Wheat E3 ubiquitin ligase gene RFEL1 and application thereof in wheat disease resistance

Abstract

The invention discloses a wheat E3 ubiquitin ligase gene RFEL1 and application of the wheat E3 ubiquitin ligase gene RFEL1 in wheat disease resistance, and belongs to the technical field of plant genetic engineering. The invention discloses a nucleotide sequence of a wheat E3 ubiquitin ligase gene RFEL1 as shown in SEQ ID NO. 3. The invention further provides application of the wheat E3 ubiquitin ligase gene RFEL1 or related biological materials thereof. The application comprises any one of the following applications: A1, improving the resistance of wheat to stripe rust; a2, the resistance of wheat to powdery mildew is improved; and A3, the resistance of wheat to leaf rust is improved. The E3 ubiquitin ligase RFEL1 gene provided by the invention not only has broad-spectrum resistance to different stripe rust, but also has resistance to wheat leaf rust and powdery mildew. The E3 ubiquitin ligase RFEL1 gene disclosed by the invention is applied to broad-spectrum resistance breeding of wheat and has important application value.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a wheat E3 ubiquitin ligase gene RFEL1 and application thereof in wheat disease resistance. Background Art

[0002] Wheat is one of the most important food crops in the world and my country. Its global planting area is second only to corn and rice, and it provides food for about 35% of the world's population. Ensuring the safe and efficient production of wheat is crucial to ensuring global food and nutrition security. However, the existence and continued prevalence of plant diseases pose serious challenges to the safe production of wheat. During the growth of wheat, there are several serious fungal diseases that continuously and frequently harm the yield and quality of wheat, including stripe rust caused by Puccinia striatum, leaf rust caused by Puccinia recondita, powdery mildew caused by Blumeria graminis, and fusarium head blight and stem base rot caused by various Fusarium species.

[0003] Planting resistant wheat varieties is a very effective, economical and environmentally friendly measure to prevent and control stripe rust. However, as stripe rust fungi continue to mutate and produce new physiological subspecies, they can overcome the stripe rust resistance of disease-resistant varieties that have been cultivated for a long time and in a single culture. With the intensification of global climate change, the area where stripe rust is prevalent is expanding, causing more and more losses. In order to efficiently cultivate wheat varieties with stripe rust resistance, it is necessary to discover more wheat stripe rust resistance genes and fully understand their molecular mechanisms, so as to provide genetic resources and theoretical basis for better breeding of wheat varieties with long-lasting and stable stripe rust resistance. Summary of the invention

[0004] The purpose of the present invention is to provide a wheat E3 ubiquitin ligase gene RFEL1 and its application in wheat disease resistance to solve the problems existing in the above-mentioned prior art. The wheat E3 ubiquitin ligase gene RFEL1 can be used for wheat broad-spectrum resistance breeding.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] Technical solution 1: wheat E3 ubiquitin ligase gene RFEL1, the nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.3.

[0007] Technical Solution 2: The application of the wheat E3 ubiquitin ligase gene RFEL1 or its related biological materials includes any of the following applications:

[0008] A1. Improve wheat's resistance to stripe rust;

[0009] A2. Improve wheat's resistance to powdery mildew;

[0010] A3. Improve wheat resistance to leaf rust.

[0011] Furthermore, the relevant biological material includes any one of the following B1-B5:

[0012] B1, the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1;

[0013] B2, an expression cassette comprising the wheat E3 ubiquitin ligase gene RFEL1;

[0014] B3, a recombinant vector comprising the wheat E3 ubiquitin ligase gene RFEL1;

[0015] B4, a recombinant microorganism comprising the wheat E3 ubiquitin ligase gene RFEL1;

[0016] B5. Transgenic material comprising the wheat E3 ubiquitin ligase gene RFEL1.

[0017] Furthermore, the amino acid sequence of the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.4.

[0018] The recombinant vector comprises the wheat E3 ubiquitin ligase gene RFEL1 with a sequence as shown in SEQ ID NO.3; the recombinant microorganism comprises the wheat E3 ubiquitin ligase gene RFEL1 with a sequence as shown in SEQ ID NO.3.

