Microbial agent, fertilizer and application of microbial agent and fertilizer in prevention and treatment of apple successive cropping obstacles

Abstract

The invention relates to the technical field of agricultural microorganisms, in particular to a microbial agent containing paenibacillus love KF-B6, a compound microbial fertilizer and application of the microbial agent and the compound microbial fertilizer. The KF-B6 Paenibacillus lovuenyuan as well as the microbial agent and the compound microbial fertilizer thereof provided by the invention can promote the formation of soil aggregates, improve soil organic matters, improve soil enzyme activity, effectively improve soil and increase the proportion of soil bacteria and fungi. Therefore, the method can be applied to prevention and treatment of apple continuous cropping obstacles, and the survival rate of field planting of apple seedling stocks and field planting of young trees in a rebuilt orchard is guaranteed. By applying the KF-B6 compound microbial fertilizer and the microbial agent, the survival rate of the M9T337 rootstock seedlings planted in the continuous cropping soil can be increased, the highest survival rate reaches 96.67%, and the seedling roots are high in activity and good in growth vigor. The survival rate of the Daphne red apple seedlings planted in the rebuilding of the continuous cropping obstacle old orchard is as high as 94.00%, and the effect of effectively preventing and controlling the apple continuous cropping obstacle is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms, and in particular to a composite functional bacterium Paenibacillus eihime KF-B6 which has the functions of soil improvement, multi-mechanism efficient biological control, and decomposition of macromolecular organic matter for nutrient conversion, a microbial agent and a composite microbial fertilizer thereof, and applications thereof, in particular, applications in preventing and controlling apple continuous cropping obstacles. Background Art

[0002] With the influence of the overall adjustment of the apple industry structure, the rise of new apple varieties such as Ruixianghong, Ruiyang and Ruixue has driven the apple industry into a new round of development. Therefore, replacing old orchards with new varieties has become a new opportunity. Most orchards in my country's main apple producing areas, especially in Shandong, Shaanxi, Gansu and other regions, have a history of more than 30 years. However, due to limited land resources, the transformation and renewal of old orchards can only choose continuous cropping cultivation, which leads to abnormal root development, dwarfed trees, weak growth, reduced resistance, shortened lifespan, and even death of replanted apple trees. This phenomenon is called apple continuous cropping disorder, also known as apple replanting disease.

[0003] There are many factors that lead to apple continuous cropping problems, mainly the deterioration of soil physical and chemical properties, the destruction of soil aggregate structure, soil compaction, and poor air permeability, which affect the root growth of newly planted saplings; the imbalance of soil flora, the reduction of beneficial bacteria, the limited decomposition of soil organic matter, and the low content of soil organic matter; the increase in the number of pathogenic fungi in the soil, especially Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme. These pathogenic fungi infect the root system, especially the root system of apple seedlings, which is more harmful, and can cause stem rot, rot, etc., resulting in a low survival rate of newly planted saplings when replacing new varieties. Therefore, the apple industry urgently needs to solve the problems of low survival rate and weak growth of apple saplings in the transformation of old orchards, and serious problems of apple continuous cropping problems.

[0004] Chinese patent CN202011124878.8 discloses a strain of Bacillus amyloliquefaciens and its application in preventing and controlling apple continuous cropping problems. The strain has an inhibitory effect on a variety of pathogens, especially on Fusarium oxysporum, Fusarium verticillium, Fusarium laminarum and Fusarium solani, which cause apple continuous cropping problems. The strain can also promote the growth of the aboveground and underground parts of seedlings of apple trees that have been continuously cropped; increase the bacterial content in the soil, increase the bacterial-fungal ratio; and increase the activity of soil urease, phosphatase, sucrase and catalase in the soil of apple continuous cropping, and can be used to prevent and control apple continuous cropping problems. Chinese patent CN202310488273.4 discloses a strain of Paenibacillus polymyxa GRY-11, which has antagonistic effects on Fusarium oxysporum, Fusarium moniliforme, Fusarium solani, and Fusarium solani that cause apple continuous cropping problems; the strain can increase the number of soil bacteria, reduce the number of pathogens, and promote plant growth; increase the soil enzyme activity in apple continuous cropping soil and the protective enzyme activity of apple seedling roots; reduce the content of soil phenolic acid substances; and can effectively alleviate apple continuous cropping problems.

[0005] The above patent mainly prevents and controls the problem of apple continuous cropping by producing water-soluble antibacterial substances to antagonize the growth of pathogenic fungi, increase the bacterial content in the soil, degrade phenolic acid self-toxic substances and increase the activity of soil enzymes. The antibacterial mechanism and antibacterial performance are limited, and it cannot achieve the effect of improving the soil such as increasing the stability of soil structure and increasing the organic matter content.

[0006] Functional strains only produce water-soluble antibacterial substances to inhibit the growth of pathogens. Generally, the inhibition rate is low and the effect is unstable. Therefore, it is the guarantee of preventive effectiveness that the strains have multiple antibacterial mechanisms.

[0007] The soil has a stable structure, is loose, has good air permeability and water retention, and is high in organic matter and humus, which is not only conducive to the reproduction of beneficial microorganisms but also promotes root growth. Therefore, it is crucial to focus on improving the soil in the orchard while preventing and controlling apple continuous cropping problems and pathogenic fungi.

[0008] It is a current research consensus that microorganisms that produce extracellular polysaccharides (EPS) can improve soil, regulate plant growth, and induce plant stress resistance. Therefore, obtaining strains that produce high EPS is an effective way to improve soil. However, the current problem is that the EPS production of general strains is not high or it takes a long time to produce EPS, and the formation of soil water-stable aggregates is slow and the structure is unstable. Therefore, if strains that not only have high EPS production but also produce EPS quickly can be obtained, the effect of improving soil will be greatly improved.

[0009] In summary, it is urgent to screen out functional strains and bacterial agents that have comprehensive and effective effects in preventing and controlling apple continuous cropping disorders. Chinese patent CN202011579100.6 discloses an antimicrobial peptide-producing Paenibacillus eihime HD and its application. The antimicrobial peptide produced by the fermentation method of the present invention has good stability and a broad antimicrobial spectrum. The obtained product is used in biological control fields such as food preservation and antibiotic-free breeding of livestock and poultry. Chinese patent CN201810202641.3 discloses a bacteriocin-producing Paenibacillus eihime strain NPUST-1, which can promote the growth and immune response of aquatic organisms.

[0010] The above inventions all show that Paenibacillus eihime has strong antibacterial properties and can produce antibacterial substances such as antimicrobial peptides and bacteriocins. However, most of the existing technologies are in the field of aquaculture or animal husbandry, and the functions of the disclosed strains are limited. They do not have the ability to produce high-yield EPS, volatile antibacterial substances, and high-yield chitinase to degrade pathogenic fungal hyphae, nor do they have nutritional conversion functions such as decomposing macromolecular organic substances such as cellulose, protein, and starch, and nitrogen fixation and growth promotion functions, and they do not involve the agricultural field. Therefore, there is currently no report on Paenibacillus eihime for preventing and controlling apple continuous cropping obstacles. Summary of the invention

[0011] Therefore, the technical problem to be solved by the present invention is to overcome the defects of the prior art in that the agricultural functional bacteria are limited in function, cannot efficiently inhibit fungal diseases through multiple mechanisms, cannot simultaneously produce high EPS to increase soil water stability aggregates to effectively improve the soil, increase soil organic matter, and do not have nutrient conversion and growth promotion. Thus, a strain of Bacillus Ehime with soil improvement, multi-mechanism efficient biocontrol, growth promotion and nutrient conversion functions and its microbial agent and compound microbial fertilizer are provided for use in preventing and controlling apple continuous cropping disorders.

[0012] To achieve the above object, the present invention provides the following technical solutions: One of the technical solutions provided by the present invention is a Paenibacillus eihime, wherein the Paenibacillus eihime is specifically Paenibacillus eihime ( Paenibacillus ehimensis )KF-B6, the deposit number is CGMCC No.32131.

[0013] The Ehime Bacillus provided by the present invention ( Paenibacillus ehimensis )KF-B6, deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on September 30, 2024. The depository address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0014] The second technical solution provided by the present invention is a method comprising Bacillus erythritolus ( Paenibacillus ehimensis )KF-B6 bacterial agent; Furthermore, the preparation method of the bacterial agent is as follows: inoculating a spore suspension of Paenibacillus eihime KF-B6 into a fermentation medium for producing EPS, culturing until the fermentation liquid is viscous and more than 95% of the spores are detected under a microscope, to obtain a KF-B6 fermentation liquid containing EPS; adding any one or more of a synergist, an osmotic salt system stabilizer, an antifreeze agent, an emulsifier, and a preservative to the fermentation liquid to obtain a bacterial agent containing Paenibacillus eihime KF-B6; More specifically, the preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and place in a water bath at 80°C for 5 min to obtain a spore suspension inoculant. (2) EPS-producing liquid fermentation: The spore suspension is inoculated into the EPS-producing liquid medium A at a rate of 5-10% (v / v), and cultured until the fermentation liquid becomes viscous and more than 95% of the spores are detected under a microscope, thereby obtaining the EPS-containing KF-B6 fermentation liquid; further, the culture conditions are: 35-45°C constant temperature oscillator at 150-200 rpm for 40-48 hours; The liquid culture medium A is composed of: 15.0-25.0 g sucrose, 1.5-2.5 g corn steep liquor powder, 1.5-2.5 g CaCO3, 0.5-1.5 g K2HPO4·3H2O, 0.25-0.75 g MgSO4·7H2O, 0.25-0.75 g MnSO4·H2O, 1 L distilled water, pH 7.0-7.3.

