAAAAGATGGTTCTGCTATCACTAAGAGATGGTCCCGCGGTGCATTAGCTAGTTGGTAA

[0047] GGTAATGGCTTACCAAGGCGATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACAAT

[0048] GGGACTGAGACACGGCCCATACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATG

[0049] GGCGAAAGCCTGATGGAGCAACGCCGCGTGTGTGATGAAGGGTTTCGGCTCGTAAAACA

[0050] CTGTTGTAAGAGAAGAATGACATTGAGAGTAACTGTTCAATGTGTGACGGTATCTTACC

[0051] AGAAAGGAACGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGTTCCAAGCGTTA

[0052] TCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGTCTGAAGTGAAAGCC

[0053] CTCAGCTCAACTGAGGAATTGCTTTGGAAACTGGATGACTTGAGTGCAGTAGAGGAAAG

[0054] TGGAACTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAAGAACACCAGTGGCGAAG

[0055] GCGGCTTTCTGGACTGTAACTGACGTTGAGGCTCGAAAGTGTGGGTAGCAAACAGGATT

[0056] AGATACCCTGGTAGTCCACACCGTAAACGATGAGTGCTAGGTGTTTGAGGGTTTCCGCC

[0057] CTTAAGTGCCGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTG

[0058] AAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAA

[0059] GCAACGCGAAGAACCTTACCAGGTCTTGACATCCCTTGACAACTCCAGAGATGGAGTGT

[0060] TCCCTTCGGGGACAAGGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGAT

[0061] GTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATTACTAGTTGCCAGCATTCAGTTGG

[0062] GCACTCTAGTGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCAT

[0063] CATGCCCCTTATGACCTGGGCTACACACGTGCTACAATGGCGTATACAACGAGTTGCCA

[0064] ACCCGCGAGGGTGAGCTAATCTCTTAAAGTACGTCTCAGTTCGGATTGTAGGCTGCAAC

[0065] TCGCCTACATGAAGTCGGAATCGCTAGTAATCGCGGATCAGCACGCCGCGGTGAATACG

[0066] TTCCCGGGTCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGCCG

[0067] GTGGGGTAACCTTCGGGAGCCAGCCGTCTAAGGTGACAGAGATGC

[0068] The sequence was submitted to the GenBank nucleotide sequence database with the accession number PP0125780.1. The strain was deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration on November 11, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 32556 and the classification name: Weissella confusa.

[0069] Example 2 Study on the characteristics of fusion Weissella RM125

[0070] 2.1 Growth curve

[0071] The fused Weissella RM125 obtained in Example 1 was inoculated into MRS broth medium and cultured at 30°C and 200 rpm for 48 h. The OD600 value of Weissella was measured every 2 h, and a growth curve was drawn. Figure 5 As a result, it entered the logarithmic growth phase in 2 hours, entered the plateau phase in 12 hours, and reached the maximum OD600 value.

[0072] 2.2 Optimum temperature and pH determination

[0073] Take 100 μL of the suspension of fused Weissella RM125 cultured to the exponential phase and inoculate it into MRS medium. After culturing at 20, 25, 30, 35, 40, and 45 °C for 24 h, measure the OD600 value. Figure 6 , the fusion Weissella RM125 can grow at 20-45℃, with the optimal growth temperature being 30-35℃, and there are significant differences in growth conditions.

[0074] Take 100 μL of the suspension of fused Weissella RM125 cultured to the exponential phase and inoculate it into MRS medium with final pH values ​​of 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, and 9.5, respectively. After culturing at 30°C for 24 h, measure the OD600 value. Figure 7 The results showed that the fusion Weissella RM125 could grow in culture media with an initial pH of 4-9.5, but there were obvious differences in the growth conditions, and the optimal pH was 6-7.

[0075] Example 3 Antibacterial test of fusion Weissella RM125

[0076] Using the Oxford cup method, 8 pathogens (Escherichia coli, Staphylococcus aureus, Salmonella, Harveyella, Vibrio anguillarum, Vibrio alginolyticus, Vibrio parahaemolyticus, Aeromonas hydrophila) were spread on LB solid culture medium plates, and Oxford cups were placed. Three Oxford cups were added, and 100 μL of bacterial suspension was added. A blank control was set up. The plates were cultured at 30°C for 12 hours, and the inhibition zones were observed and the inhibition diameters were recorded. The experimental results are shown in Table 2 and Figure 8 As shown, the fused Weissella RM125 has an inhibitory effect on Escherichia coli, Staphylococcus aureus, Salmonella, Harveyella, Vibrio anguillarum, Vibrio alginolyticus, Vibrio parahaemolyticus, and Aeromonas hydrophila. This result proves that the fused Weissella RM125 has a broad-spectrum antibacterial activity.

[0077] Table 2. Antibacterial test results

[0078]

[0079] Note: In Table 2, + indicates that the diameter of the inhibition zone is <15mm, which is low sensitivity; ++ indicates that the diameter of the inhibition group is 15-17mm; +++ indicates that the diameter of the inhibition zone is >17mm.

[0080] Example 4 Probiotics Incorporating Weissella RM125

[0081] Take the fused Weissella RM125 strain in Example 1, inoculate it in MRS broth medium with an inoculum of 0.5-5% (v / v), and culture it at 35° C., pH 6.5-7.5 for 12 hours. After the strain is activated, inoculate it in a fermentation medium with an inoculum of 1.5-2% (v / v), and ferment it for 24 hours at 35° C., pH 6.5-7.5. After the fermentation is completed, a bacterial solution is obtained, which is a probiotic agent of fused Weissella RM125.

