Oxygen-resistant photosynthetic nitrogen-fixing engineering bacterium as well as construction method and application thereof

Abstract

The invention discloses an oxygen-resistant photosynthetic nitrogen-fixing engineering bacterium as well as a construction method and application thereof. The oxygen-resistant photosynthetic nitrogen fixation engineering bacterium disclosed by the invention does not contain a fixL gene and a fixJ gene. The photosynthetic nitrogen-fixing engineering bacteria disclosed by the invention can be used for nitrogen-fixing growth under an aerobic condition. The obtained photosynthetic nitrogen-fixing engineering bacterium breaks through the limitation that oxygen inhibits nitrogenase expression, nitrogen fixation under the aerobic condition is achieved, the nitrogen-fixing efficiency and nitrogen-fixing stability of photosynthetic microorganisms are improved, a theoretical basis is provided for developing rhodopseudomonas palustris as an efficient photosynthetic nitrogen-fixing microbial agent and expanding application of rhodopseudomonas palustris in the fields of industry and agriculture, and the photosynthetic nitrogen-fixing engineering bacterium has a wide application prospect. Good application prospects are realized.

Description

Technical Field

[0001] The invention relates to an oxygen-tolerant photosynthetic nitrogen-fixing engineering bacterium and a construction method and application thereof in the field of microbial engineering. Background Art

[0002] my country is a country with a large population in the world. In order to improve the level of food self-sufficiency, in agricultural production, people apply nitrogen-fixing bacterial fertilizers to achieve weight loss and efficiency while increasing crop yields. However, for non-leguminous crops, symbiotic nitrogen fixation and combined nitrogen-fixing bacterial fertilizers cannot significantly improve their yield and quality. The self-generated photosynthetic nitrogen-fixing bacteria, Rhodopseudomonas palustris, can effectively utilize renewable light energy for its growth metabolism, as well as provide a continuous supply of energy for the high-energy-consuming microbial nitrogen fixation process, so it shows very good application prospects in the development of microbial nitrogen-fixing agents.

[0003] Since Rhodopseudomonas palustris is a facultative anaerobic bacterium, it fixes nitrogen under anaerobic conditions, but the nitrogen fixation process is inhibited under aerobic conditions, which limits the stability of the nitrogen fixation process of Rhodopseudomonas palustris. Using genetic engineering methods, the two-component system FixLJ of oxygen signal sensing of Rhodopseudomonas palustris was knocked out to construct oxygen-tolerant genetically engineered bacteria, which relieved the inhibition of oxygen in the environment on the expression of nitrogenase, and greatly increased the expression level of iron nitrogenase under ammonium conditions, which can be used as nitrogen-fixing bacterial fertilizer to meet the needs of industrial and agricultural production. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to relieve the oxygen inhibition of Rhodopseudomonas palustris.

[0005] In order to solve the above technical problems, the present invention first provides an engineered bacterium of Rhodopseudomonas palustris, wherein the engineered bacterium of Rhodopseudomonas palustris has the following characteristics:

[0006] A1) does not contain the fixL gene or contains a substance in which the fixL gene is knocked out or contains a substance that reduces the content or activity of the fixL protein;

[0007] A2) does not contain the fixJ gene, contains a substance in which the fixJ gene is knocked out, or contains a substance that reduces the content or activity of the fixJ protein.

[0008] The present invention also provides a method for preparing an engineered bacterium of Rhodopseudomonas palustris, the method comprising: using Rhodopseudomonas palustris as a receptor bacterium, and performing transformations including steps B1) and B2) on the receptor bacterium to obtain an engineered bacterium of Rhodopseudomonas palustris;

[0009] B1) knocking out the fixL gene in the recipient bacteria or reducing the content or activity of the fixL protein in the recipient bacteria;

[0010] B2) knocking out the fixJ gene in the recipient bacteria or reducing the content or activity of the fixJ protein in the recipient bacteria.

[0011] In one embodiment of the present invention, the recipient bacteria is Rhodopseudomonas palustris CGA009.

[0012] The present invention also provides a bacterial agent, the active ingredient of the bacterial agent is the engineered bacterium Rhodopseudomonas palustris.

[0013] The bacterial agent can be used to prepare nitrogen-fixing bacterial fertilizer or microbial bacterial fertilizer.