[0015] (3) Preparation of KF-B6 liquid microbial agent: Add 10-15% (w / v) mineral potassium humate (synergist), 3.0-4.5% (w / v) potassium dihydrogen phosphate (osmotic salt system stabilizer), 1.5-3.5% (w / v) pH 7.0 seaweed liquid (synergist), 3.0-5.0% (w / v) ethylene glycol (antifreeze), 1.5-2.5% (w / v) OP-10 (emulsifier), and 0.05-0.1% (w / v) sodium dehydroacetate (preservative) to the KF-B6 fermentation broth containing EPS, and mix thoroughly to obtain the KF-B6 microbial agent.

[0016] Furthermore, the specific indicators of the KF-B6 liquid microbial agent are: KF-B6 effective viable bacteria count> 200 million / mL, extracellular polysaccharide> 3000 μg / mL, pH 5.0-7.0.

[0017] The third technical solution provided by the present invention is a method comprising Ehime Bacillus ( Paenibacillus ehimensis ) KF-B6 compound microbial fertilizer; Furthermore, the preparation method of the composite microbial fertilizer is as follows: inoculating the seed liquid of Paenibacillus erythritol KF-B6 into the fermentation medium, culturing until the spore rate in the fermentation liquid is greater than 95% and the number of effective live bacteria is greater than 600 million / mL to obtain the fermentation liquid; after the KF-B6 fermentation liquid is evenly mixed with the sterilized carrier, the mixture is spread in a constant temperature culture room and ventilated and cultured until the moisture content is less than 10%, thereby obtaining the KF-B6 composite microbial fertilizer; Furthermore, the specific preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and place in a water bath at 80°C for 5 min to obtain a spore suspension inoculant. (2) Seed liquid culture: Inoculate the slant spore suspension into liquid culture medium B at a 5-10% (v / v) inoculation rate, and culture at 35-45°C and 150-200 rpm for 16-20 h to obtain seed liquid; The liquid culture medium B is composed of: 4.0-6.0 g yeast extract powder, 4.0-6.0 g soybean meal powder, 0.50-1.50 g K2HPO4·3H2O, and 0.50-1.50 g MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, distilled water 1L, pH natural.

[0018] (3) Fermentation culture: Inoculate the seed liquid into liquid culture medium C at an inoculation rate of 5-10% (v / v) to obtain a fermentation liquid, wherein the spore rate in the fermentation liquid is >95% and the bacterial activity is >600 million / mL; further, the culture conditions are: constant temperature culture at 35-45°C and 150-200 rpm for 24-32 hours; The liquid culture medium C is composed of: 4.0-6.0 g yeast extract powder, 4.0-6.0 g soybean meal powder, 0.50-1.50 g K2HPO4·3H2O, and 0.50-1.50 g MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural.

[0019] (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 and the sterilized carrier are evenly mixed in a volume-to-mass ratio of 1:2-1:3, the mixture is spread in a 15 cm-20 cm thickness in a constant temperature culture room at 35-45°C and cultured with ventilation for 5-7 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer.

[0020] Furthermore, the carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:1; Furthermore, the specific indicators of KF-B6 powdered compound microbial fertilizer are: organic matter > 40%, total nutrients (N+P2O5+K2O) of 8-10%, moisture < 10%, KF-B6 effective live bacteria count > 300 million / g, pH 7.0-8.5.

[0021] The fourth technical solution provided by the present invention is the application of Paenibacillus erythritol KF-B6 described in the first technical solution, or the bacterial agent described in the second technical solution, or the compound fertilizer described in the third technical solution, especially in the field of agricultural microbial technology, and more particularly in preventing and controlling apple continuous cropping obstacles; Furthermore, the microbial agent described in the second technical solution is used for root soaking of seedlings before planting; further, before planting, the seedlings are root soaked in a 50-150 times diluted solution of KF-B6 liquid microbial agent for 30-60 minutes; Furthermore, after covering the soil during planting, a 150-350 times diluted solution of the bacterial agent described in the second technical solution is used for root irrigation treatment; Furthermore, in the growing season from May to June, the root is irrigated once with a 150-350 times diluted solution of the bacterial agent described in the second technical solution; Furthermore, during land preparation, the compound microbial fertilizer described in the third technical solution is spread in the soil at a rate of 300-450 kg / mu; Furthermore, the compound microbial fertilizer described in the third technical solution is spread in the planting ditch at a dosage of 400-600 kg / mu; Furthermore, when planting, 15-25% of the compound microbial fertilizer described in the third technical solution and 15-25% of soil are added to the 50-150 times diluted solution of the bacterial agent described in the second technical solution to make a slurry, the roots of the seedlings are dipped in the slurry and then the seedlings are planted in the pit; Furthermore, during autumn fertilization, 1.5-3.5 kg of the compound microbial fertilizer described in technical solution 3 is applied to each tree.

[0022] Preferably, the method of use is as follows: (1) Digging planting trenches ① Deep plowing and land preparation: After the fruit is harvested in autumn, old trees are removed, and residual roots and diseased roots are picked out. When plowing the land, KF-B6 powder compound microbial fertilizer is applied in the test plot at a rate of 300kg / mu; ② Digging planting trenches; ③ Spring backfilling of planting trenches: Spread 500kg of KF-B6 compound microbial fertilizer per mu in the planting trenches, mix it with the backfill soil and backfill; (2) Treatment of seedlings before planting For seedlings that have not lost water, soak their roots with 100-fold diluted KF-B6 liquid microbial agent for 30 minutes; (3) Tree planting ① When transplanting, apply 2kg of KF-B6 compound microbial fertilizer to each transplanting pit and mix it evenly with the soil; when transplanting, add 20% (w / v) of KF-B6 powdered compound microbial fertilizer and 20% (w / v) soil to the 100-fold diluted solution of KF-B6 liquid microbial agent to make a slurry, dip the roots of the seedlings in the slurry and then transplant the seedlings into the dug pits.

[0023] ② Covering with soil After covering the soil, use 300 times diluted solution of KF-B6 liquid microbial agent for root irrigation; (4) Management after planting ①Growing season, May-June: Use KF-B6 liquid bacterial agent diluted 300 times to irrigate the roots once; ② Autumn fertilization: 2kg KF-B6 powdered compound microbial fertilizer + 0.5kg trace elements in commercially available Mumei soil for each tree.

[0024] Beneficial effects: 1. The Ehime Paenibacillus KF-B6 provided by the present invention has the performance of rapid and high-yield EPS, increases soil water stability aggregates and reduces soil bulk density to improve soil stability structure and achieve soil improvement effect; produces water-soluble and volatile antibacterial substances, and high-yield chitinase directly degrades chitin in fungal cell walls, making mycelium coarse and deformed, broken, hollow or even completely digested to make pathogens inactive, and multiple biocontrol mechanisms ensure comprehensive biocontrol effects. The bacterium also has the functions of decomposing cellulose, protein, starch, fat and other nutrient conversion functions and growth-promoting functions, and is a composite functional strain. The application of this fungus, its microbial agent and compound microbial fertilizer can effectively increase the number of rhizosphere soil bacteria, reduce the number of pathogenic fungi, increase the ratio of bacteria and fungi, and promote the recovery of the soil microbial ecosystem in apple orchards with continuous cropping problems; increase the proportion of water-stable aggregates, increase the soil organic matter content and increase the soil enzyme activity, and improve the soil; increase the survival rate of planted young trees in the process of updating new varieties in old orchards with continuous cropping problems, promote plant root vitality and plant growth, and comprehensively alleviate and prevent apple continuous cropping problems, meeting the needs of the agricultural industry, especially the apple industry.

[0025] (1) The Paenibacillus erythritol KF-B6 provided by the present invention is a highly safe strain that can quickly produce extracellular polysaccharides (EPS). It can start producing EPS in 6 hours, and the viscosity of the fermentation liquid increases significantly after 16 hours, with the yield reaching 978.41 μg / mL. The maximum yield of 4307.39 μg / mL can be reached after 24 hours. The yield remains stable after 24 hours. It is currently reported to be the fastest and highest EPS producing strain.

[0026] The experimental results of treating sandy loam with EPS-containing fermented bacterial solution showed that after 10 days of inoculation of the sandy loam inoculated with the EPS-containing KF-B6 fermented bacterial solution, the proportion of water-stable aggregates (>0.25 mm) was 21.38%, 5.4 times that of the sterile water treatment group; after 20 days of inoculation, the proportion of water-stable aggregates reached the maximum, 32.97%, 6.6 times that of the sterile water treatment group. The proportion of water-stable aggregates after 30 days of inoculation was not much different from that after 20 days of inoculation, and the aggregate particle size was stable between 0.25-3 mm, indicating that KF-B6 bacteria and the EPS produced by them can quickly promote the formation of soil water-stable aggregates, and the stability is strong.

[0027] (2) Paenibacillus efavirens KF-B6 produces water-soluble antibacterial substances that inhibit the growth of pathogens. The inhibition rates against the pathogenic fungi Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme that cause apple cropping problems are as high as 82.66%, 83.81%, and 78.49%, respectively. At the same time, KF-B6 also produces volatile antibacterial substances, and the inhibition rates against the above three pathogens are 91.11%, 87.78%, and 86.67%, respectively. The antibacterial effect is extremely significant.

[0028] Paenibacillus efavirens KF-B6 is a broad-spectrum biocontrol strain that has good antagonistic effects on other apple disease pathogens such as Alternaria alternata (apple tree rot), Alternaria malariae (apple leaf spot disease), Botrytis cinerea (apple ring rot), and pathogens of vegetables and field crops such as Alternaria solani (tomato early blight), Pyricularia oryzae (rice blast), Acanthopanax spp. (corn leaf blight), and Acanthopanax spp., with an inhibition rate of 59.84%-82.54%.