[0019] Technical solution three: Application of a functional product for increasing the expression level of the wheat E3 ubiquitin ligase gene RFEL1 in improving resistance to wheat stripe rust, wheat powdery mildew and wheat leaf rust, wherein the functional product is a gene RFEL1 overexpression vector.

[0020] Technical solution 4: A method for improving wheat resistance to stripe rust, powdery mildew and leaf rust, comprising the following steps:

[0021] S1. constructing an overexpression vector using the wheat E3 ubiquitin ligase gene RFEL1 as a target gene;

[0022] S2, transforming the constructed overexpression vector into wheat;

[0023] S3. Screen and obtain positive transgenic wheat.

[0024] The present invention discloses the following technical effects:

[0025] The present invention conducts transcriptome sequencing analysis on samples of Urartu wheat material PI428322 before and after inoculation with wheat stripe rust, and identifies an E3 ubiquitin ligase gene RFEL1 that is induced to up-regulate expression by stripe rust. Virus-induced gene silencing technology is used to preliminarily verify that the RFEL1 gene positively regulates wheat resistance to stripe rust. Urartu wheat (Triticum urartu) is a diploid wild einkorn wheat, and is the ancestral species of the A genome of tetraploid wheat and hexaploid wheat. There are a large number of germplasm resources in nature, which can be used as a gene resource for the discovery of stripe rust resistance genes and applied to the breeding of common wheat. Transgenic technology is further used to introduce it into common hexaploid wheat Fielder to verify that it positively regulates wheat resistance to stripe rust. The stripe rust resistance identification results show that the RFEL1 overexpression strain is resistant to different stripe rust physiological races CYR17, CYR32, CYR33 and CYR34. Further resistance identification showed that the RFEL1 overexpression strain was resistant to both powdery mildew and stripe rust. The E3 ubiquitin ligase RFEL1 gene can be used for broad-spectrum resistance breeding of wheat and has important application value. The invention identifies a broad-spectrum disease resistance gene, providing theoretical guidance and genetic gene resources for wheat disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 The results showed that the silencing of RFEL1 by barley mosaic virus in the Urartu wheat material PI428322 could reduce the resistance of the material to the stripe rust fungus CYR34. A: The relative expression of RFEL1 gene in BSMV:GFP and BSMV:RFEL1 plants; B: After silencing RFEL1, the resistance of the disease-resistant material PI428322 to the stripe rust fungus CYR34 was weakened; C: The area occupied by stripe rust spores on the leaf surface of BSMV:RFEL1 plants was significantly higher than that of BSMV:GFP plants;

[0028] Figure 2In order to stably transform the common wheat susceptible variety Fielder with RFEL1 gene, the RFEL1 overexpressing plants enhanced the resistance to stripe rust CYR34. A: The expression level of RFEL1 gene in the overexpressing positive plants and wild-type Fielder was identified by qRT-PCR; B: Overexpression of RFEL1 enhanced the resistance of common wheat Fielder to stripe rust CYR34; C: The biomass of stripe rust in the infected leaves of the RFEL1 overexpressing positive plants was significantly lower than that of the wild-type Fielder;

[0029] Figure 3 The results showed that RFEL1 overexpression enhanced wheat resistance to stripe rust fungi CYR17, CYR32, and CYR33;

[0030] Figure 4 RFEL1 overexpression enhanced wheat resistance to powdery mildew E09, where A: cell death and H2O2 accumulation in RFEL1 overexpression plants and wild-type Fielder plants after inoculation with powdery mildew E09 for 48 h; B: RFEL1 overexpression enhanced common wheat Fielder resistance to powdery mildew E09;

[0031] Figure 5 RFEL1 overexpression plants enhanced wheat resistance to leaf rust Pt23a. A: The phenotypes of RFEL1 overexpression plants and wild-type Fielder plants 14 days after inoculation with leaf rust Pt23a; B: The leaf rust biomass in the infected leaves of RFEL1 overexpression positive plants was significantly lower than that of wild-type Fielder. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1

