High-yield tetraacetyl phytosphingosine strain and application thereof

Abstract

The invention provides a high-yield tetraacetyl phytosphingosine strain and application thereof, and belongs to the technical field of biology. Wild Wickerhamomyces ciferrii RK01 which is separated from rotten wood in a mountain forest in Yunnan China for the first time is used as an original strain, ascospores are generated by the original strain, so that a haploid strain with better tetra-acetyl phytosphingosine (TAPS) production performance is obtained through separation, and a mutant strain W. ciferrii CG223 with high yield of TAPS is obtained by performing multiple rounds of ARTP iterative mutagenesis on the haploid strain. The strain can produce 4.02 g / LTAPS after being cultured for 72 hours under a batch shake-flask culture condition, which is 11.82 times that of a wild strain, and can produce 47.3 g / LTAPS after being cultured for 96 hours in a 20L fermentation tank, so that the yield of TAPS is remarkably increased, and large-scale production of TAPS is facilitated.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a haploid strain of Wickham's yeast capable of producing high amounts of tetraacetyl phytosphingosine, a screening method and an application thereof. Background Art

[0002] Sphingolipids are a class of complex lipid molecules that are widely present in cell membranes and play an important role in cell signaling, cell-cell interactions, and membrane stability. Ceramides are an important subclass of sphingolipids and play a key role in maintaining skin barrier function and cell signaling.

[0003] Ceramide is composed of long-chain bases and fatty acids. It forms an orderly layered structure with cholesterol and free fatty acids in the stratum corneum, effectively reducing transepidermal water loss, thereby maintaining skin hydration. In addition, ceramide participates in the regulation of keratinocyte proliferation, differentiation and apoptosis, thereby maintaining the dynamic balance of the skin barrier. With age, the content of ceramide in the skin gradually decreases, resulting in weakened skin barrier function, increased water loss, and dry and rough skin. Therefore, exogenous supplementation of ceramide can improve the hydration state and barrier function of the skin, thereby achieving an anti-aging effect.

[0004] Tetraacetylphytosphingosine (TAPS) is a precursor of ceramide synthesis, which can be converted into phytosphingosine (which has the same structure as the precursor of ceramide synthesis in human skin) through deacetylation. Studies have also found that TAPS is a natural raw material for skin care products, with moisturizing, anti-oxidation, whitening and anti-freckle effects, and is effective in promoting the self-repair of the skin barrier; TAPS has the effect of inhibiting inflammation and is a potential topical drug for the treatment of chronic inflammatory skin diseases.

[0005] In nature, phytosphingosine exists in certain plants and microorganisms, such as oats, wheat, rice and other plants, as well as in specific yeasts. However, the natural content of phytosphingosine is extremely low, and it is difficult to meet industrial needs by direct extraction. At present, phytosphingosine is mainly produced by three methods: chemical synthesis, plant extraction and biosynthesis. The chemical synthesis method is not conducive to large-scale production due to its complex process, harsh reaction conditions, high cost and serious environmental pollution. The plant extraction method is limited by the supply of raw materials and extraction process, with low yield and poor stability, which is difficult to meet market demand. Biosynthesis mainly uses Wickerhamomyces ciferrii as a production strain to directly produce acetylated TAPS, and then obtains phytosphingosine after extraction and deacetylation. This method has the advantages of low cost and mild reaction, which is in line with the trend of green development. However, the existing Wickerhamomyces ciferrii strains still cannot meet the needs of industrial production in terms of TAPS production, which limits its application prospects. Therefore, it is urgent to optimize it through genetic modification and mutagenesis technology to increase TAPS production and achieve large-scale production. Summary of the invention

[0006] The purpose of the present invention is to provide a haploid strain of Wickham's yeast with high production of tetraacetylphytosphingosine (TAPS), which is obtained by selecting and breeding the original strain through haploid separation and mutagenesis techniques, and can achieve a higher level of tetraacetylphytosphingosine (TAPS) production, providing a better production bacterium for industrial production.

