Reagent and method for enhancing tolerance of PCR (Polymerase Chain Reaction) inhibitor and application

Abstract

The invention provides a reagent and a method for enhancing the tolerance of a PCR (Polymerase Chain Reaction) inhibitor and application. The reagent comprises arginine and sodium lauroyl sarcosinate, the method comprises the step of adding arginine and sodium lauroyl sarcosinate into a reagent for PCR (Polymerase Chain Reaction) amplification. The reagent disclosed by the invention has relatively strong tolerance to interference of inhibitors such as non-target nucleic acid and the like. The method is simple to operate, low in cost and high in nucleic acid detection sensitivity. The reagent and the method have good application prospects in detection of nucleic acid extracted from samples such as whole blood, urine, sputum and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a reagent, a method and an application for enhancing tolerance to PCR inhibitors. Background Art

[0002] Fluorescence PCR technology is an important application technology in molecular diagnosis. It is widely used in pathogen detection, genetic disease diagnosis and tumor molecular detection. Its detection samples include whole blood, urine, sputum, alveolar lavage fluid, exfoliated cells and other types. These samples are usually extracted and purified by nucleic acid to obtain nucleic acids that can be used for PCR detection. Due to the complex background of these samples, they are highly inhibitory to PCR amplification detection. Common amplification inhibitors include non-target genomic nucleic acids, high concentrations of proteins and lipids, as well as drugs or other metabolites ingested by the human body. These inhibitors are difficult to completely remove through nucleic acid extraction and purification. In particular, non-target genomic nucleic acids are usually extracted together with target nucleic acids and cannot be distinguished and removed. To achieve ideal detection performance, the anti-inhibition property of the amplification reagent is crucial.

[0003] Chinese patent CN116179656A discloses that by adding one or more of bovine serum albumin, raffinose and dithiothreitol as additives to the qPCR amplification reaction solution, it is beneficial to improve the amplification efficiency and sensitivity of blood samples, and has good compatibility with different amplification reaction systems. Chinese patent CN111218502A discloses a composition for improving the detection performance of fluorescent quantitative PCR, the composition comprising: bovine serum albumin, sorbitol, ammonium sulfate, formamide and tetramethylammonium chloride and at least one of dithiothreitol and betaine; using the composition of the present invention, the sensitivity, specificity and anti-interference of fluorescent quantitative PCR can be improved. Chinese patent CN 117327772 A discloses a composition for enhancing tolerance to PCR inhibitors, the composition containing 3 to 7 parts by weight of trehalose, 0.5 to 1.0 parts by weight of arginine, 0.5 to 1.0 parts by weight of bovine serum albumin, 0.005 to 0.015 parts by weight of polyethylene glycol, 3 to 7 parts by weight of glycerol and 0.5 to 1.5 parts by weight of Triton X-100. However, the inventors found that the added components mentioned in the above patents have limited effect in improving amplification inhibition, especially inhibition of non-target genomic nucleic acids in the sample. Summary of the invention

[0004] Based on this, the object of the present invention is to provide a reagent, method and application for enhancing tolerance to PCR inhibitors. The reagent of the present invention has strong tolerance to interference from inhibitors such as non-target nucleic acids. The method of the present invention is simple to operate, low in cost and has high sensitivity in nucleic acid detection. The reagent and method of the present invention have good application prospects in detecting nucleic acids extracted from samples such as whole blood, urine, and sputum.

[0005] The purpose of the present invention is achieved through the following technical solutions.

[0006] In a first aspect, the present invention provides use of a combination of arginine and sodium lauroyl sarcosinate in enhancing PCR inhibitor tolerance.

[0007] In some embodiments of the present invention, in the composition, the mass ratio of arginine to sodium lauroyl sarcosinate is (0.1-1):(0.1-2).

[0008] In some embodiments of the present invention, in the composition, the mass ratio of arginine to sodium lauroyl sarcosinate is (0.2-0.3):(0.4-0.8).