[0014] In the above-mentioned bacterial agent, the bacterial agent may further include a carrier. The carrier may be a solid carrier or a liquid carrier. The solid carrier may be a mineral material, a plant material or a polymer compound; the mineral material may be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica and diatomaceous earth; the plant material may be at least one of corn flour, soybean flour and starch; the polymer compound may be polyvinyl alcohol and / or polyglycol. The liquid carrier may be an organic solvent, vegetable oil, mineral oil or water; the organic solvent may be decane and / or dodecane. In the bacterial agent, the active ingredient may be present in the form of cultured living cells, fermentation broth of living cells, filtrate of cell culture or a mixture of cells and filtrate. The dosage form of the composition may be a variety of dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water-dispersible granule.

[0015] As required, a surfactant (such as Tween 20, Tween 80, etc.), a binder, a stabilizer (such as an antioxidant), a pH adjuster, etc. may also be added to the bacterial agent.

[0016] The use of the engineered Rhodopseudomonas palustris in the preparation of microbial fertilizers, or in the preparation of nitrogen-fixing fertilizers, also falls within the protection scope of the present invention.

[0017] The application of the method for preparing engineered Rhodopseudomonas palustris in the preparation of microbial fertilizers or in the preparation of nitrogen-fixing fertilizers also falls within the protection scope of the present invention.

[0018] The present invention also provides a method for relieving oxygen inhibition of Rhodopseudomonas palustris, the method comprising: performing transformations including B1) and B2) on Rhodopseudomonas palustris to obtain an engineered strain of Rhodopseudomonas palustris having the ability to relieve oxygen inhibition;

[0019] B1) knocking out the fixL gene in the recipient bacteria or reducing the content or activity of the fixL protein in the recipient bacteria;

[0020] B2) knocking out the fixJ gene in the recipient bacteria or reducing the content or activity of the fixJ protein in the recipient bacteria.

[0021] In an embodiment of the present invention, the fixL gene encodes the fixL protein shown in SEQ ID No.2, and its sequence is shown in positions 1-1527 of SEQ ID No.1; the fixJ gene encodes the fixJ protein shown in SEQ ID No.3, and its sequence is shown in positions 1520-2131 of SEQ ID No.1.

[0022] The Rhodopseudomonas palustris engineered bacteria of the present invention can grow by nitrogen fixation under aerobic conditions. The Rhodopseudomonas palustris engineered bacteria obtained by the present invention breaks through the limitation that oxygen inhibits the expression of nitrogenase, realizes nitrogen fixation under aerobic conditions, helps to improve the nitrogen fixation efficiency and nitrogen fixation stability of photosynthetic microorganisms, provides a theoretical basis for developing Rhodopseudomonas palustris as a high-efficiency photosynthetic nitrogen-fixing bacterial agent, and expands its application in the fields of industry and agriculture, and has a good application prospect.

[0023] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the construction of recombinant plasmid.

[0025] Figure 2 This is the nucleic acid electrophoresis diagram for the identification of genetically engineered bacteria CGA3015. The lanes from left to right are Rhodopseudomonas palustris CGA009, CGA3015, CGA3015 and DNA molecular weight standards. The primers used for identification are LJ-test-F (CGGTCATCGCCTGACGGAACTC) and LJ-test-R (GAAACACCGCGAGCTTCGGGTTC).

[0026] Figure 3 It is the result of phenotypic identification of genetically engineered bacteria. A is a schematic diagram of nitrogen fixation growth of genetically engineered bacteria under aerobic conditions; B is a growth curve of genetically engineered bacteria under different culture conditions.

[0027] Figure 4 It is a schematic diagram of the nitrogenase activity of genetically engineered bacteria. DETAILED DESCRIPTION

[0028] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0029] Rhodopseudomonas palustris CGA009 strain is a wild-type strain, which is recorded in the article "Oda, Y. et al. Functional genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium Rhodopseudomonas palustris [J]. JOURNAL OF BACTERIOLOGY, Nov. 2005, p. 7784-7794". The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0030] Escherichia coli S17-1 strain, used for conjugative transfer, is described in "Simon R, Priefer U, Pühler A. 1983. A broad host mobilization system for in vivo genetic engineering: Transposon mutagenesis in Gram-negative bacteria [J]. Bio / Technolgy 1: 784–791." The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0031] Vector pJQ200SK is a suicide plasmid suitable for Gram-negative bacteria, which is recorded in "Jürgen Quandt, F. Hynes M. 1993. Versatile Suicide Vectors Which Allow Direct Selection for Gene Replacement in Gram-Negative Bacteria. Gene 127: 15-21." The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0032] Anaerobic culture conditions for Rhodopseudomonas palustris: 10 mL of culture medium was placed in a 25 mL anaerobic test tube, the upper layer was filled with nitrogen, and the light density was ≥ 30 μmol photons m –2 s –1 , cultured at 30℃.