[0038] Obtaining the gene sequence of E3 ubiquitin ligase RFEL1

[0039] Through transcriptome sequencing analysis, an E3 ubiquitin ligase gene TuG1812G0100001368 (named RFEL1) was obtained. Gene-specific primers were designed based on the CDS sequence of TuG1812G0100001368 in G1812 in the Urartu wheat database, and amplified in the cDNA sample of the leaves of the Urartu wheat material PI428322 to obtain the full-length sequence of RFEL1. The specific operation process is as follows: At room temperature, the Urartu wheat material PI428322 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University) was planted in a seedling pot, and the leaves were taken when the seedlings grew to 10 days old, and RNA was extracted using Trizol reagent, and reverse transcribed using First-strand cDNA Synthesis Mix. Then, FP: 5'-ATGGATGACAGTTGCGCG-3' (SEQ ID NO.1) and RF: 5'-CTATTTCTTTCCATTGCTGGAAAAG-3' (SEQID NO.2) were used as primers, PI428322 leaf cDNA was used as a template, and KOD-FX high-fidelity enzyme was used for PCR amplification (amplification program was 94°C pre-denaturation for 5 min; 98°C denaturation for 20 s, 58°C annealing for 15 s, 68°C extension for 3 min, 35 cycles; 68°C extension for 10 min. The reaction system was 50 μL, and its components were 2 μL cDNA, 1.5 μL 10 μM primer FP, 1.5 μL 10 μM primer RF, 10 μL 2 mM dNTPs, 1 μL KOD-FX Taq (Toyobo), 25 μL 2×KOD-FX PCR Buffer and 9 μL The full-length CDS sequence of RFEL1 was obtained by adding ddH2O), the specific sequence is shown in SEQ ID NO.3, and the amino acid sequence encoded by it is shown in SEQ ID NO.4.

[0040] SEQ ID NO.3:

[0041]

[0042] SEQ ID NO.4:

[0043] MDDSCAVCADALEWVAYGPCGHREVCSTCVVRLRFVLEDSLCCICKTDCPSVFVTKAMGDYTKVISDFSVLPTEANEGNVGEYWYHEDTKAYFDDADHYKMIRAMCRLSCSVCDKAEDQVGQAAQAKRRSRFKSIDQLKGHLFHQHRLYMCNLCLEGRKVFICEQKLYTRAQLAQHTKTGDSEVDGSEIERSGFAGHPVCEFCKYPLYGDNELYTHMSREHYSCHICQRQHPGQYDYFRNYDDLEMHFRKDHFLCEDDACLAKKFVVFQSDAEIKRHNAMEHGGRMSRAQRNAALQIPTSFIYQRNEQDQRRGRGRGRNAHHDRPDRDFSLPVRDGSATADHGLGSRVDSVAGPFQSLSVSSSSGRTETGRSLGNGRLLEQLSFPPLQDQDIPDARMDAVPYETSFPPVSEQQSRYALALNQSSRGSARLGDESLFPPLPGSSNKGSASTQQGLQSLAKNTLASRLQQRSKGTVKVLYSAQSQTAENPEIVPHVSTSTQTWPTPEQGLHLSGSSQLWIVTQSTRENGLMPSASSGSAWNSRASNKMKHSISTPNFVSGGSSAQASSTAYGNKKQLPPQSSQPLPVVEDVRQANKSLVERMRVALGMDEDRFSAFKEIASEYRQGVIDTSEYLSYVEQFGISHLVPEMAKLLPDPLKQMELADAYYTNMRFRSLQENGGCGTITVKENKRRNKGKGKTPDAETAPAKDASESLADSFMDTVRKLQLNNKAQEGEAAVLSKDGYRSSKEKIPLSAGGSSCGTNMGLDGDPVAISKASGTSRYVGKGGGSTGSSSSNNKQSKKTSKFLRARLGDNSLATLDFSHPDVSPERPVRETQVLQTGLPVRSVWKNGAAQKLFSSNGKK。

[0044] Functional verification of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to stripe rust

[0045] The function of E3 ubiquitin ligase RFEL1 gene in wheat stripe rust resistance was verified by BSMV-VIGS and transgenic overexpression.

[0046] The function of the RFEL1 gene was verified by the VIGS experiment. First, a 140bp sequence (SEQ ID NO.7) was reversely constructed into the barley mosaic virus RNAγ chain using primers RFEL1-VIGS (SEQ ID NO.5 and SEQ ID NO.6) to form the recombinant plasmid BSMV:RFEL1. Then, the RFEL1 fragment was introduced into wheat leaves through barley stripe mosaic virus. When wheat had one leaf and one heart, the recombinant virus vector BSMV:RFEL1 and the control virus vector BSMV:GFP were friction-inoculated on the second leaf of 15 PI428322 plants, respectively.