[0029] (3) Paenibacillus eihime KF-B6 produces chitinase, which has a strong decomposition effect on the hyphae of the three pathogens, degrading their cell walls and causing hyphae breakage, hollowing, and cracking. It can even be destructive to the spores of the pathogens, reducing or losing their activity. Among them, KF-B6 has the strongest decomposition performance on the hyphae of Fusarium oxysporum, and can digest the hyphae of the pathogen at 30℃ and 35℃ to completely inactivate it. Compared with CK, KF-B6 can reduce the activity of Fusarium solani by 200-20000 times and the activity of Fusarium moniliforme by 1300-12000 times. This shows that KF-B6 not only inhibits the growth of the main pathogens of apple continuous cropping obstacles, Fusarium oxysporum, Fusarium solani and Fusarium moniliforme, but also can digest their hyphae and even spores, making them partially or completely inactive, with a significant biocontrol effect.

[0030] Paenibacillus eihime KF-B6 is a high-producing chitinase strain. It can produce 11.51-13.54U / mL of chitinase without the induction of exogenous chitin or pathogenic hyphae. Both exogenous chitin and pathogenic hyphae can induce the strain to produce chitinase with higher activity. KF-B6 produces high levels of chitinase in the process of degrading hyphae of different pathogens, and the enzyme activity in the process of degrading Fusarium oxysporum is as high as 17.88 U / mL, which has the potential to exert a strong biocontrol effect.

[0031] (4) Paenibacillus efavirens KF-B6 has the ability to decompose macromolecular organic matter and transform it into small molecule organic nutrients such as sugars, amino acids, small peptides, and fatty acids, thereby balancing the quantity and type of small molecule organic nutrients in the soil, facilitating plant absorption and utilization, and promoting crop growth. At the same time, the bacterium has a certain nitrogen fixation ability and growth-promoting ability such as producing IAA, which can increase the supply of nitrogen nutrition for plants and promote plant growth.

[0032] 2. The KF-B6 Paenibacillus erythritolus and its microbial agent and composite microbial fertilizer provided by the present invention can promote the formation of soil aggregates, increase soil organic matter, increase soil enzyme activity, effectively improve soil, and increase the proportion of soil bacteria and fungi; ensure the survival rate of planted apple seedling rootstocks and planted young trees in rebuilt orchards, and effectively prevent and control apple continuous cropping obstacles, as follows: (1) The application of KF-B6 microbial agent and compound microbial fertilizer can increase the activities of soil neutral phosphatase, soil urease, soil sucrase and soil catalase, which are 1.63 times, 1.44 times, 3.81 times and 2.53 times of that of the continuous cropping soil treatment CK, respectively. This indirectly reflects that KF-B6 bacteria and its microbial agent and compound microbial fertilizer can improve the soil, increase the conversion intensity of soil carbon, nitrogen and phosphorus, promote the metabolic activity of soil microorganisms, and increase soil vitality.

[0033] (2) After applying KF-B6 microbial agent and compound microbial fertilizer, KF-B6 bacteria can effectively colonize rhizosphere soil and plant roots, promoting the increase of soil bacteria and actinomycetes. The number of bacteria increased by 8.01 times, the number of actinomycetes increased by 5.00 times, and the number of fungi decreased by 81.56%. The ratio of bacteria and fungi was increased, which was beneficial to the reconstruction of the soil microbial ecosystem in apple orchards with continuous cropping problems and transformed towards promoting plant growth.

[0034] (3) KF-B6 microbial agent and compound microbial fertilizer increased soil organic matter content by 17.03 g / kg compared with the CK group, improving soil fertility; promoting the formation of water-stable aggregates, especially increasing the proportion of large-size aggregates, of which >2 mm and 1-2 mm water-stable aggregates increased by 28.01% and 47.64% respectively compared with the CK group; the proportion of microaggregates (<0.25 mm) decreased by 48.60% compared with the CK group, and the soil bulk density decreased by 6.87%. This indicates that KF-B6 bacteria and its agent not only increased soil organic matter, but also promoted the formation of water-stable aggregates, reduced soil bulk density, increased soil structure stability and air permeability, and achieved the effect of improving soil.

[0035] (4) The application of KF-B6 compound microbial fertilizer and bacterial agent can improve the survival rate of M9 T337 rootstock seedlings planted in continuous cropping soil, with the highest survival rate reaching 96.67%. The seedlings have high root vitality and good growth. The survival rate of Daphne Red apple seedlings planted in old orchards with continuous cropping obstacles is as high as 94.00%, achieving the effect of effectively preventing and controlling apple continuous cropping obstacles. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The antibacterial effect of KF-B6 on three pathogenic fungi causing apple continuous cropping problems.

[0037] Figure 2 This is the colony morphology of KF-B6.

[0038] Figure 3 KF-B6 bacteria and spores. Figure 4 The KF-B6 hemolytic test was negative.

[0039] Figure 5 Normal hyphae and spores of three pathogens and those degraded by KF-B6 (35℃).

[0040] Figure 6 This is the transparent circle of KF-B6 chitin solution.

[0041] Figure 7 Chitinization effect of KF-B6 in shake flask (35℃). Figure 8 It is the antibacterial ability of KF-B6 volatile antibacterial substances against pathogens.

[0042] Fig. 9 The antibacterial effect of KF-B6 on different pathogens. Fig.10 Glucose standard curve.

[0043] Fig.11 EPS produced for KF-B6 Among them, A is the EPS precipitated from 95% anhydrous ethanol, and B is the EPS-containing bacterial liquid produced by KF-B6. Fig.12 It is the function of KF-B6 bacteria to decompose and transform macromolecular nutrients. Fig.13 Nitrogen fixation by KF-B6 bacteria Among them, left: Ashby's medium, right: silicate bacterial medium. Fig.14 KF-B6 promotes the formation of water-stable aggregates in soil. Fig.15 This study is about the effects of KF-B6 compound microbial fertilizer and bacterial agent treatment on soil enzyme activities in continuous apple cropping. DETAILED DESCRIPTION

[0044] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0045] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the art can be used. The raw materials or instruments used are all conventional products that can be obtained commercially, including but not limited to the raw materials or instruments used in the examples of this application.

[0046] Some of the culture media involved in the embodiments of the present invention are as follows: The composition of the EPS-producing liquid culture medium A is: sucrose 20 g, corn syrup powder 2 g, CaCO3 2 g, K2HPO4·3H2O 1 g, MgSO4·7H2O 0.5 g, MnSO4·H2O 0.5 g, distilled water 1 L, pH 7.25.

[0047] Liquid medium B consists of: yeast extract powder 5g, soybean meal powder 5g, K2HPO4·3H2O 1g, MnSO4 . H2O 0.5g, NaCl 0.6g, MgSO4 . 7H2O 0.4g, KCl 0.2g, distilled water 1L, pH natural.

[0048] Liquid medium C consists of: yeast extract powder 5g, soybean meal powder 5g, K2HPO4·3H2O 1g, MnSO4 . H2O 0.5g, NaCl 0.6g, MgSO4 .7H2O 0.4g, KCl 0.2g, sucrose 1g, CaCO3 2g, distilled water 1L, pH natural.

[0049] The composition of NA medium is: peptone 10.0g, beef powder 3.0g, NaCl 5.0g, distilled water 1L, pH 7.0-7.2.

[0050] Gao's medium I consists of: soluble starch 20g, NaCl 0.5g, KNO31g, K2HPO4 . 3H2O 0.5g, MgSO4 . 7H2O 0.5g, FeSO4 . 7H2O 0.01g, agar 20g, distilled water 1L, pH 7.2- 7.4.

[0051] The present invention will be further explained below through specific examples.

[0052] Example 1 Screening of strains 1. Primary screening: Screening of EPS-producing bacteria Take a clean, dry 500 mL Erlenmeyer flask, pour in 10.0 g of accurately weighed rhizosphere soil from healthy plants in the apple orchard with continuous cropping problems, add 100 mL of ddH2O to prepare a bacterial suspension, mix well, add a small amount of glass beads for shaking, and serially dilute 10 2 , 10 3 , 10 4 , 10 5 , 100 μL of the above soil extracts were measured and evenly spread on Gao's No. 1 medium plates, and each gradient was repeated 3 times. The plates were cultured in a constant temperature incubator at 37°C for 3-5 days, and single colonies were picked up with sterilized bamboo sticks. The strains with moist surface and high viscosity were selected. The strains with EPS production were initially screened and numbered as KF-B2, KF-B3, KF-B6, and KF-B10 (see Table 1), and they were purified and stored in glycerol tubes.

[0053] Table 1 Different strains producing EPS

[0054] Note: The more + the longer the wire drawing, the higher the viscosity 2. Rescreening: Bacteria that produce EPS and have antibacterial effects on apple continuous cropping pathogens The plate confrontation method was used to determine the antagonistic effects of the four strains KF-B2, KF-B3, KF-B6, and KF-B10 obtained in the initial screening on the main pathogens of apple continuous cropping obstacles, Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme. The preserved strains were cultured on NA medium at 37°C for 48 hours for activation. The above three pathogenic bacteria cakes with a diameter of 5 mm were inoculated on the center of the circle of the NA medium plate, and three points 25 mm away from the center of the circle were inoculated with functional bacteria as the treatment group; the plate inoculated only with pathogenic bacteria cakes but not functional bacteria was used as the control group, and cultured at 28°C for 7 days (the results are shown in Figure 1 As shown in the figure), the colony radius of the pathogens was measured and the inhibition rate of each bacterium on the pathogens was calculated.

[0055] Inhibition rate = (control colony radius - treated colony radius) / control colony radius × 100%.

[0056] The three pathogenic bacteria used in this patent were isolated from apple orchards with continuous cropping problems and are preserved in the strain collection center of Mumeituli Ecological Agriculture Co., Ltd.