[0009] In some embodiments of the present invention, in the composition, the mass ratio of arginine to sodium lauroyl sarcosinate is 0.2:0.5.

[0010] In a second aspect, the present invention provides a reagent for enhancing tolerance to PCR inhibitors, the reagent comprising arginine and sodium lauroyl sarcosinate.

[0011] In some embodiments of the present invention, in the reagent, the concentration of arginine is 0.1-1 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL.

[0012] In some embodiments of the present invention, in the reagent, the concentration of arginine is 0.1-1 g / mL, which means that the concentration of arginine can be selected from any value of the following concentrations or any value between any two of them: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 g / mL.

[0013] In some embodiments of the present invention, in the reagent, the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL, which means that the concentration of sodium lauroyl sarcosinate can be selected from any value of the following concentrations or any value between any two of them: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 g / mL.

[0014] In some embodiments of the present invention, in the reagent, the concentration of arginine is 0.2-0.3 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.4-0.8 g / mL.

[0015] In some embodiments of the present invention, in the reagent, the concentration of arginine is 0.2 g / mL, and the concentration of sodium lauroyl sarcosinate is 0.5 g / mL.

[0016] In some embodiments of the present invention, the reagent further comprises one or more of pH buffer, divalent salt particles, monovalent cations, DNA polymerase, dNTPs, UDG, BSA, etc.

[0017] In some embodiments of the present invention, the pH buffer is selected from one of Tris buffer, PBS buffer, Trcine buffer, HEPES buffer, MOPS buffer and the like.

[0018] In some embodiments of the present invention, in the reagent, the concentration of the pH buffer is 30-50 mM.

[0019] In some embodiments of the present invention, the divalent salt particles are selected from one or more of MgCl2, MnCl2, etc.

[0020] In some embodiments of the present invention, in the reagent, the concentration of the divalent salt particles is 3-5 mM.

[0021] In some embodiments of the present invention, the monovalent cation is selected from K + NH4 + 、Na + , Li + One or more of the above.

[0022] In some embodiments of the present invention, in the reagent, the concentration of the monovalent cation is 10 to 30 mM.

[0023] In some embodiments of the present invention, the DNA polymerase is Taq DNA polymerase.

[0024] In some embodiments of the present invention, the concentration of the DNA polymerase in the reagent is 4-6U.

[0025] In some embodiments of the present invention, the dNTPs include dATP, dCTP, dGTP and dUTP and the molar ratio of dATP, dCTP, dGTP and dUTP is 1:1:1:2.

[0026] In some embodiments of the present invention, in the reagent, the concentration of the dNTPs is 0.5-1.5 mM.

[0027] In a third aspect, the present invention provides a method for enhancing tolerance to PCR inhibitors, the method comprising adding arginine and sodium lauroyl sarcosinate to a reagent for PCR amplification.

[0028] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of arginine is 0.1-1 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL.

[0029] In some embodiments of the present invention, in the reagent, the concentration of arginine is 0.1-1 g / mL, which means that the concentration of arginine can be selected from any value of the following concentrations or any value between any two of them: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 g / mL.

[0030] In some embodiments of the present invention, in the reagent, the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL, which means that the concentration of sodium lauroyl sarcosinate can be selected from any value of the following concentrations or any value between any two of them: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 g / mL.

[0031] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of arginine is 0.2-0.3 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.4-0.8 g / mL.

[0032] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of arginine is 0.2 g / mL, and the concentration of sodium lauroyl sarcosinate is 0.5 g / mL.

[0033] In some embodiments of the present invention, the reagents for PCR amplification further include one or more of pH buffer, divalent salt particles, monovalent cations, DNA polymerase, dNTPs, primers, probes, UDG, BSA, etc.

[0034] In some embodiments of the present invention, the pH buffer is selected from one of Tris buffer, PBS buffer, Trcine buffer, HEPES buffer, MOPS buffer and the like.