[0007] The present invention provides a wild Wickerhamomyces ciferrii RK01, which has a deposit number of CCTCC M 20241945. It is deposited in China Center for Type Culture Collection, deposit address: Wuhan University, Wuhan, China, deposit date 2024-09-09

[0008] The present invention also provides a mutant Wickerhamomyces ciferrii CG223, which has a deposit number of CCTCC M 20242551. It is deposited in China Center for Type Culture Collection, deposit address: Wuhan University, Wuhan, China, deposit date 2024-11-13

[0009] The present invention also provides the use of the wild Wickerhamomyces ciferrii RK01 or the mutant Wickerhamomyces ciferrii CG223 in the fermentation production of tetraacetylphytosphingosine (TAPS).

[0010] The present invention also provides a method for producing tetraacetyl phytosphingosine (TAPS) by fermentation, the method comprising the following steps: inoculating the wild Wickerhamomyces ciferrii RK01 or the mutant Wickerhamomyces ciferrii CG223 into a seed culture medium for seed culture, and waiting for the absorbance value of the seed solution to reach OD 600 At 8-12 o'clock, inoculate 6%-10% of the inoculum into the fermentation medium for fermentation, and collect the fermentation liquid after the fermentation is completed.

[0011] Furthermore, the seed culture medium is YPD liquid culture medium.

[0012] Furthermore, the timing and amount of inoculation are as follows: when the absorbance value of the seed solution is OD 600 At 10 o'clock, inoculate at 8%.

[0013] Furthermore, the fermentation is shake flask fermentation, the fermentation medium is YM medium, the fermentation temperature is 28-32°C, preferably 30°C, the rotation speed is 180-220rpm, preferably 200rpm, and the time is 2-5, preferably 3-4 days.

[0014] Furthermore, the YM medium includes the following ingredients: 5 g / L casein peptone, 3 g / L malt extract powder, 50 g / L glycerol, and 3 g / L yeast extract.

[0015] Furthermore, the fermentation is fermentation in a fermenter, and the fermentation medium comprises the following components: 45-55 g / L glycerol, 2-4 g / L yeast extract, 2-4 g / L malt extract, 2-4 g / L MgSO4·7H2O, 2-4 g / L CaCO3, 0.5-2 g / L KHPO4, 0.5-2 g / L serine, and 0.1-1 g / L defoaming agent; the culture conditions are: temperature 28-32°C, pH 5.0-6.0 automatically controlled by ammonia water, ventilation ratio 0.8-1.2 vvm, dissolved oxygen controlled ≥ 28%, and feeding started when the initial glycerol was lower than 30 g / L, and the glycerol concentration was controlled at 28-42 g / L during the process.

[0016] Furthermore, the fermentation medium contains the following ingredients: 50 g / L glycerol, 3 g / L yeast extract, 3 g / L malt extract, 3 g / L MgSO4·7H2O, 3 g / L CaCO3, 1 g / L KHPO4, 1 g / L serine, and 0.3 g / L defoaming agent.

[0017] Furthermore, the culture conditions are: temperature 30°C, pH 5.6 automatically controlled by ammonia water, ventilation ratio 1vvm, dissolved oxygen controlled ≥30%, feeding started when the initial glycerol was lower than 30g / L, and the glycerol concentration was controlled at 30-40g / L during the process.

[0018] Furthermore, after the fermentation is completed, the method further comprises the following steps: mixing the fermentation liquid with methanol, extracting, centrifuging, and taking the supernatant.

[0019] The present invention also provides a spore production culture medium, which comprises the following components: 42.7 g / L malt extract, 5 g / L sodium acetate, 2 g / L yeast extract, 2 g / L glucose and 20 g / L agar.

[0020] The present invention also provides application of the spore-producing culture medium for obtaining a haploid strain of wild Wickerhamomyces ciferrii RK01.

[0021] The present invention also provides a spore production method of wild Wickerhamomyces ciferrii RK01, which specifically comprises diluting and coating the diploid on a spore production medium, culturing for four days at 25-30°C, and then placing the culture medium at 15-20°C for at least two days. The ascospore production rate can reach 10-50%.

[0022] The invention also provides a fermentation formula for producing TAPS by using Wickham yeast.

[0023] The present invention also provides a high-throughput comprehensive screening scheme for high-yield TAPS strains. Specifically, the strains are mutated by atmospheric plasma mutagenesis (ATP), and then coated on YPDG series plates using high concentration EGTA to precipitate Ca 2+ The ions were chelated to preliminarily screen out mutants with better performance in the sphingosine synthesis pathway, and the mutant library was then subjected to high-throughput testing and screening using the Tecan Fluent 1080 automation platform and Agilent RapidFire 400.