[0057] Table 2 Inhibition rate of 4 strains against pathogenic bacteria

[0058] Note: The data in the table are mean ± standard error. The lowercase letters after the data indicate the difference between the two groups after Duncan's new multiple range method test. P The difference was significant at the level of <0.05.

[0059] It can be seen that among the four strains, KF-B6 has a higher inhibition rate against the three pathogens than the other three functional strains, with an inhibition rate of 78.49-83.81%, and an antagonistic coefficient of level I. It also shows that the bacteria has a broad-spectrum antibacterial activity against the pathogens of apple continuous cropping disorders. Therefore, the KF-B6 strain with the ability to produce EPS and significant antibacterial ability against the main pathogens of apple continuous cropping disorders was finally obtained through primary screening and rescreening.

[0060] Example 2 Identification of KF-B6 strain (1) Morphological identification The KF-B6 strain was streaked onto Gao's I and NA medium, respectively, and cultured at 45°C for 72 h. Single colonies grew and their morphological characteristics were observed.

[0061] The results are as follows Figure 2 As shown. It can be seen that the colony characteristics of KF-B6 bacteria on Gao's No. 1 medium are obvious, round, translucent, with patterned surface wrinkles, strong adhesion to the contact surface of the medium, not easy to pick up, and after picking up, it will be drawn into a thread, with high viscosity. On NA medium, the colony is round, the surface is moist, the colony is raised, and it has a certain viscosity.

[0062] At the same time, the bacteria were gram-stained and the morphology was observed under a microscope. Figure 3 The results of Gram staining showed that KF-B6 was a Gram-positive bacterium with a short rod shape and produced spores.

[0063] (2) Physiological and biochemical identification Physiological and biochemical identification The experiment was repeated three times according to the methods in Bergey's Bacterial Identification Manual (Second Edition) and Common Bacterial System Identification Manual. The physiological and biochemical indexes of strain KF-B6 were tested, and the results are shown in Table 3.

[0064] Table 3 Physiological and biochemical characteristics of KF-B6 strain

[0065] Note: "+" represents a positive reaction or availability; "-" represents a negative reaction (3) 16S rDNA sequence analysis and phylogenetic analysis KF-B6 was inoculated into LB liquid culture medium and cultured at 45°C with shaking for 1 day until the culture medium became turbid. The bacterial liquid was added to a centrifuge tube (1.5 mL), and the genome was extracted strictly according to the process of the genome extraction kit. The extracted DNA genome was used as a template, and 27f / 1492r (27f: GAGTTTGATCCTGGCTCAG; 1492r: ACGGCTACCTTGTTACGACTT) was used as primers for PCR reaction to amplify the 16s DNA (16s ribosomal DNA) sequence fragment. The PCR reaction conditions were: 94°C for 5 min, 94°C for 30 s, 55°C for 40 s, 72°C for 1.5 min, 30 cycles, and final extension at 72°C for 10 min.

[0066] After electrophoresis, the PCR product was recovered by gel excision (the gel excision recovery step was strictly performed according to the method of the full-form gold gel recovery kit), connected to the pEASY T3 vector, and then transformed into the Trans-Top1 competent state by heat shock transformation. The blue-white spot screening picked the white spot colonies and added them to the LB liquid medium containing Amp, and cultured at 37°C, 200rpm for 8-12h. The M13F / M13R primers were used to detect positive clones, and the positive clone bacterial solution was sent to Beijing Liuhe BGI for sequencing. After the obtained sequences were spliced ​​and proofread, the GeneBank database was used for Blast comparison analysis.

[0067] Results: The length of the 16S rDNA sequence of KF-B6 was 1512 bp. The comparison results of NCBI showed that the 16S rDNA sequence of KF-B6 was Paenibacillus ehimensis GE17-1 (Sequence ID: KF030787.1) has a similarity of up to 99.20%.

[0068] Finally, the strain KF-B6 was identified as Paenibacillus eihime ( Paenibacillus ehimensis ).

[0069] On September 30, 2024, Paenibacillus eihime ( Paenibacillus ehimensis )KF-B6 is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee, with the deposit number CGMCC No.32131. The deposit address is No.3, Yard No.1, Beichen West Road, Chaoyang District, Beijing.

[0070] The 16S rDNA sequence of KF-B6 is shown below:

[0071] Example 3 Safety test of Paenibacillus eihime KF-B6 Experimental method: The activated KF-B6 was inoculated onto the blood plate culture medium, and hemolysis-positive bacteria were used as a control. The culture was cultured at 45°C for 24-72 hours, and the hemolysis was observed.

[0072] Preparation method of blood plate culture medium: 18g peptone, 1g yeast powder, 5g NaCl, 15g agar, 1L distilled water, pH7.2-7.4. Sterilize at 121℃ for 30min, add 5% sheep blood when the culture medium cools to 50℃, mix well and pour the culture medium plate.

[0073] The results are as follows Figure 4 As shown, no hemolytic transparent zone appeared around the KF-B6 colony within 24-72 hours, while a hemolytic zone appeared around the hemolytic-positive bacteria within 24 hours, indicating that the KF-B6 bacteria are not hemolytic, harmless to humans, livestock, etc., and have high application safety.

[0074] Example 4 Functional Study of Paenibacillus eihime KF-B6 1. Paenibacillus Ehime KF-B6 degrades the cell wall of pathogens, dissolves hyphae and spores, inactivates them, and reduces the number of pathogens (1) It has destructive effects on the mycelium and spores of the main pathogens of apple continuous cropping, namely Fusarium oxysporum, Fusarium solani and Fusarium moniliforme.

[0075] ① Preparation of seed solutions of three pathogenic bacteria: activated Fusarium oxysporum, Fusarium solani and Fusarium moniliforme were inoculated into PDA liquid culture medium respectively, and cultured at 30°C and 200 rpm for 18 h to obtain seed solutions of three pathogenic bacteria; ② Preparation of KF-B6 seed solution: inoculate the activated KF-B6 into liquid culture medium B, culture at 40°C and 200 rpm for 18 h to obtain KF-B6 seed solution; ③ Co-cultivation: The above two seed liquids were treated according to the following table (Table 4), inoculated into liquid culture medium C for co-cultivation, and cultured at 30℃ and 35℃ with shaking at 200rpm for 40h, respectively. The degradation of pathogen mycelium was examined under a microscope, and the activity of pathogens in each treatment group and the control group was detected, and the reduction in pathogen activity was calculated (Table 5).

[0076] The method for preparing the PDA liquid culture medium is as follows: weigh 200 g of peeled potatoes and cut them into pieces of about 1 cm 3 Put small pieces of syrup into appropriate amount of distilled water and boil for 30 min, then filter the juice with double-layer gauze, add 20 g of glucose, heat and dissolve, then add water to 1000 mL, divide into portions, and sterilize at 121℃ for 30 min.

[0077] Table 4 Co-culture method of KF-B6 and pathogens

[0078] Microscopic examination results Figure 5 As shown, the details are as follows: (1) The hyphae of the three pathogens in the CK group were thick and grew well ( Figure 5 , 35℃), while compared with the CK group, the hyphae cell walls of the three pathogens in treatments I, II, and III began to be degraded 18 hours after co-culture with KF-B6. After 40 hours of culture, the hyphae of the three pathogens all showed signs of shrinkage, deformity, breakage, and hollowness, indicating that KF-B6 produced chitinase to degrade the hyphae cell walls of the pathogens.

[0079] (2) Compared with treatments I, II, and III, the mycelia of pathogens in treatments V, VI, and VII were broken and hollow, and were degraded faster and more thoroughly. At the same time, some pathogen spores also showed hollowness, indicating that KF-B6 and the chitinase it produced can not only degrade pathogen mycelia, but also have destructive effects on pathogen spores, reducing or even losing their activity ( Figure 5 ).

[0080] The activity of pathogens in each treatment group and the control group is shown in Table 5. As can be seen from Table 5, under different temperatures and different co-culture methods, KF-B6 has a strong degradability on the hyphae of the three pathogens, and can make them partially or completely inactive. Among them, KF-B6 has the strongest degradation performance on the hyphae of Fusarium oxysporum, which is completely inactivated at 30 and 35°C; compared with CK, the activity of Fusarium solani is reduced by 200-20000 times; the activity of Fusarium moniliforme is reduced by 1300-12000 times. This shows that KF-B6 not only inhibits the growth of Fusarium oxysporum, Fusarium solani and Fusarium moniliforme, the main pathogens of apple continuous cropping obstacles, but also degrades their hyphae and even spores, making them partially or completely inactive, and the biocontrol effect is significant.

[0081] Table 5 Pathogen activity in different treatments

[0082] 2. Ehime Bacillus KF-B6 decomposes chitin (qualitative detection) (1) Chitin decomposition plate transparent zone method: Use a sterile bamboo stick to inoculate the activated KF-B6 bacteria on the chitin decomposition plate culture medium, and place it in a constant temperature incubator at 28℃, 37℃ and 45℃ for 48h. The results show the chitin decomposition transparent zone ( Figure 6 ).

[0083] The chitin culture medium is composed of: K2HPO4·3H2O 0.7g, MgSO4 . 7H2O 0.5g, ZnSO4. 7H2O 0.001g, KH2PO4 0.5g, FeSO4 0.01g, 40mL colloidal chitin, add distilled water to 1L, and adjust the pH to 7.3-7.5 with 40% NaOH.