[0047] SEQ ID NO.5:

[0048] GATTCTTCTTCCGTTGCTAGCGACTTTCTTGTAGTGTATGTGACAA;

[0049] SEQ ID NO.6:

[0050] TTTTTTTTTTTTTAGCTAGCAAGATTACACATGTATAACCTATGC;

[0051] SEQ ID NO.7:

[0052] GACTTTCTTGTAGTGTATGTGACAAAGCTGAGGACCAGGTTGGTCAGGCAGCACAA GCAAAGCGCCGAAGCAGGTTCAAGAGCATTGATCAGCTAAAGGGACATTTGTTCCATCA GCATAGGTTATACATGTGTAATCTT.

[0053] On the 14th day after friction inoculation with the virus, the 4th slice was taken to extract RNA and detect the silencing efficiency of the RFEL1 gene. The successfully silenced plants were inoculated with stripe rust fungus CYR34 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University). The disease resistance phenotype was observed 14 days after inoculation, and the fungal biomass was determined. The specific method for determining the fungal biomass was to take the infected leaves 14 days after inoculation, extract DNA, and perform qRT-PCR (amplification primers: TaEF1a FP: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO.8), RP1: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO.9); PsEF1 FP: 5'-TTCGCCGTCCGTGATATGAGACAA-3' (SEQ ID NO.10), RP2: 5'-ATGCGTATCATGGTGGTGGAGTGA-3' (SEQ ID NO.11). Amplification procedure: 95°C pre-denaturation for 30s; 95°C denaturation for 10s, 60°C annealing for 20s, 72°C extension for 20s, and 40 cycles. The reaction system was 10 μL, and its components were 1 μL genomic DNA, 10 μM primer TaEF1a 0.2 μL each of FP, RP1, PsEF1 FP and RP2, 5 μL Taq SYBR·@Green qPCRpremix (Lambolide) and 3.6 μL ddH2O), and the biomass of stripe rust was determined by the relative value of stripe rust elongation factor (PsEF1) and wheat elongation factor (TaEF1a). The results showed that transient silencing of the RFEL1 gene in PI428322 reduced the resistance of PI428322 to PstCYR34 ( Figure 1 ).

[0054] The present invention further transfers the RFEL1 gene into the common susceptible wheat Fielder (derived from the Crop Genomics and Molecular Breeding Center Laboratory of the College of Agriculture of Henan Agricultural University). First, primers are designed according to the full-length CDS sequence of RFEL1, and the cDNA of PI428322 is used as a template. The full-length CDS sequence of RFEL1 (SEQ ID NO.3) is obtained by PCR amplification, and it is connected to the pCAMBIA1305 vector with a GFP tag initiated by the UBI promoter. Then, the RFEL1-GFP fusion vector is used as a template to design specific primers upstream primer SEQ ID NO.12 and downstream primer SEQ ID NO.13, which are constructed into the overexpression vector pLH5.

[0055] SEQ ID NO.12:

[0056] TTTCAAAGGCGTCTGGCACT;

[0057] SEQ ID NO.13:

[0058] TGTAGCCAATGAGTTGTCACC.

[0059] The pLH5 overexpression vector containing RFEL1-GFP fusion protein was introduced into common wheat Fielder by Agrobacterium-mediated method to obtain stable transgenic plants. The presence of RFEL1 gene in transgenic plants was verified by qRT-PCR (the reaction procedure was 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 60℃ annealing for 20s, 72℃ extension for 20s, and 40 cycles. The reaction system was 10μL, and its components were 1μL cDNA, 0.2μL 10μM upstream primer, 0.2μL 10μM downstream primer, 5μL Taq SYBR·@Green qPCR premix (Lambolide) and 3.6μL ddH2O). Two stable T2 positive transgenic lines and the control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, and inoculated with stripe rust CYR34. After 14 days, the disease resistance phenotype and stripe rust biomass were observed. The results showed that RFEL1 transgenic plants enhanced Fielder's resistance to stripe rust CYR34 ( Figure 2 ).