[0024] The present invention has achieved the following beneficial effects:

[0025] The invention uses the wild Wickerhamomyces ciferrii RK01 (currently preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC M 20241945) firstly isolated from rotten wood in the mountains of Yunnan, China as a starting strain, and separates a haploid strain with better TAPS production performance by making it produce ascospores, and performs multiple rounds of ARTP iterative mutagenesis on the haploid strain to obtain a mutant strain W. ciferrii CG223 with high TAPS production. The strain can produce 4.02 g / LTAPS under batch shake flask culture conditions for 72 hours, which is 11.82 times that of the wild strain, and can produce 47.3 g / LTAPS under 20L fermenter culture for 96 hours, which significantly increases the TAPS production and is conducive to the large-scale production of TAPS.

[0026] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0027] The above contents of the present invention are further described in detail below through specific implementation methods in the form of examples. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the plate morphology of Wickerhamomyces ciferrii RK01.

[0029] Figure 2 This is the microscopic morphology of Wickerhamomyces ciferrii RK01.

[0030] Figure 3 Stained micrographs of Wickerhamomyces ciferrii cultured on MA sporulation medium (A) and MA4 sporulation medium (B).

[0031] Figure 4 TAPS yield from 320 L tank fed-batch fermentation of W. ciferrii CG22. DETAILED DESCRIPTION

[0032] The raw materials and equipment used in the present invention are all known products, which are obtained by purchasing commercially available products.

[0033] Example 1. Isolation and identification of Wickerhamomyces ciferriiRK01

[0034] A strain was isolated from a sample of rotten wood in a mountain forest in Yunnan, China. After being cultured at 30°C for 3 days on YPD solid plates (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar powder), the colonies of the strain were white to cream-colored, convex, with a smooth and soft surface and complete edges. After being cultured at 30°C for 2 days in YPD liquid (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose), the cells were oval or ellipsoidal under a microscope (100X), and budded individually or in pairs.

[0035] The strain was subjected to polymerase chain reaction (PCR) amplification using the fungal ITS identification primers ITS1 (sequence ID number: 1) and ITS4 (sequence ID number: 2) to obtain the ITS sequence of the strain. The reaction composition used to amplify the nucleotide sequence was a small amount of bacteria, 10 pmol ITS1 (1.5 μL), 10 pmol ITS4 (1.5 μL), KOD OneTM PCR MasterMix (TOYOBO, 25 μL), and distilled water (22 μL). PCR was performed under the following conditions: denaturation at 98°C for 8 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 52°C for 10 seconds, and polymerization at 72°C for 10 seconds; and additional reaction at 72°C for 10 minutes.

[0036] The amplified sequence was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for DNA sequencing to obtain an ITS sequence with a sequence ID number of 3, which is 594 bases long. The obtained sequence was compared and analyzed by the local sequence alignment search basic tool (BLAST) program provided by the National Center for Biotechnology Information (NCBI), confirming that the sequence had an ITS sequence homology of up to 99% with Wickerhamomyces ciferrii. It was proved that the strain isolated above was Wickerhamomyces ciferrii, named Wickerhamomyces ciferrii RK01, and it was also the first time that this type of strain was isolated in Yunnan, China. The Wickerhamomyces ciferrii RK01 strain was deposited in the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan City, Hubei Province, with a deposit date of September 9, 2024, and a deposit number of CCTCC M 20241945.

[0037] Example 2: Method for producing TAPS by fermentation using wild Wickerhamomyces ciferrii RK01

[0038] Wickerhamomyces ciferrii RK01 was streaked and isolated, and a single colony was picked and inoculated into a test tube containing YPD liquid medium for seed culture. 600 When the temperature reached 10, the inoculation amount was 8% inoculated into a 250 mL shake flask containing 25 mL fermentation medium (YM medium: 5 g / L casein peptone, 3 g / L malt extract, 50 g / L glycerol, 3 g / L yeast extract) for fermentation. The fermentation conditions were 30°C, 200 rpm, and 3 days. After the fermentation was completed, the fermentation liquid was collected.