[0035] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of the pH buffer is 30-50 mM.

[0036] In some embodiments of the present invention, the divalent salt particles are selected from one or more of MgCl2, MnCl2, etc.

[0037] In some embodiments of the present invention, the concentration of the divalent salt particles in the reagent for PCR amplification is 3-5 mM.

[0038] In some embodiments of the present invention, the monovalent cation is selected from K + NH4 + 、Na + , Li + One or more of the above.

[0039] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of the monovalent cation is 10 to 30 mM.

[0040] In some embodiments of the present invention, the DNA polymerase is Taq DNA polymerase.

[0041] In some embodiments of the present invention, the concentration of the DNA polymerase in the reagent for PCR amplification is 4-6U.

[0042] In some embodiments of the present invention, the dNTPs include dATP, dCTP, dGTP and dUTP and the molar ratio of dATP, dCTP, dGTP and dUTP is 1:1:1:2.

[0043] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of the dNTPs is 0.5-1.5 mM.

[0044] In some embodiments of the present invention, the primers include an upstream primer and a downstream primer; preferably, in the reagent for PCR amplification, the concentration of the downstream primer is higher than the concentration of the upstream primer; more preferably, in the reagent for PCR amplification, the concentration of the downstream primer is 300-500 mM, and the concentration of the upstream primer is 50-150 mM.

[0045] In some embodiments of the present invention, the concentration of the probe in the reagent for PCR amplification is 150-250 mM.

[0046] In some embodiments of the present invention, the concentration of UDG in the reagent for PCR amplification is 0.5-1.5U.

[0047] In some embodiments of the present invention, in the reagent for PCR amplification, the concentration of BSA is 1 to 5 g / mL.

[0048] In a fourth aspect, the present invention provides a nucleic acid detection kit, which includes the reagent described in the second aspect or the reagent for PCR amplification defined in the third aspect.

[0049] In a fifth aspect, the present invention provides the use of the reagent described in the second aspect, the method described in the third aspect, and the kit described in the fourth aspect in nucleic acid detection for purposes other than disease diagnosis and treatment.

[0050] In some embodiments of the present invention, the nucleic acid is extracted from any one or more samples including whole blood, urine, sputum, alveolar lavage fluid, and exfoliated cells; preferably, the nucleic acid extraction method includes a magnetic bead method.

[0051] In some embodiments of the present invention, the nucleic acid detection includes detection using fluorescent PCR detection technology; preferably, it also includes further performing a melting curve analysis on the amplified product.

[0052] The beneficial effects of the present invention are as follows:

[0053] The reagent of the present invention has strong tolerance to interference from inhibitors such as non-target nucleic acids. The method of the present invention is simple to operate, low in cost and has high sensitivity in nucleic acid detection. The reagent and method of the present invention have good application prospects in detecting nucleic acids extracted from samples such as whole blood, urine, and sputum. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is a melting curve obtained according to the method of Example 1.

[0055] Figure 2 It is a melting curve diagram obtained by performing melting curve analysis after PCR amplification with reagent 1 and reagent 2 according to the method of Example 2.

[0056] Figure 3 It is a melting curve diagram obtained by performing melting curve analysis after PCR amplification with reagent 1 and reagent 3 according to the method of Example 2.

[0057] Figure 4 This is a melting curve diagram obtained by performing melting curve analysis after PCR amplification with reagent 1 and reagent 4 according to the method of Example 2.

[0058] Figure 5 This is a melting curve diagram obtained by performing PCR amplification using reagents 1, 2, 5, and 6 according to the method of Example 3 and then performing melting curve analysis.

[0059] Figure 6 This is a melting curve diagram obtained by performing PCR amplification using reagents 1, 2, 7, and 8 according to the method of Example 3 and then performing melting curve analysis.

[0060] Figure 7 It is a melting curve diagram obtained by performing PCR amplification using reagents 2, 9, and 10 and then performing melting curve analysis according to the method of Example 4.