[0084] (2) Shake flask chitin decomposition method: Use a sterile bamboo stick to inoculate the activated KF-B6 bacteria into liquid culture medium B, and culture at 40℃ and 200rpm for 18 hours to obtain seed liquid; inoculate the seed liquid into chitin shake flask culture medium at a 1% inoculation rate, and culture at 30℃, 35℃, and 40℃, 200rpm for 40 hours; the chitin shake flask culture medium without seed liquid was used as a control, and the changes in the amount of chitin in the control and the chitin shake flask culture medium inoculated with KF-B6 were observed. As a result, the chitin particles in the shake flask inoculated with KF-B6 bacteria were completely decomposed ( Figure 7 , 35℃).

[0085] The chitin shake flask culture medium is composed of: peptone 10g, K2HPO4·3H2O 0.7g, MgSO4 . 7H2O0.5g, ZnSO4 . 7H2O 0.001g, KH2PO4 0.3g, 40mL colloidal chitin, pH adjusted to 7.3 with 40% NaOH.

[0086] Preparation method of the colloidal chitin used above: 5g chitin is dissolved in 200mL concentrated hydrochloric acid precooled at 4℃, stirred on a magnetic stirrer for 2h, and left to stand at 4℃ for 24h; the above substances are added to 1000mL 95% ethanol precooled at 4℃, stirred for 2h, and left to stand at room temperature overnight. The supernatant is poured off, the white precipitate at the bottom is centrifuged at 4000 rpm for 20min, the precipitate is collected, and dissolved in 100mL distilled water to form a colloidal state, thus obtaining colloidal chitin with a chitin content of 5%.

[0087] 3. Detection of chitinase activity produced by Paenibacillus erythrocytes KF-B6 The fermentation broth of KF-B6 CK group in Table 4, the mixed fermentation broth of different treatments Ⅰ-Ⅶ of KF-B6 and pathogenic bacteria co-culture, and the fermentation broth of the chitin shake flask medium mentioned above were sterilized by filtration with a 0.22 μm microporous filter membrane to obtain a sterile filtrate, which was added to a perforated chitin-degrading plate and placed at 37°C for 24 h. As a result, transparent circles of degraded chitin appeared, indicating that the filtrates of different treatments contained chitinase.

[0088] The sterile filtrate of different test treatments was appropriately diluted, and the chitinase activity in the dilution was determined using the chitinase reagent kit of Shanghai Fenxi Biotechnology Co., Ltd. The chitinase activity of the original solution was obtained by multiplying the result by the dilution multiple. The chitinase standard curve y=18.457x-1.1636 (where x is OD450 , y is chitinase activity U / L), standard curve R 2 =0.9956, the linear relationship is good.

[0089] The results are shown in Table 6: (1) The chitinase activity in the sterile filtrate of KF-B6 CK group was 11.51-13.54 U / mL, indicating that Paenibacillus eihime KF-B6 can produce chitinase in the absence of exogenous chitin or pathogenic mycelium induction.

[0090] (2) The chitinase activity of the fermentation broth in the chitin shake flask medium was 13.71-17.40 U / mL, which was higher than that in the CK group, indicating that exogenous chitin induced KF-B6 to produce chitinase with higher activity.

[0091] (3) The chitinase activity in the sterile filtrates of treatments I to VII was higher than that in the KF-B6 CK group, indicating that the pathogenic fungus hyphae became exogenous chitin and could induce KB-B6 to produce more chitinase. The highest enzyme activity was achieved during the degradation of Fusarium oxysporum, reaching 17.88 U / mL.

[0092] (4) KF-B6 is a strain that produces a high amount of chitinase and can efficiently degrade the mycelium and spores of pathogens, rendering them partially or completely inactive, and has the potential to exert a strong biocontrol effect.

[0093] Table 6 Chitinase activity in different treatments

[0094] 4. Detection of the antibacterial rate of volatile antibacterial substances of Paenibacillus erythrorhizium KF-B6 against the main pathogens of apple continuous cropping problems, Fusarium oxysporum, Fusarium solani and Fusarium moniliforme The specific method is: (1) Plate inoculation: Inoculate the three pathogenic bacteria cakes in the center of the PDA medium; use a sterilized bamboo stick to streak KF-B6 bacteria on the NA medium.

[0095] (2) The antibacterial effect of KF-B6 volatile substances was measured by the plate-pair method: the NA medium inoculated with KF-B6 bacteria and the PDA plate inoculated with pathogens were placed side by side, and the plates were sealed with sealing film to form the treatment group, with 3 replicates for each treatment. At the same time, an empty NA medium without KF-B6 bacteria and a PDA plate inoculated with pathogens were placed side by side to form the control group. The plates were cultured at 30°C. When the pathogens in the control group filled the plates, the antibacterial effect of KF-B6 in the treatment group on the pathogens was observed and the antibacterial rate was calculated.

[0096] Inhibition rate % = (9cm-diameter of pathogens in the treatment group) / 9cm×100% The results are as follows Figure 8 As shown in Table 7, the volatile antibacterial substances produced by KF-B6 have an inhibition rate of 91.11%, 87.78% and 86.67% against three pathogens, namely Fusarium oxysporum, Fusarium solani and Fusarium moniliforme, respectively, and the antibacterial effect is extremely significant.

[0097] Table 7 Inhibition rate of KF-B6 volatile antibacterial substances against three pathogenic bacteria

[0098] 5. Determination of the broad-spectrum antibacterial effect of Paenibacillus erythrocytes KF-B6 The plate confrontation test (the method is the same as the multiple screening method) was used to evaluate the antibacterial activity of KF-B6 against other fruit and vegetable disease pathogens.

[0099] The results are as follows Fig. 9 As shown in Table 8, KF-B6 not only has a high antagonism to the main pathogens of apple continuous cropping disorder, but also has antagonistic effects on other apple disease pathogens, such as apple black rot (apple tree rot), apple leaf spot disease, apple leaf spot disease, Berenger's Botrytis ciliata (apple ring rot), and tomato early blight, rice blast, and convex umbilical cord spores of corn leaf spot disease. Fig. 9 ), the inhibition rates were 59.84%-82.54% (Table 8).

[0100] Table 8 Inhibition rate of KF-B6 against other pathogens

[0101] 6. Rapid and high EPS production capability of Paenibacillus Ehime KF-B6 (1) Bacteria activation The KF-B6 bacteria were inoculated onto the slant of the NA culture medium using a sterile inoculation loop and cultured at 45°C for 72 h. All of them were spores under microscopic examination.

[0102] (2) Inoculation and cultivation Slant inoculation: Add 10 mL of sterile water to the NA medium slant containing bacteria, use a sterile inoculation loop to scrape the spores into distilled water to prepare an inoculum suspension, and inoculate it into the EPS-producing liquid medium A at a 1% inoculum amount. Take the liquid medium A without inoculation of KF-B6 bacteria as CK, and culture at 200 rpm and 45 °C for 2 / 4 / 6 / 8 / 12 / 16 / 20 / 24 / 28 / 32 / 40 / 48 h. Repeat 3 times for each time period. Take out the shake flasks at different times at regular intervals, observe the viscosity, and store them in a 4 °C refrigerator. After the cultivation of all time periods is completed, the EPS yield is determined at the same time.

[0103] (3) EPS production detection method is as follows ①Precipitation of crude polysaccharides The EPS of the fermentation liquid was extracted by low-temperature alcohol precipitation separation method. 10 mL of KF-B6 EPS fermentation liquid cultured for different times was placed in a boiling water bath for 10 minutes to denature the protein. After natural cooling, it was centrifuged at 4°C, 10000r / min for 15 minutes to remove the protein, and the supernatant was retained. 2.0 mL of the supernatant was taken, 6 mL of anhydrous ethanol was added, and it was placed at 4°C for low-temperature extraction for 24 hours to fully precipitate the EPS. The supernatant of the precipitated EPS was centrifuged at 4°C, 10000r / min for 15 minutes, the supernatant was removed, and the EPS precipitate was retained; the centrifuge tube containing the EPS precipitate was placed in an oven at 50°C for drying, and the dried precipitate was dissolved in 20 mL of distilled water to be the test solution.

[0104] ② Make a standard curve Prepare 100 mg / L (100 μg / mL) glucose standard solution. Take 0.2, 0.4, 0.6, 0.8, 1.0 mL of the standard solution into 20 or 25 mL stoppered test tubes respectively. Make up the volume less than 1 mL with water. Add 1.0 mL of 6% phenol and 5.0 mL of concentrated sulfuric acid to each tube. Let stand for 10 min, vortex to mix, and place in a 30°C water bath for 20 min. Measure the optical density at 490 nm. Use 1.0 mL of water as a blank according to the same color development. The optical density value OD 490 The standard curve is drawn with the glucose content as the horizontal axis and the glucose content as the vertical axis ( Fig.10 ). Table 9 Glucose standard curve

[0105] ③Sample content determination The samples were diluted at different times according to their viscosity, and the optical density of the sample solutions at different dilution times was measured by the same color development method as above, and the polysaccharide content was calculated using the standard curve. ④ Calculation method of extracellular polysaccharides

[0106] Where: m1--Sugar content in the sample solution obtained from the standard curve, in micrograms (μg) V1--Sample fixed volume, in milliliters (mL) V2--The volume transferred for colorimetric determination, in milliliters (mL) V3--sample volume, in milliliters (mL) 0.9--Correction factor for converting glucose to dextran.

[0107] The calculation result is rounded to two decimal places.

[0108] (4) EPS production results after different cultivation times The results are shown in Table 10. It can be seen that the fermentation broth of Paenibacillus eihime KF-B6 has a slight viscosity when it is cultured for 6 hours. The EPS production is 21.80μg / mL after testing, indicating that EPS has been produced at 6 hours; therefore, Paenibacillus eihime KF-B6 is the fastest reported strain producing EPS. The viscosity of the fermentation broth increased after 12 hours of culture, and the viscosity increased significantly after 16 hours. The yield reached 978.41μg / mL, and the highest yield of 4307.39μg / mL could be reached in 24 hours (Table 10). The yield stabilized after 24 hours. The EPS content in the fermentation broth is high, and the amount of EPS precipitated with anhydrous ethanol is large ( Fig.11 Medium A), and EPS has high viscosity ( Fig.11 B), indicating that it has a high molecular weight and good adhesion, which is conducive to promoting the formation of soil aggregates. Therefore, Paenibacillus eihime KF-B6 is the fastest EPS-producing strain reported so far, and its EPS production is also at a relatively high level.