[0039] 1 mL of fermentation broth was mixed with 4 mL of methanol, extracted at 30°C and 200 rpm for two hours, and then the supernatant was centrifuged for high performance liquid chromatography (HPLC) detection. The test results showed that the fermentation broth of Wickerhamomyces ciferrii RK01 contained 0.34 g / LTAPS.

[0040] Example 3. Preparation of mutant strain W. ciferrii CG223 and method for fermenting TAPS using mutant strain W. ciferrii CG223

[0041] 1. Obtaining haploid strains

[0042] 1. Screening of sporulation medium

[0043] Wickerhamomyces ciferrii RK01 was inoculated into YPD liquid (yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L) medium for cultivation. 600 Take it out when the concentration is 1. Dilute the bacterial solution to 10 with physiological saline. -5, 100 μL was spread on MA medium (malt extract 50 g / L, agar powder 20 g / L), WCCB medium (sodium acetate 7.6 g / L, potassium chloride 17.4 g / L, magnesium sulfate 0.18 g / L, glucose 0.9 g / L, agar powder 20 g / L), McClary medium (glucose 1 g / L, potassium chloride 1.8 g / L, sodium acetate 8.2 g / L, yeast extract 2.5 g / L, agar powder 20 g / L), SPM medium (glucose 1g / L, potassium chloride 10g / L, potassium dihydrogen phosphate 0.68g / L, yeast extract 2.5g / L, agar powder 20g / L), YD medium (tryptone 2.5g / L, glucose 0.625g / L, sodium acetate 5g / L, agar powder 20g / L) and Kleyn medium (peptone 2.5g / L, glucose 0.62g / L, sodium chloride 0.62g / L, sodium acetate 5g / L, agar 20g / L) and placed in a 26°C constant temperature incubator for culture. Every three days, the grown single colonies were stained (carbolic acid fuchsin and Lu's methylene blue staining method) to observe and record the spore production rate. The specific results are shown in Table 1. MA and WCCB medium have spore production potential, so the colonies on these two mediums were continuously stained and observed, and the results are shown in Table 2. It can be seen from Table 2 that the spore production effect of MA is better than that of WCCB spore production medium. Subsequently, the MA medium and culture conditions were optimized to obtain MA4 medium (malt extract 42.7 g / L, sodium acetate 5 g / L, yeast extract 2 g / L, glucose 2 g / L, agar 20 g / L). The spore production results are shown in Table 3 and Attached Figure 3 The culture conditions are to culture at 25℃-30℃ for four days, and then place it in 15-20℃ for at least two days. The spore production rate can reach up to 50%.

[0044] Table 1 Observation on preselection of spore-forming culture medium

[0045]

[0046] Table 2 Spore production of MA and WCCB spore production medium

[0047]

[0048] Table 3 Spore production of MA and MA4 spore production medium

[0049]

[0050] 2. Cell disassembly

[0051] Take a sterile 2mL EP tube, pick up an appropriate amount of bacteria and add the sterilized enzymatic solution (3% snail enzyme, 0.33% lytic enzyme) and 1 / 3 tube of sterile 1mm glass beads, vortex shake for 1min, and treat at 37℃ shaker 220rpm for 1.5h. After the treatment, centrifuge the bacterial solution at 7000rpm for 1min, discard the supernatant, add an equal amount of sterile water to resuspend, and put it in a 60℃ water bath for inactivation for 100s. Spread the inactivated bacterial solution on YPD solid culture plates (yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 20g / L) at 100μL / plate, and culture at 30℃ until the colonies grow to a suitable size.

[0052] 3. Haploid identification

[0053] Pick the single colony grown on the culture dish in step 2, spot it on the MA4 solid culture plate, and perform spore culture and staining identification according to the method described in "1. Screening of spore culture medium". The strain that did not produce spores in two spore verifications is haploid. A total of 50 haploid strains were obtained.

[0054] 2. Screening of high-yield TAPS haploid strains

[0055] The 50 haploid strains obtained in the previous step were streaked and isolated, and single colonies were picked and inoculated into test tubes containing YPD liquid culture medium for seed culture. Then, the TAPS fermentation performance test of the haploids was performed under the fermentation conditions of Example 2.

[0056] The results are shown in Table 4 (strain number CG01-50).