[0060] In order to verify the function of E3 ubiquitin ligase RFEL1 gene in wheat resistance to multiple physiological subspecies of stripe rust, T2 positive transgenic lines and control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, inoculated with stripe rust CYR17, CYR32 and CYR33, and the disease resistance phenotype was observed after 14 days. The results showed that RFEL1 transgenic plants enhanced the resistance of Fielder to stripe rust CYR17, CYR32 and CYR33 ( Figure 3 ).

[0061] Example 3 Role of E3 ubiquitin ligase RFEL1 gene in broad-spectrum disease resistance in wheat

[0062] In order to verify the role of the E3 ubiquitin ligase RFEL1 gene in the broad-spectrum disease resistance of wheat, RFEL1 transgenic plants were inoculated with powdery mildew E09 (from the Laboratory of Crop Genomics and Molecular Breeding Center, College of Agriculture, Henan Agricultural University) and leaf rust Pt23a (from Zheng Wenming Laboratory, College of Life Sciences, Henan Agricultural University) for disease resistance phenotype identification.

[0063] In order to verify the role of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to powdery mildew, two stable T2 positive transgenic lines and the control Fielder were planted in a greenhouse, with 16h light and 8h dark, cultured at 22℃ for 10 days, inoculated with powdery mildew E09, and samples were taken 48 hours after inoculation. The mycelial growth and development were observed using Coomassie brilliant blue dye, cell death was observed using trypan blue dye, and hydrogen peroxide accumulation was observed using DAB dye. The results showed that compared with the wild-type Fielder, mycelial growth on RFEL1 transgenic plants was slower, showing more cell death and more hydrogen peroxide accumulation. Phenotypic observations were performed 7 days after inoculation, and the results showed that RFEL1 transgenic plants had fewer spores on the leaf surface and were more resistant to disease ( Figure 4 ).

[0064] In order to verify the role of the E3 ubiquitin ligase RFEL1 gene in wheat resistance to powdery mildew, two stable T2 positive transgenic lines and the control Fielder were planted in a greenhouse with 16h light and 8h dark, cultured at 22℃ for 10 days, inoculated with leaf rust Pt23a, and leaf rust biomass and phenotypic observation were performed 14 days later. The results showed that compared with the wild-type Fielder, the RFEL1 transgenic plants had stronger resistance to leaf rust Pt23a ( Figure 5 ).

[0065] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Wheat E3 ubiquitin ligase gene RFEL1, characterized in that The nucleotide sequence of the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.

3.

2. The use of the wheat E3 ubiquitin ligase gene RFEL1 or its related biomaterials according to claim 1, characterized in that: Including any of the following applications A1-A3: A1. Improve wheat's resistance to stripe rust; A2. Improve wheat's resistance to powdery mildew; A3. Improve wheat resistance to leaf rust.

3. The use according to claim 2, characterized in that: The relevant biological material includes any one of the following B1-B5: B1, the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1; B2, an expression cassette comprising the wheat E3 ubiquitin ligase gene RFEL1; B3, a recombinant vector comprising the wheat E3 ubiquitin ligase gene RFEL1; B4, a recombinant microorganism comprising the wheat E3 ubiquitin ligase gene RFEL1; B5. Transgenic material comprising the wheat E3 ubiquitin ligase gene RFEL1.

4. The use according to claim 3, characterized in that: The amino acid sequence of the protein encoded by the wheat E3 ubiquitin ligase gene RFEL1 is shown in SEQ ID NO.

4.

5. Use of a functional product for increasing the expression level of the wheat E3 ubiquitin ligase gene RFEL1 according to claim 1 in improving resistance to wheat stripe rust, wheat powdery mildew and wheat leaf rust, characterized in that: The functional product includes a gene RFEL1 overexpression vector.

6. A method for improving wheat resistance to stripe rust, powdery mildew and leaf rust, characterized in that: The following steps are involved: S1. Constructing an overexpression vector using the wheat E3 ubiquitin ligase gene RFEL1 described in claim 1 as a target gene; S2, transforming the constructed overexpression vector into wheat; S3. Screen and obtain positive transgenic wheat.

Images