[0033] Aerobic culture conditions for Rhodopseudomonas palustris: 10 ml of culture medium is placed in a 50 ml aerobic large test tube, covered with a breathable rubber stopper, and cultured at 30°C.

[0034] Nitrogen fixing medium (NFM): The solvent is water, and the solutes and their concentrations are 12.5 mM disodium hydrogen phosphate (Na2HPO4), 12.5 mM potassium dihydrogen phosphate (KH2PO4), 1 mL / L concentrated alkali, 0.1 mM sodium thiosulfate (Na2S2O3), 2 mg / L p-aminobenzoic acid (PABA), and 20 mM sodium acetate.

[0035] Non-nitrogen fixing medium (PM): a medium in which ammonium sulfate is added to nitrogen fixing medium to obtain a medium in which the mass percentage of ammonium sulfate is 0.1%.

[0036] Non-nitrogen-fixing solid culture medium: A solid culture medium is obtained by adding 1.5-2% agar powder to a non-nitrogen-fixing culture medium and replacing 20 mM sodium acetate therein with 10 mM sodium succinate.

[0037] PM resistance medium: A solid medium containing gentamicin at a concentration of 100 μg / mL obtained by adding gentamicin to a non-nitrogen fixing solid medium.

[0038] PM sucrose medium: A solid medium with a sucrose content of 10% by mass obtained by adding sucrose to a non-nitrogen fixing solid culture medium.

[0039] PM resistance sucrose-added medium: Sucrose and gentamicin are added to a non-nitrogen-fixing solid medium to obtain a solid medium with a sucrose content of 10% and a gentamicin concentration of 100 μg / mL.

[0040] CA solid culture medium: based on the nitrogen-fixing culture medium, remove the sodium acetate and replace it with 10 mM sodium succinate, add yeast powder with a final concentration of 0.2%, 0.5% acid casein, and 1.5-2% agar powder. The nitrogen-fixing culture medium and the additional part are sterilized at 121°C separately, mixed at low temperature, and poured into plates.

[0041] LB medium: The solvent is water, and the solutes and their concentrations are 0.5 g / 100 mL yeast powder, 1 g / 100 mL tryptone, and 1 g / 100 mL NaCl. Sterilize at 121°C. Add 20 μg / mL gentamicin as needed.

[0042] LB solid medium: Add agar powder to LB medium at a final concentration of 1.5-2%. Sterilize at 121℃.

[0043] Concentrated alkali: The solvent is water, and the solutes and their concentrations are 20 g / L aminotriacetic acid (NTA), 28.9 g / L anhydrous magnesium sulfate (MgSO4), 6.67 g / L CaCl2·2H2O, and 0.0185 g / L (NH4)6Mo7O 24 ·4H2O, 0.198g / L FeSO4·7H2O, 100mL / L Metal 44. Dissolve NTA separately in 600mL water and neutralize with KOH (14.6g KOH), add other components and dissolve in the order given. Adjust pH to 6.8 before making a final volume of 1L. A precipitate forms when the pH is adjusted from acidic to 6.8 with KOH (approximately 100mL of 1M KOH is required), but it will eventually redissolve with stirring. The color of the solution changes from dark yellow to straw green as the pH approaches 6.8. Filter sterilize and store in a glass bottle wrapped in aluminum foil. Store at 4°C for at least one year.

[0044] Metal 44: The solvent is water, and the solutes and their concentrations are 2.5 g / L EDTA, 10.95 g / L ZnSO4·7H2O, 5 g / L FeSO4·7H2O, 1.54 g / L MnSO4·H2O, 0.392 g / L CuSO4·5H2O, 0.25 g / L Co(NO3)2·6H2O, and 0.177 g / L Na2B4O7·10H2O. Add EDTA to 800 mL of distilled water and stir, and adjust the pH to about 5.0 with 10 M NaOH to dissolve the EDTA. Add the other metal compounds in the order given (do not add components until the previous one is completely dissolved), and make up the volume to 1 L (final pH is about 2.4, clear lemon green solution). Filter sterilize and store in a glass bottle wrapped in aluminum foil. It can be stored indefinitely at 4°C.