[0057] Table 4 Haploid TAPS fermentation performance test

[0058]

[0059] The TAPS titer of strain W. ciferrii CG38 was 1.68 g / L, which was 4.94 times that of the wild-type W. ciferrii RK01.

[0060] ARTP mutagenesis and high-throughput screening of W. ciferrii CG38

[0061] 1. ARTP mutagenesis

[0062] Take a sterile 2 mL EP tube and inoculate the W. ciferrii CG38 strain obtained in the previous step into a test tube containing YPD liquid medium for cultivation. 600在When the temperature was 0.6-1, 15 μL of bacterial solution was taken on the mutagenesis slide, and after ensuring uniform tiling, it was moved into the corresponding well of the ARTP mutagenesis breeding instrument (Tianmu Biotechnology Co., Ltd.) and a 2mL EP tube containing 500 μL of saline (0.9% NaCl) was placed on the collection rack below. The instrument power was set to 120W, the gas flow rate was 10.0SLM, and the treatment time was 0s, 30s, 60s, 90s, 120s and 150s. After the mutagenesis, the EP tube was tightly covered, and a metal bath was used at 30°C and 600rpm for 30min to elute the bacteria and 100 μL / plate was applied to the YPD solid plate, placed in a constant temperature environment at 30°C to wait for the bacteria to grow and record the number of colonies.

[0063] The mutagenesis results are shown in Table 5 , and the number of mutant libraries was moderate at 90 s.

[0064] Table 5 Correspondence between mutagenesis time and mutation library size

[0065] Mutagenesis time / s Number of mutation libraries 0 106 30 104 60 600±10 90 120±10 120 27±2 150 14±2

[0066] 2. ARTP mutagenesis and high-throughput screening of W. ciferrii CG38

[0067] W. ciferrii CG38 was subjected to ARTP mutagenesis for 90 s and then plated on YPDG1 solid plates (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar, 2 mM EGTA (for chelating Ca 2+ ions) for cultivation. After a single colony grows on the plate, use the Tecan Fluent1080 automation platform to automatically pick the 50 largest colonies into a 96-deep-well plate (1.5 mL specification) containing 600 μL YPD culture medium based on the colony size as the screening standard; after the picking work is completed, seal the well plate and transfer it to a well plate shaker, and culture it at 30°C and 800 rpm for 1 day. After the cultivation is completed, 100 μL of the bacterial solution is transferred to a 96-deep-well plate (1.5 mL specification) containing 600 μL of the fermentation medium described in Example 2, and ferment it at 30°C and 800 rpm for 3 days. After the fermentation is completed, 200 μL of the fermentation broth is transferred to a 96-deep-well plate (1.5 mL specification) containing 800 μL of methanol and shaken for extraction for two hours. After the extraction, centrifuge at 4000 rpm for 10 min; then transfer 200 μL of supernatant to a 96-well plate and perform high-throughput detection using Agilent RapidFire 400 (high-throughput fully automatic mass spectrometry sample pretreatment system). The method parameters are shown in Table 6.

[0068] Table 6 Agilent RapidFire 400 TAPS detection method

[0069]

[0070]

[0071] The strain with the highest TAPS production in each well plate was screened out according to the detection results of Agilent RapidFire 400, streaked and separated on a YPD plate, and a single colony was picked and the fermentation performance of the strain was tested at the shake flask level according to the fermentation conditions of Example 2. The results are shown in Table 7. Among them, the strain W. ciferrii CG73 had the highest TAPS titer of 2.14 g / L.

[0072] Table 7 Results of the first round of mutagenesis (strain number CG51-100).

[0073]

[0074] 3. ARTP mutagenesis and high-throughput screening of W. ciferrii CG73

[0075] According to the scheme for ARTP mutagenesis of W.ciferrii CG38, the high-yield strain W.ciferrii CG73 obtained in the previous step was subjected to a second round of ARTP iterative mutagenesis, with a mutagenesis time of 90s, and then coated on a YPDG2 solid plate (yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 20g / L, 2.5mM EGTA) for culture. After that, according to the scheme for screening W.ciferrii CG38, preliminary screening was performed on a 96-well plate and secondary fermentation screening was performed in a shake flask. The results are shown in Table 8. Among them, the strain W.ciferrii CG106 had the highest TAPS titer of 3.02g / L.