[0109] Table 10 EPS production of KF-B6 bacteria at different times

[0110] 7. Nutritional conversion ability of Ehime Bacillus KF-B6 in decomposing macromolecular organic matter (1) Determination of starch decomposition ability The KF-B6 strain was activated and inoculated onto Gow's I medium with a sterile inoculation needle, cultured at 28 / 37 / 45 / 50°C for 72 h, stained with Lugol's iodine solution (stock solution diluted 25 times), and the size of the transparent zone produced around the colony of strain KF-B6 was measured.

[0111] (2) Determination of protein degradation ability The KF-B6 strain was activated and inoculated onto the protein decomposition function test medium with a sterile inoculation needle. It was cultured at 28 / 37 / 45 / 50°C for 72h, and the size of the transparent circle produced around the colony of the strain KF-B6 was measured.

[0112] (3) Determination of cellulose decomposition ability The KF-B6 strain was activated and inoculated onto the cellulose decomposition function test medium with a sterile inoculation needle. It was cultured at 28 / 37 / 45 / 50°C for 72 hours, and the size of the transparent circle produced around the colony of the strain KF-B6 was measured.

[0113] (4) Determination of fat decomposition ability The KF-B6 strain was activated and inoculated onto the lipolytic function test medium with a sterile inoculation needle. The strain was cultured at 28 / 37 / 45 / 50°C for 72 h, and the size of the halo produced around the colony of the KF-B6 strain was measured.

[0114] (5) Determination of nitrogen fixation capacity The KF-B6 strain was activated and streaked onto nitrogen-fixing medium (Ashuber medium) and silicate bacterial medium using a sterile inoculation loop. The strains were cultured at 28 / 37 / 45 / 50℃ for 72h, respectively, and their growth was observed. If the strains reproduced quickly and grew well, it indicated that the strains had a strong nitrogen-fixing ability.

[0115] The method for preparing the protein decomposition function detection medium comprises the following steps: weighing 2.0 g of casein, wetting the mixture with 5 mL of 0.5 mol / L NaOH, adding 150 mL of distilled water, stirring the mixture in a boiling water bath until the mixture is completely dissolved, supplementing the mixture with distilled water to 800 mL, adding 3.0 g of beef extract, 5.0 g of NaCl, and 0.1 g of CaCl2·2H2O, fully dissolving and mixing the mixture, adjusting the volume to 1 L with distilled water, adjusting the pH to natural, and adding 20.0 g of agar powder.

[0116] The fiber decomposition function detection medium is composed of: 1.0g sodium nitrate, 1.2g Na2HPO4·12H2O, 0.9g KH2PO4, 0.5g MgSO4·7H2O, 0.5g KCl, 0.5g yeast extract powder, 0.5g acid hydrolyzed casein, 0.2g Congo red, 10g sodium carboxymethyl cellulose, 1L distilled water, pH 7.0±1, and 20g agar powder.

[0117] The preparation method of the lipolytic function detection medium is as follows: 10.0 g of peptone, 5.0 g of NaCl, and 0.1 g of CaCl2·2H2O are weighed and fully dissolved in 800 mL of distilled water, 20.0 g of agar is added, the pH is adjusted to 7.2, the volume is fixed to 1 L, sterilized at 121° C. for 30 min, cooled to 65° C., 10 mL of Tween80 or Tween60 or Tween40 sterilized at 121° C. for 30 min is added, and the mixture is mixed evenly.

[0118] The nitrogen-fixing medium (Ashberriere medium) is composed of: 10 g of mannitol, 0.2 g of KH2PO4, 0.2 g of NaCl, 0.2 g of MgSO4·7H2O, 0.1 g of CaSO4·7H2O, 5 g of CaCO3, 1 L of distilled water, pH 6.8-7.0, and 20 g of agar powder.

[0119] The silicate bacterial culture medium is composed of: 5 g sucrose, 2 g Na2HPO4·12H2O, 0.1 g CaCO3, 0.5 g MgSO4·7H2O, 1 mL 0.5% FeCl3·6H2O solution, 1 L distilled water, pH 7.0-7.2, and 20 g agar powder.

[0120] Table 11 Nutritional transformation function of KF-B6 bacteria in decomposing macromolecular organic matter

[0121] The results are as follows Fig.12 As shown in Table 11, it can be seen that KF-B6 bacteria have the ability to produce cellulase, amylase, protease, lipase and nitrogenase at different temperatures ( Fig.12 ), and its function is strongest in the medium and high temperature range of 37-45℃; it can be seen that the bacteria has the ability to decompose cellulose-rich organic matter such as crop straw and raw materials containing starch, protein and fat such as corn flour and soybean meal into small molecule organic nutrients such as disaccharides, monosaccharides and small peptides, amino acids, fatty acids, etc., thereby balancing the small molecule organic nutrients in the soil, which is beneficial for plant absorption and utilization, and at the same time provides nutrition for other microorganisms and increases the microbial diversity in the soil.

[0122] At the same time, the bacteria can grow well in both Ashuber medium and silicate bacterial medium, indicating that it has a strong nitrogen fixation ability ( Fig.13 , left: Ashutosh culture medium, right: silicate bacterial culture medium), which can increase the supply of nitrogen nutrition for plants.

[0123] 8. Determination of the growth-promoting properties of Paenibacillus erythrocytes KF-B6 (1) After KF-B6 strains were activated, they were inoculated into liquid culture medium B and cultured at 40°C and 200 rpm for 18 h to obtain seed solution; (2) Inoculate the seed liquid into the IAA-producing fermentation medium at a 10% inoculation rate, and culture at 40°C and 200 rpm for 24 h to obtain the fermentation liquid.

[0124] The IAA-producing fermentation medium is composed of: 5.0 g yeast extract powder, 5.0 g soybean meal powder, 1.0 g K2HPO4▪3H2O, 0.5 g MnSO4▪H2O, 0.6 g NaCl, 0.4 g MgSO4▪7H2O, 0.2 g KCl, 1 g sucrose, 2 g CaCO3, 1 L distilled water, natural pH, and 200 mg / L of filtered and sterilized L-tryptophan solution is added after sterilization.

[0125] (3) Determination of the ability to produce indoleacetic acid ① Determination of IAA standard curve Prepare IAA standard solutions with concentrations of 0, 20, 40, 60, 80, and 100 μg / mL, and mix with Salkowski colorimetric solution at a volume ratio of 1:1. Place at room temperature in the dark for 30 minutes, and then measure the OD of each concentration. 530 (A 1:1 mixture of distilled water and Salkowski colorimetric solution was used as a blank control). 530 Plotting with the concentration of IAA as the horizontal axis and the concentration of IAA as the vertical axis, we can obtain the IAA standard curve.

[0126] ② Determination of IAA concentration in bacterial solution KF-B6 fermentation broth was centrifuged at 6000rpm for 15min, and then 4mL of supernatant was mixed with an equal volume of Salkowski colorimetric solution. It was placed at room temperature and away from light for 30min to see if it turned red. If it turned red, it indicated that the bacteria had a certain ability to produce IAA, and its OD was further measured. 530 Values ​​(with the mixed solution of uninoculated liquid culture medium and equal volume of Salkowski colorimetric solution as control). 530 The corresponding IAA concentration was calculated based on the standard relationship curve.

[0127] Finally, after culturing at 45°C for 24 hours, the IAA production of the bacteria was determined to be 26.84 μg / mL. Therefore, the bacteria has the potential to promote plant root and plant growth.

[0128] Example 5 Effect of Rapid and High-yield EPS Paenibacillus Ehime KF-B6 on Soil Water Stability Aggregates The test soil was sandy loam, sieved through a 0.25 mm sieve, and sterilized at 121°C for 40 min. KF-B6 was cultured in liquid medium A to obtain the KF-B6 fermentation liquid containing EPS (EPS content = 3500.65 μg / mL, bacterial activity = 550 million / mL). The fermentation liquid was inoculated into a petri dish containing 80.0 g of soil sample at a 5% (v / w) inoculation rate as the treatment group. The soil sample inoculated with an equal volume of sterile water was CK1, and the soil sample inoculated with liquid medium A was CK2. Each treatment was repeated 6 times. The petri dish was placed in a 40°C incubator for 30 days and sterile water was regularly added to keep the soil surface relatively moist. The proportion of soil water-stable aggregates > 0.25 mm was determined every 10 days by the wet sieving method (the detection method refers to NYT1121.19-2008 Soil Testing Parts 19 and 20).

[0129] Results: Fig.14 As shown in Table 12, the proportion of water-stable aggregates (>0.25 mm) in the soil was significantly increased by 10 days after inoculation with KF-B6 fermented liquid, reaching 21.38%, 5.4 times that of the CK1 sterile water treatment group, and the proportion of aggregates with a particle size greater than 3 mm was 9.45%; after 20 days of cultivation, the proportion of water-stable aggregates >0.25 mm reached the maximum, reaching 32.97%, 6.6 times that of the CK1 sterile water treatment group. The proportion of water-stable soil aggregates after 30 days of cultivation was not much different from that after 20 days of cultivation, and the proportion of particles with a particle size greater than 3 mm gradually decreased, and the particle size was more stable between 0.25-3 mm, indicating that the soil structure tended to be stable after 20 days, while the proportion of water-stable aggregates in the CK2 group inoculated with liquid culture medium did not increase significantly compared with CK1 ( Fig.14), indicating that KF-B6 bacteria and the EPS they produce promote the formation of soil water-stable aggregates, and the efficiency of forming aggregates is high, and the soil aggregates are stable. Therefore, KF-B6 has the function of efficiently improving soil.