[0082] Example 5 Mandarin fish breeding test example

[0083] The artificial compound feed for mandarin fish mainly fed in this embodiment is provided by Anhui Dafu Da Mandarin Fish Aquatic Products Co., Ltd., and the main components of the compound feed include: crude protein ≥48.0%, crude fat ≥10.0%, crude fiber ≤4%, crude ash ≤12.0%, lysine ≥2.8%, calcium ≥1.5%, total phosphorus ≥1.5%, and moisture ≤12.0%.

[0084] Three experimental groups were set up: an artificial compound feed group (C), an artificial compound feed group (RM) fed with the addition of Weissella RM125, and an artificial compound feed group (SJ) fed with the addition of the probiotic agent Weissella edodes SJ548. Group C: The artificial compound feed was Haiying brand mandarin fish special feed; Group RM: The feed was the Haiying brand mandarin fish special feed added with the probiotic agent Weissella RM125, and the probiotic component was preferably prepared in the manner of Example 4, and the number of viable bacteria in the C component feed was not less than 1×10 7 CFU / g, SJ group: The number of viable bacteria of Weissella sinensis SJ548 added to the Haiying brand mandarin fish feed is not less than 3×10 7 CFU / g.

[0085] The experimental process is as follows: The experiment was conducted in the mandarin fish breeding workshop of Dafu Da Mandarin fish ecological breeding base in Chizhou, Anhui Province. The breeding system is flow-through breeding. The length, width and height of a single breeding pond are 4m×4m×1.2m respectively, and the breeding water body is 12.8m 3 . The initial average temperature of the culture water was 28°C, and the pH was about 7. The domesticated mandarin fish with an initial body weight of about 200g were selected and divided into 3 culture ponds, with 100 fish in each culture pond, which were fed with artificial feed group (C), artificial feed group supplemented with Weissella RM125 (RM), and artificial feed group supplemented with Weissella sinusoidalis SJ548 (SJ group). Feed twice a day, and the feed amount is 2wt% of the total body weight of the fish.

[0086] This example tests the growth effect and intestinal tissue morphology of the three groups of mandarin fish. The test period is 30 days. The weight and body length of mandarin fish are measured on the 0th day, 15th day and 30th day respectively. The survival rate, weight gain rate, specific growth rate and feed coefficient of each experimental group are calculated. The test results are shown in Table 3 and Fig. 9 It should be noted that the calculation formula of the specific growth rate is: [W t : Average body weight at the end of the experiment (g);

[0087] W0: average body weight at the beginning of the experiment (g), T is the number of days of culture (d). ]; the calculation formula of feed coefficient is [W t : average body weight at the end of the experiment (g); W0: average body weight at the beginning of the experiment (g), W s : Average feed intake per tail (g). ]

[0088] After the 30-day experiment, the height of intestinal villi and thickness of the muscular layer of the foregut, midgut and hindgut of the mandarin fish were measured and observed. The test results are as follows: Fig.10 shown.

[0089] After the 30-day experiment, the microbial species composition of the intestinal contents of mandarin fish was analyzed to observe whether Weissella fusion RM125 was stably colonized in the intestine. The test results are as follows Fig.11 shown.

[0090] Table 3. Growth comparison of different feeding groups

[0091]

[0092] From Table 3 and Fig. 9 It can be seen from the test results that the survival rate and weight gain rate of mandarin fish in the feed group (RM) supplemented with Weissella are significantly higher than those in the artificial feed group (C). Compared with the probiotic agent (SJ) of Weissella sphaerocephala SJ548 disclosed in the prior art, the feed group (RM) supplemented with Weissella sphaerocephala significantly reduces the feed coefficient and the specific growth rate of mandarin fish is also relatively improved.

[0093] from Fig.10 The experimental results show that the Weissella-added feed group (RM) can significantly improve the intestinal health of mandarin fish. The most intuitive manifestation of the above-mentioned improvement is that the thickness of the muscular layer of the intestinal tract of mandarin fish has increased, the number of villi has increased, and the height of the villi has increased. Fig.11 It can be seen from the experimental results that the fused Weissella RM125 is the dominant genus in the Weissella added feed group (RM) and can stably colonize in the intestine. The fused Weissella RM125 of this embodiment applied to feed can not only prevent and treat bacterial diseases of mandarin fish, but also promote the growth of mandarin fish and reduce the feed coefficient.

[0094] Although the present invention has been described in detail above by general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A fusion strain of Weissella RM125, characterized in that: The strain was deposited in the China General Microbiological Culture Collection Center on November 11, 2024, with the deposit number CGMCC NO.32556.

2. A method for cultivating fusion Weissella RM125, characterized in that: The following steps are involved: Obtain the fused Weissella RM125 as claimed in claim 1, Set the culture temperature to 30-35°C and the pH value of the culture medium to 5-8. The fused Weissella RM125 as claimed in claim 1 was cultured in a culture medium for 12-24 hours.

3. The method for cultivating the fusion Weissella RM125 as claimed in claim 2, characterized in that: The culture medium includes any one of MRS broth medium and MRS solid medium.

4. The method for cultivating the fusion Weissella RM125 as claimed in claim 3, characterized in that: The fused Weissella RM125 as claimed in claim 1 is cultured in a culture medium for 12-24 hours.

5. A microbial preparation, characterized in that: It includes one or more components of the fused Weissella RM125 or its fermentation liquid, exosomes, and metabolites described in claim 1.

6. Use of the fused Weissella RM125 described in claim 1 in inhibiting Escherichia coli, Aeromonas hydrophila, Staphylococcus aureus, Salmonella, Vibrio anguillarum, Vibrio harveyi, Vibrio parahaemolyticus, and Vibrio alginolyticus.

7. Use of the fused Weissella RM125 according to claim 1 in preparing mandarin fish feed.

Images