[0076] Table 8 Results of the second round of iterative mutagenesis screening (strain number CG101-150)

[0077]

[0078]

[0079] 4. ARTP mutagenesis and high-throughput screening of W. ciferrii CG106

[0080] According to the ARTP mutagenesis scheme for W.ciferrii CG38, the high-yield strain W.ciferrii CG106 obtained in the previous step was subjected to the third round of ARTP iterative mutagenesis, with a mutagenesis time of 90s, and then coated on YPDG3 solid plates (yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 20g / L, 3mM EGTA) for culture. After that, according to the screening scheme for W.ciferrii CG38, preliminary screening was performed on 96-well plates and secondary fermentation screening was performed on shake flasks. The results are shown in Table 9. Among them, the strain W.ciferrii CG191 had the highest TAPS titer of 3.44g / L.

[0081] Table 9 Results of the third round of mutagenesis (strain number CG151-200).

[0082]

[0083] 5. ARTP mutagenesis and high-throughput screening of W. ciferrii CG191

[0084] Take a sterile 2mL EP tube and perform the fourth round of ARTP iterative mutagenesis on the high-yield strain W.ciferrii CG191 obtained in the previous step according to the ARTP mutagenesis scheme for W.ciferrii CG38. The mutagenesis time is 90s, and then spread on YPDG4 solid plates (yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 20g / L, 3.5mM EGTA) for culture. Then, according to the screening scheme for W.ciferrii CG38, preliminary screening was performed on 96-well plates and secondary fermentation screening was performed on shake flasks. The results are shown in Table 10. Among them, the TAPS titer of strain W.ciferrii CG223 was the highest, at 4.02g / L.

[0085] Table 10 Fourth round of mutagenesis results (strain number CG201-250)

[0086]

[0087] Example 4: Method for producing TAPS by fed-batch fermentation using mutant strain W. ciferrii CG223 (5 L fermenter)

[0088] The high-yield strain W. ciferrii CG223 obtained in Example 3 was used for batch fermentation in a 5 L tank. The W. ciferrii CG223 single clone was inoculated into 200 mL YPD liquid culture medium for seed culture. 600At 10 o'clock, the inoculation amount was 8% and inoculated into a 5L fermentation tank containing 2L fermentation medium. The medium was 50g / L glycerol, 3g / L yeast extract, 3g / L malt extract, 3g / L MgSO4·7H2O, 3 g / L CaCO3, 1 g / L KHPO4, 1g / L serine, and 0.3g / L defoamer. The culture conditions were 30℃, pH was automatically controlled at 5.6 with ammonia water, the ventilation ratio was 1vvm, and the dissolved oxygen was controlled to be ≥30% by adjusting the speed; when the initial glycerol was lower than 30g / L, feeding was started, and the glycerol concentration was controlled at 30-40g / L during the process. During the fermentation process, 1mL of fermentation broth was taken at appropriate times and mixed with 4mL of methanol. After extraction for two hours at 30℃ and 200rpm, the supernatant was centrifuged and tested by high performance liquid chromatography (HPLC). The final fermentation time was 96h, and the TAPS titer reached 47.3g / L. The results are shown in Figure 4 .

[0089] In summary, the present invention uses the wild Wickerhamomyces ciferrii RK01 (currently preserved in the China Center for Type Culture Collection (CCTCC), with a preservation number of CCTCC M 20241945) first isolated from a mountain forest in Yunnan, China as a starting strain, and separates a haploid strain with better TAPS production performance by making it produce ascospores, and performs multiple rounds of ARTP iterative mutagenesis on the haploid strain to obtain a high-yield TAPS mutant strain W. ciferrii CG223 (currently preserved in the China Center for Type Culture Collection (CCTCC), with a preservation number of CCTCC M20242551). The strain can produce 4.02 g / LTAPS under batch shake flask culture conditions for 72 hours, which is 11.82 times that of the wild strain, and can produce 47.3 g / LTAPS after 96 hours of culture in a 20L fermenter, which significantly increases the TAPS yield and is conducive to the large-scale production of TAPS.

[0090] The results of Wickerhamomyces ciferrii RK01 sequencing are as follows:

[0091] Sequence ID1: ITS1

[0092] Artificial sequence

[0093] Primer 1

[0094] TCCGTAGGTGAACCTGCGG.