[0130] Table 12 Effects of different treatments on the proportion of water-stable aggregates at each level (%)

[0131] Example 6 Preparation of KF-B6 Ehime Paenibacillus agent and composite microbial fertilizer 1. Preparation of KF-B6 liquid microbial agent (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium with a sterile inoculation loop, and culture at 45°C for 3 days. The spore rate under microscopic examination should be greater than 95%. Elute the spores with 10 mL of sterile distilled water into a sterile and dry inoculation bottle, and incubate in a water bath at 80°C for 5 min to obtain a spore suspension inoculant.

[0132] (2) EPS-producing liquid fermentation: Inoculate the spore suspension into the EPS-producing liquid culture medium A at a 10% inoculation rate, and culture it at 45°C in a constant temperature oscillator at 200 rpm for 48 h. The fermentation liquid is viscous and more than 95% of the spores can be detected by microscopic examination, thus obtaining the EPS-containing KF-B6 fermentation liquid.

[0133] (3) Preparation of KF-B6 liquid microbial agent: Add 15% (w / v) mineral potassium humate, 3.5% (w / v) potassium dihydrogen phosphate, 2% (w / v) seaweed liquid with pH 7.0, 3% (w / v) ethylene glycol, 1.5% (w / v) OP-10, and 0.05% (w / v) sodium dehydroacetate to the KF-B6 fermentation broth containing EPS, and mix thoroughly to obtain KF-B6 liquid microbial agent.

[0134] In the above-mentioned KF-B6 liquid microbial agent: the effective viable count of KF-B6 is 550 million / mL, the extracellular polysaccharide is 3500.65 μg / mL, and the pH is 6.0.

[0135] 2. Preparation of KF-B6 compound microbial fertilizer (1) Preparation of spore suspension on slant: The method is the same as that of KF-B6 liquid microbial agent.

[0136] (2) Inoculate the slant spore suspension into liquid culture medium B at a 10% inoculation rate and culture at 40℃ and 200rpm for 18h.

[0137] (3) Inoculate the seed liquid into liquid culture medium C at a 10% inoculation rate and culture at 45°C and 200 rpm for 24 h to obtain fermentation liquid. The spore rate in the fermentation liquid is >95% and the bacterial activity is >600 million / mL.

[0138] (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 and the sterilized carrier are evenly mixed in a volume-to-mass ratio of 1:2, the mixture is spread in a thickness of 15 cm to 20 cm in a constant temperature culture room at 45°C and cultured with ventilation for 6 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer.

[0139] The carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:1.

[0140] The above-mentioned KF-B6 compound microbial fertilizer contains: organic matter 45.60%, total nutrients (N+P2O5+K2O) 9.26%, water 8.63%, KF-B6 effective live bacteria count 380 million / g, and pH 7.5.

[0141] Example 7 Potted Plant Test 1. Test seedlings: tissue culture seedlings that have been hardened in the seedling shed for 2 months and are ready for transplanting are M9 T337 rootstock seedlings with the same growth potential.

[0142] 2. Experimental soil: The soil was taken from a 30-year-old orchard in Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. Multiple random sampling was performed at a depth of 10-40 cm and 80 cm from the tree trunk, and the soil was mixed evenly. The soil texture is sandy loam.

[0143] 3. Experimental design Control group (CK): soil CK from orchard with continuous cropping; Treatment I (T1): continuous orchard soil + KF-6 compound microbial fertilizer (prepared in Example 6) 2.0 kg / pot, and 10% (v / v) KF-B6 liquid microbial agent (prepared in Example 6) was added to the irrigation water when planting in flower pots; Treatment II (T2): continuous orchard soil + carrier 2.0 kg / pot, the carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:1; Each treatment had 30 pots. When transplanting from the nursery to large pots, 15 kg of soil from the above different experimental treatments was added to each pot, and watering was carried out regularly. The greenhouse humidity was 65%-70%; the daytime temperature was 23-26℃, and the night temperature was 15-18℃; the greenhouse was ventilated regularly.

[0144] 4. Index determination (1) Investigate the survival rate and growth of trees after half a year Calculate the survival rate of seedlings in each treatment; select 20 leaves from the middle of the outer branches with normal development for each plant, and investigate a total of 100 leaves for each treatment to determine the weight of 100 leaves. Measure plant height, increase in stem circumference 25 cm above the soil surface, and root activity (methyl blue photoelectric colorimetry).

[0145] Results: As shown in Table 13, the growth and development of rootstock seedlings in treatment I (T1) and treatment II (T2) were better than those in the treatment of continuous cropping soil. Among them, T1 had the best growth after applying KF-6 compound microbial fertilizer and microbial agent, and the survival rate of seedlings was as high as 96.67%, while the survival rate of rootstock seedlings in the continuous cropping soil was low in the CK treatment, which was only 63.33%, and the tree growth was weak and the root activity was low. As shown in Table 13, the increase in leaf weight, plant height, stem circumference and root activity of T1 increased by 23.77%, 16.87%, 18.46% and 38.72% respectively compared with the control CK. The various indicators of the T2 group were lower than those of the T1 treatment, indicating that the KF-B6 bacteria still had the function of resisting continuous cropping.

[0146] Table 13 Effects of different treatments on the growth of M9 T337 rootstock seedlings

[0147] (2) Effects of KF-B6 compound microbial fertilizer and bacterial agent on rhizosphere soil enzyme activities of continuously cropped apple trees Half a year later, fresh rhizosphere soil from plants in different treatment groups was collected by the five-point sampling method and mixed evenly. The activities of neutral phosphatase, urease, sucrase and catalase were measured according to the instructions of the soil neutral phosphatase, soil urease, soil sucrase and soil catalase test kits, and each treatment was repeated 3 times.

[0148] The results are as follows Fig.15 As shown, it can be seen that the activities of soil neutral phosphatase, soil urease, soil sucrase and soil catalase in KF-B6 treatment I (T1) were 1.63 times, 1.44 times, 3.81 times and 2.53 times those in continuous cropping soil treatment CK, respectively. Therefore, the application of KF-B6 compound microbial fertilizer and bacterial agent can increase soil enzyme activity, reflecting that it can improve the conversion intensity of soil carbon, nitrogen and phosphorus and promote the metabolic activity of soil microorganisms.

[0149] (3) Detection of culturable soil microorganisms Half a year later, the plate count method was used to determine the number of bacteria, fungi, actinomycetes and Fusarium pathogens in the soil. The soil samples were diluted and spread on LB medium, PDA medium and Gao's medium No. 1 to calculate the number of bacteria, fungi, actinomycetes and Fusarium pathogens in the soil.

[0150] Results: As shown in Table 14, after the application of KF-6 compound microbial fertilizer and microbial agent, the fungi and bacteria in each gram of soil in treatment I (T1) are shown in Table 14. It can be seen that the bacterial content of T1 is 8.01 times that of CK, the actinomycetes are 5.00 times that of the CK group, and the fungal content is 81.56% lower than that of CK. Therefore, the application of KF-B6 compound microbial fertilizer and microbial agent can significantly increase the number of bacteria in the soil, reduce the fungal content in the soil, and increase the ratio of bacteria and fungi. The increase in the ratio of bacteria / fungi is conducive to the reconstruction of the soil microbial ecosystem in the apple orchard after continuous cropping, and is transformed in the direction of promoting plant growth.

[0151] Table 14 Effects of KF-B6 compound microbial fertilizer and bacterial agent treatment on soil microorganisms in apple continuous cropping

[0152] (4) Detection of culturable soil microorganism KF-B6 The initial bacterial activity was determined after the colonization treatment, and the effective bacterial activity of KF-B6 in the rhizosphere soil of the rootstock seedlings of treatment I (T1) was tested every one month: large pieces of soil around the roots were shaken off, and the attached soil was retained. 10.00 g was accurately weighed and placed in a conical flask containing 100 mL of sterile saline. Serial dilutions were performed, and 0.1 mL of the dilutions of different concentrations were spread on Gao's medium No. 1 and cultured at 35°C for 72 h. The effective bacterial activity of KF-B6 was calculated by the plate count method.

[0153] The results are shown in Table 15. It can be seen that the initial effective bacterial activity of KF-B6 is 3.20×10 7 CFU / g, close to the theoretical number of 6.00×10 7 CFU / g, the number of bacteria detected in the second month decreased by 1 order of magnitude, and in the fourth month it decreased by 5 times compared with the second month, but the number of live bacteria measured in the sixth month was not much different from that in the fourth month, indicating that KF-B6 can effectively colonize in the soil and plant roots of continuous cropping, thereby playing the role of preventing and controlling continuous cropping diseases.

[0154] Table 15 Changes in the number of KF-B6 bacteria in rhizosphere soil

[0155] Example 8 Field Test A planting experiment of a new variety of Ruixianghong was conducted in the orchard of Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. The orchard covers an area of ​​82 mu, and the previous crop was 30-year-old intermediate rootstock Fuji. On March 20, 2022, apple saplings were replanted at the original site. The variety was 2-year-old M9 T337 dwarf self-root rootstock Ruixianghong, with a plant spacing of 3.8m×1m. There were 2 treatments in the experiment, each with 4 replicates, and 1 replicate was 1 plot. There were 25 apple trees in each test plot.