[0045] The gas phase analysis method for nitrogen-fixing bacteria phenotype and nitrogenase activity is:

[0046] Gas chromatography conditions: A flame ionization detector (FID) and a Porapak N column (matrix 80 / 100, 6.0ft (1.8m) × 1 / 8in. × 2.1mm) were used to detect methane, acetylene, ethylene and ethane. The temperatures of the injector, detector and column oven were 120°C, 60°C and 150°C, respectively. Argon was used as a carrier and the flow rate was 25mL / min. A thermal conductivity detector (TCD) and a Molecular Sieve5A column (matrix 60 / 80, 6.0ft (1.8m) × 1 / 8in. × 2.1mm) were used to detect hydrogen. The temperatures of the injector, detector and column oven were 85°C, 60°C and 120°C, respectively. Argon was used as a carrier and the flow rate was 25mL / min. The injection volume was 100μL.

[0047] Example 1. Construction of genetically engineered bacteria CGA3015

[0048] The CGA009 strain of Rhodopseudomonas palustris was used as the starting strain, and its micro-oxygen regulator fixLJ gene was deleted and mutated in the genome ( Figure 1 ). The specific steps are as follows:

[0049] The genomic DNA of Rhodopseudomonas palustris CGA009 strain was used as a template, and PCR amplification was performed using pJQ-fixL-up-F and pJQ-fixL-up-R (primer sequences are shown in Table 1). The resulting PCR product was the 1170 bp upstream homology arm required for knocking out fixLJ. The PCR amplification was performed using pJQ-fixJ-down-F and pJQ-fixJ-down-R (primer sequences are shown in Table 1). The resulting PCR product was the 1175 bp downstream homology arm required for knocking out fixLJ. The upstream and downstream homology arms of about 1000 bp required for knocking out fixLJ in the obtained Rhodopseudomonas palustris CGA009 genome were constructed at the BamHI restriction site of the plasmid pJQ200SK by homologous recombination. The recombinant plasmid with the correct sequence and containing both the upstream homology arm and the downstream homology arm was recorded as pJQ-△fixLJ ( Figure 1); pJQ-△fixLJ was transferred into Escherichia coli S17-1, and then the recombinant strain carrying the recombinant plasmid was conjugated to transform the CGA009 strain of Rhodopseudomonas palustris. The clones were screened in CA solid medium, PM resistance medium, PM sucrose medium, and PM resistance plus sucrose medium. The clones that did not grow on PM resistance plus sucrose medium but grew on PM sucrose medium were the possible correct clones. The clones were identified by PCR ( Figure 2 ) and sequencing. The colonies with the correct sequences were the successfully constructed bacteria. The corresponding colonies were picked and inoculated into PM medium and cultured at 30°C under light to obtain the fixLJ deletion mutant bacteria, which were recorded as CGA3015 and stored in glycerol tubes at -80°C for long-term storage.

[0050] CGA3015 is a strain obtained by knocking out the fixLJ gene (as shown in the sequence SEQID NO.1) in the genomic DNA of the Rhodopseudomonas palustris strain CGA009.

[0051] Among them, the 1st to 1527th positions of SEQ ID NO.1 represent the fixL gene, encoding the fixL protein shown in SEQ ID No.2; the 1520th to 2131st positions represent the fixJ gene, encoding the fixJ protein shown in SEQ ID No.3.

[0052] Table 1

[0053]

[0054]

[0055] Example 2: Phenotypic Identification of Genetically Engineered Bacteria

[0056] Under aerobic nitrogen fixation culture conditions, the phenotype of the genetically engineered bacteria CGA3015 was detected with the starting strain CGA009 as the control. The culture medium used was NFM nitrogen fixation medium. After two days of culture, it was clearly seen that the genetically engineered bacteria CGA3015 became turbid, while the starting strain CGA009 was still relatively clear ( Figure 3 Therefore, the phenotype can be detected by measuring the growth curve under different culture conditions.