[0095] Sequence ID2: ITS4

[0096] Artificial sequence

[0097] Primer 2

[0098] TCCTCCGCTTATTGATATGC.

[0099] Sequence ID 3: ITS sequence

[0100] Artificial sequence

[0101] NNNNNNNNNNNNCNNTTGNNNCGCTTATTGCGCGGCGATAAACCTTAC

[0102] ACACACTGTTTATTCTTTATGAACTTTGCTTTGGGTTGAGCCTAGCTTAG

[0103] CCCAGAGGTTATAAACACATTATTTTTCTAATGTTTTAAACAATTAAACC

[0104] TTTAGTCATGAAATTTTTTATAAAATAAAAATCTTCAAAACTTTCAACAA

[0105] CGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATAT

[0106] GTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACAT

[0107] TGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTC

[0108] TCTCAAACCTTTGGGTTTGGTATTGAGTGATACTCTGTCATATGGGTTAA

[0109] CTTGAAATATTGAACAGCAAGAGTGTATTTGTTAGTACTCCTTCTGAAAT

[0110] AATGTATTAGGTTCTTCCAACTCGTTATATCAGTTAGGCAGTTGCTTCGG

[0111] ATATTTTAGGCTCGGCTTAATAACAATAACATAAAGTTTGACCTCAAATC

[0112] AGGTAGGATTACCCGCTGAACTTAAGCATATNNNNNNNNNGGAGGAAA。

Claims

1. A wild Wickerhamomyces ciferrii RK01, whose deposit number is CCTCC M 20241945.

2. A mutant Wickerhamomyces ciferrii CG223, whose deposit number is CCTCC M 20242551.

3. Use of the wild Wickerhamomyces ciferrii RK01 according to claim 1 or the mutant Wickerhamomyces ciferrii CG223 according to claim 2 in the fermentation production of tetraacetylphytosphingosine.

4. A method for producing tetraacetyl phytosphingosine by fermentation, characterized in that: The method comprises the following steps: inoculating the wild Wickerhamomyces ciferrii RK01 described in claim 1 or the mutant Wickerhamomyces ciferrii CG223 described in claim 2 into a seed culture medium for seed culture, and waiting for the absorbance value of the seed liquid to reach OD 600 At 8-12 o'clock, inoculate 6%-10% of the inoculum into the fermentation medium for fermentation, and collect the fermentation liquid after the fermentation is completed.

5. The method according to claim 4, characterized in that The seed culture medium is YPD liquid culture medium.

6. The method according to claim 4, characterized in that The timing and amount of inoculation are as follows: when the seed solution absorbance value OD 600 At 10 o'clock, inoculate at 8%.

7. The method according to any one of claims 4 to 6, characterized in that: The fermentation is shake flask fermentation, the fermentation medium is YM medium, the fermentation temperature is 28-32°C, preferably 30°C, the rotation speed is 180-220rpm, preferably 200rpm, and the fermentation time is 2-5, preferably 3-4 days.

8. The method according to any one of claims 4 to 6, characterized in that: The fermentation is carried out in a fermentation tank, and the fermentation medium comprises the following components: 45-55 g / L of glycerol, 2-4 g / L of yeast extract, 2-4 g / L of malt extract, 2-4 g / L of MgSO4·7H2O, 2-4 g / L of CaCO3, 0.5-2 g / L of KHPO4, 0.5-2 g / L of serine, and 0.1-1 g / L of defoaming agent; the culture conditions are: temperature of 28-32°C, pH of 5.0-6.0 automatically controlled by ammonia water, aeration ratio of 0.8-1.2 vvm, dissolved oxygen controlled to be ≥28%, feeding starts when the initial glycerol is lower than 30 g / L, and the glycerol concentration is controlled to be 28-42 g / L during the process.

9. A spore production medium comprising the following ingredients: 42.7 g / L malt extract, 5 g / L sodium acetate, 2 g / L yeast extract, 2 g / L glucose, and 20 g / L agar.

10. Use of the spore-producing culture medium according to claim 9 for obtaining the haploid strain of the wild Wickerhamomyces ciferrii RK01 according to claim 1.

Images