[0156] 1. KF-B6 compound microbial fertilizer and liquid microbial agent treatment, the specific process and anti-replanting test plan are as follows: (1) Dig planting trenches before winter 2021 ① Deep plowing and land preparation: After the fruit is harvested in autumn, old trees are removed, and residual roots and diseased roots are picked out. When plowing the land, KF-B6 compound microbial fertilizer (prepared in Example 6) is spread in the test plot at a usage of 300 kg / mu; ② Dig planting trenches: The planting trenches are about 80 cm deep and 80 cm wide.

[0157] ③ Backfill the planting ditch in spring (March 6, 2022): Sprinkle 500 kg of KF-B6 compound microbial fertilizer per mu in the planting ditch, mix it with the backfill soil and backfill.

[0158] (2) Treatment of seedlings before planting on March 20, 2022 Planting seedlings that have not lost water were soaked in a 100-fold dilution of KF-B6 liquid microbial agent (prepared in Example 6) for 30 minutes; (3) Tree planting on March 20, 2022 ① When transplanting, apply 2kg of KF-B6 compound microbial fertilizer to each transplanting pit and mix it evenly with the soil; when transplanting, add 20% KF-B6 compound microbial fertilizer and 20% soil to the 100-fold diluted solution of KF-B6 liquid microbial agent to make a slurry, dip the roots of the seedlings in the mud and then transplant the seedlings into the dug pits.

[0159] ② Covering with soil After covering the soil, a 300-fold dilution of KF-B6 liquid microbial agent (prepared in Example 6) was used for root irrigation; (4) Management after planting in 2022 ① During the growing season from May to June: use KF-B6 liquid bacterial agent (prepared in Example 6) diluted 300 times and irrigate the roots once; ② Autumn fertilization: 2 kg KF-B6 compound microbial fertilizer + 0.5 kg trace elements in commercially available Mumei soil per tree.

[0160] 2. Control treatment: The KF-B6 compound microbial fertilizer in the above process and scheme was replaced with farmyard manure (rotted cow dung, dried to a moisture content of less than 30%, and crushed); water was used to replace the KF-B6 liquid microbial agent.

[0161] Other farming operations were exactly the same in the two treatments.

[0162] 3. Detection indicators (1) Soil index detection: The five-point sampling method was used to collect rhizosphere soil samples from apple trees in each plot. Six trees were selected from each plot to collect soil samples at fixed points. Five sampling points were set up 0.5 m away from the base of the tree trunks. A soil drill with an inner diameter of 10 cm was used to dig 20-40 cm of soil to collect the roots. The soil attached to the roots was shaken off, and the contents of organic matter, total nitrogen, available potassium and available phosphorus in the rhizosphere soil, as well as soil aggregates and soil bulk density were measured.

[0163] The results are shown in Table 16. The nitrogen, phosphorus and potassium contents in the soil of the KF-B6 compound microbial fertilizer and microbial agent treatment groups increased, especially the organic matter content increased by 17.03 g / kg compared with the CK group, which improved soil fertility. At the same time, the treatment also promoted the formation of water-stable aggregates, especially the proportion of large-size aggregates, among which the water-stable aggregates of >2 mm and 1-2 mm increased by 28.01% and 47.64% respectively compared with the CK group; the proportion of microaggregates (<0.25 mm) decreased by 48.60% compared with the CK group, and the soil bulk density decreased by 6.87%, indicating that KF-B6 bacteria and its agents not only increased soil organic matter, but also promoted the formation of water-stable aggregates, reduced soil bulk density, increased the stability and air permeability of soil structure, and achieved the effect of improving soil.

[0164] Table 16 Effects of KF-B6 compound microbial fertilizer and microbial agent on the physical and chemical properties of rhizosphere soil in continuous apple cropping

[0165] (2) Testing of planting survival rate and apple tree growth indicators A total of 100 trees were planted in 4 plots in each treatment group. After one year, the number of surviving trees was counted and the survival rate was calculated. At the same time, 3 trees were selected and marked in each plot. The plant height and trunk diameter of the young apple trees were measured at the time of planting to obtain the initial values. One year later, the marked apple trees were measured again as the final values, measuring plant height, trunk diameter, leaf chlorophyll content, counting the number of plant branches and measuring branch length.

[0166] The results are shown in Table 17. The survival rate of Daphne odora red apple seedlings planted in the KF-B6 treatment group was as high as 94.00%, which was 16.05% higher than that in the CK treatment group. The plant height growth rate, stem diameter growth rate, chlorophyll content, branch number and branch length increased by 31.14%, 30.26%, 11.15%, 24.32% and 25.14%, respectively. Therefore, KF-B6 bacteria and its bacterial agent can not only increase the survival rate of the new variety of Daphne odora red apple in the continuous cropping orchard, but also have a significant promoting effect on its growth.

[0167] Table 17 Effects on the survival rate and plant growth of apples in continuous cropping orchards

[0168] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A microbial agent or composite microbial fertilizer comprising Paenibacillus eihime, characterized in that: The Ehime Bacillus is specifically Ehime Bacillus ( Paenibacillus ehimensis )KF-B6, the deposit number is CGMCCNo.32131.

2. The microbial agent comprising Paenibacillus eihime according to claim 1, characterized in that: The preparation method of the bacterial agent is as follows: inoculating a spore suspension of Paenibacillus erythritol KF-B6 into a fermentation medium for producing EPS, culturing until the fermentation liquid is viscous and more than 95% of the spores are found under a microscope, thereby obtaining a KF-B6 fermentation liquid containing EPS; and adding any one or more of a synergist, an osmotic salt system stabilizer, an antifreeze agent, an emulsifier and a preservative to the fermentation liquid, thereby obtaining a bacterial agent containing Paenibacillus erythritol KF-B6.

3. The microbial agent comprising Paenibacillus eihime according to claim 2, characterized in that: The EPS-producing fermentation medium comprises: 15.0-25.0 g sucrose, 1.5-2.5 g corn steep liquor powder, 1.5-2.5 g CaCO3, 0.5-1.5 g K2HPO4·3H2O, 0.25-0.75 g MgSO4·7H2O, 0.25-0.75 g MnSO4·H2O, 1 L distilled water, and pH 7.0-7.

3.

4. The microbial agent comprising Paenibacillus eihime according to claim 2, characterized in that: The synergist includes but is not limited to mineral potassium humate and seaweed liquid; the osmotic salt system stabilizer includes but is not limited to potassium dihydrogen phosphate; the antifreeze agent includes but is not limited to ethylene glycol; the emulsifier includes but is not limited to OP-10; the preservative includes but is not limited to sodium dehydroacetate.

5. The microbial agent comprising Paenibacillus eihime according to claim 2, characterized in that: The specific preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and place in a water bath at 80°C for 5 min to obtain a spore suspension inoculant. (2) EPS-producing liquid fermentation: Inoculate the spore suspension at a rate of 5-10% into the EPS-producing liquid medium A, and culture until the fermentation liquid becomes viscous and more than 95% of the spores are detected under a microscope, thereby obtaining the EPS-containing KF-B6 fermentation liquid; The liquid culture medium A is composed of: sucrose 15.0-25.0 g, corn steep liquor dry powder 1.5-2.5 g, CaCO3 1.5-2.5 g, K2HPO4·3H2O 0.5-1.5 g, MgSO4·7H2O 0.25-0.75 g, MnSO4·H2O 0.25-0.75 g, distilled water 1 L, pH 7.0-7.3; (3) Preparation of KF-B6 liquid microbial agent: Add 10-15% mineral potassium humate, 3.0-4.5% potassium dihydrogen phosphate, 1.5-3.5% seaweed liquid with a pH of 7.0, 3.0-5.0% ethylene glycol, 1.5-2.5% OP-10, and 0.05-0.1% sodium dehydroacetate to the KF-B6 fermentation liquid containing EPS, and mix thoroughly to obtain the KF-B6 microbial agent.

6. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 1, characterized in that: The preparation method of the composite microbial fertilizer is as follows: inoculating Ehime Bacillus KF-B6 seed liquid into a fermentation medium, and culturing until the spore rate in the fermentation liquid is greater than 95% and the number of effective live bacteria is greater than 600 million / mL to obtain a fermentation liquid; after the KF-B6 fermentation liquid is evenly mixed with a sterilized carrier, thickly spread in a constant temperature culture room and ventilated and cultured until the moisture content is less than 10%, to obtain a KF-B6 composite microbial fertilizer.

7. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 6, characterized in that: The fermentation medium is composed of: 4.0-6.0 g yeast extract powder, 4.0-6.0 g soybean meal powder, 0.50-1.50 g K2HPO4·3H2O, and 0.50-1.50 g MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural.

8. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 6, characterized in that: The carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:

1.

9. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 6, characterized in that: The specific preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and place in a water bath at 80°C for 5 min to obtain a spore suspension inoculant. (2) Seed liquid culture: Inoculate the slant spore suspension into liquid culture medium B at a 5-10% inoculation rate, and culture at 35-45°C and 150-200 rpm for 16-20 hours to obtain seed liquid; The liquid culture medium B is composed of: 4.0-6.0 g yeast extract powder, 4.0-6.0 g soybean meal powder, 0.50-1.50 g K2HPO4·3H2O, and 0.50-1.50 g MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, distilled water 1L, pH natural; (3) Fermentation culture: Inoculate the seed liquid into liquid culture medium C at an inoculation rate of 5-10% to obtain fermentation liquid, in which the spore rate is >95% and the bacterial activity is >600 million / mL; The liquid culture medium C is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural; (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 and the sterilized carrier are mixed evenly in a volume-to-mass ratio of 1:2-1:3, the mixture is spread in a 15 cm-20 cm thickness in a constant temperature culture room at 35-45°C and ventilated for 5-7 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer; The carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:

1.

10. Use of the microbial agent or compound microbial fertilizer containing Paenibacillus erythritol as claimed in claim 1 in preventing and controlling apple continuous cropping problems.

Images