[0057] Anaerobic culture in NFM nitrogen-fixing medium and PM non-nitrogen-fixing medium was used as control, and aerobic culture was carried out in NFM nitrogen-fixing medium and PM non-nitrogen-fixing medium to determine the growth curves of the two strains, and each experiment was repeated 3 times.

[0058] Through the above experiments, it was found that strain CGA3015 can grow normally under aerobic nitrogen fixation conditions ( Figure 3 Middle B), oxygen inhibition is relieved.

[0059] Example 3: Detection of nitrogenase activity expressed by genetically engineered bacteria

[0060] The activity of nitrogenase can be quantitatively detected by the acetylene reduction method, in which molybdenum nitrogenase can reduce acetylene to ethylene, and the nitrogenase can be qualitatively characterized based on gas chromatography detection.

[0061] The nitrogenase activity of the fixLJ deletion mutant strain Rhodopseudomonas palustris CGA3015 aerobically cultured in NFM medium was detected, with the wild-type strain CGA009 aerobically cultured in NFM medium as the control. 660nm When the pH reaches 0.4-0.5, transfer the bacterial solution to an anaerobic tube to extract air to consume oxygen, and then transfer it to a nitrogen anaerobic tube containing 0.5% acetylene. After standing at 30°C for 8 hours, the catalytic product is detected. Then, 1 mL of bacterial solution is taken, centrifuged at 12000 rpm for 1 min, and the bacteria are collected by centrifugation. They are resuspended with 200 μl 1M NaOH, boiled for 15 min, and centrifuged at 12000 rpm for 1 min. The protein concentration of the supernatant is determined by the Bradford protein concentration determination kit. The gas production per unit protein concentration of each strain is calculated. Each experiment is repeated 3 times.

[0062] Gas chromatography revealed that the genetically engineered bacteria CGA3015 could reduce acetylene to ethylene under aerobic nitrogen fixation conditions ( Figure 4 ), indicating that the genetically engineered bacteria CGA3015 expressed active molybdenum nitrogenase.

[0063] The invention obtains a genetically engineered bacterium resistant to oxygen and expressing nitrogenase by means of genetic engineering technology, which provides a good foundation for the future development of nitrogen-fixing bacterial fertilizer and its promotion and application in industrial and agricultural production.

[0064] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. An engineered bacterium of Rhodopseudomonas palustris, comprising the following characteristics: A1) does not contain the fixL gene or contains a substance in which the fixL gene is knocked out or contains a substance that reduces the content or activity of the fixL protein; A2) does not contain the fixJ gene, contains a substance in which the fixJ gene is knocked out, or contains a substance that reduces the content or activity of the fixJ protein.

2. A method for preparing an engineered bacterium of Rhodopseudomonas palustris, comprising: Using Rhodopseudomonas palustris as a recipient bacterium, and performing transformations including B1) and B2) on the recipient bacterium to obtain an engineered Rhodopseudomonas palustris bacterium; B1) knocking out the fixL gene in the recipient bacteria or reducing the content or activity of the fixL protein in the recipient bacteria; B2) knocking out the fixJ gene in the recipient bacteria or reducing the content or activity of the fixJ protein in the recipient bacteria.

3. The method according to claim 2, characterized in that: The recipient bacteria is Rhodopseudomonas palustris CGA009.

4. The engineered bacteria of Rhodopseudomonas palustris obtained by the method according to claim 2 or 3.

5. A bacterial agent, characterized in that: The active ingredient of the bacterial agent is the engineered bacteria of Rhodopseudomonas palustris as described in claim 1 or 4.

6. Use of the engineered bacteria of Rhodopseudomonas palustris according to claim 1 or 4 in the preparation of microbial fertilizer, or in the preparation of nitrogen-fixing fertilizer.

7. Use of the method according to claim 2 or 3 in preparing microbial fertilizer, or in preparing nitrogen-fixing fertilizer.

8. A method for relieving oxygen inhibition of Rhodopseudomonas palustris, comprising: The Rhodopseudomonas palustris is modified by steps B1) and B2) to obtain an engineered strain of Rhodopseudomonas palustris with the ability to relieve oxygen inhibition; B1) knocking out the fixL gene in the recipient bacteria or reducing the content or activity of the fixL protein in the recipient bacteria; B2) knocking out the fixJ gene in the recipient bacteria or reducing the content or activity of the fixJ protein in the recipient bacteria.

Images