[0061] Figure 8 This is a melting curve diagram obtained by performing PCR amplification using reagents 2, 11, and 12 and then performing melting curve analysis according to the method of Example 5.

[0062] Fig. 9 This is a melting curve diagram obtained by performing PCR amplification using reagents 2, 13, and 14 and then performing melting curve analysis according to the method of Example 5.

[0063] Due to the limitation of the source of background nucleic acid and the amount of nucleic acid extracted each time, it is impossible to obtain a large amount of background nucleic acid from the same source at one time. The background nucleic acid (i.e., the main inhibitor) corresponding to each reagent in the same figure above is the same, and the background nucleic acid (i.e., the main inhibitor) corresponding to different figures is different; for example, Figure 8 and Fig. 9 The samples to be tested are two test samples obtained by mixing two nucleic acid samples extracted from two sputums with plasmid DNA respectively. DETAILED DESCRIPTION

[0064] The following examples further illustrate the technology of the present invention. These examples are for illustration and example of the present invention and are not intended to limit the scope of the present invention in any form.

[0065] The plasmid DNA used in the following examples was synthesized by Zixi Biotechnology Co., Ltd., and the sequence of the plasmid DNA was: GGTGCCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTACGGTCGGCGAGCTGATCCAAAACCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATT CATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTG CCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTCGGGTCATCGAAACGCCGTACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCG.

[0066] A set of primer pairs and probes were designed for amplification of the above plasmid DNA, among which:

[0067] The sequence of the upstream primer is ACGTGGAGGCGATCACACC,

[0068] The sequence of the downstream primer is: GTGCGCACGCTCACGTCACAGACCGCC,

[0069] The sequence of the probe is:

[0070] CCGACAGCCGAGCCAATTCA / iFAMdT / GGACCAGAATTACCAGCTGTCGGG-BHQ1.

[0071] The following examples all use the upstream primer, downstream primer and probe mentioned here.

[0072] Example 1

[0073] The nucleic acid sample extracted from the human 293T cell line and the mixed plasmid DNA were used as the test sample (i.e., the nucleic acid in the nucleic acid sample extracted from the human 293T cell line was used as the background nucleic acid in the test sample, and the PCR inhibitor that inhibited the plasmid DNA amplification during the test sample amplification process was derived from the nucleic acid sample). The sample preparation process was as follows: 293T cells were extracted with a magnetic bead nucleic acid extraction reagent, the extracted nucleic acid was measured with a spectrophotometer to obtain an OD260 / 280 of 1.8, and the nucleic acid was fixed using digital PCR, and the concentration after the fixed value was 1E6 copies / reaction; plasmid DNA was added as a PCR detection template, and the added concentration was 10 copies / reaction. A group of pure plasmid DNA samples (i.e., not mixed with the nucleic acid sample extracted from the human 293T cell line, equivalent to not containing background nucleic acid) was set as the control group without inhibitors. The following PCR amplification reagents were used and the following amplification procedures were used for PCR amplification, and the amplification products were analyzed according to the melting curve analysis procedure:

[0074] Reagent 1: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0075] Reagent 2: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0076] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 65°C for 30 min, and extension at 72°C for 30 min, for a total of 50 cycles.

[0077] Melting curve analysis procedure: heating from 50 to 90 °C to make melting curve, with a heating rate of 0.05 °C / s.

[0078] The obtained melting curve is as follows Figure 1 As shown. Figure 1It can be seen that the detection rate and amplification signal of reagent 2 containing arginine and sodium lauroyl sarcosinate are significantly higher than those of reagent 1 not containing arginine and sodium lauroyl sarcosinate, and the amplification performance of reagent 2 under the background of 1E6 copies / reaction of cell-extracted nucleic acid is not significantly different from that of pure plasmid DNA samples without background nucleic acid (control group), indicating that the addition of arginine and sodium lauroyl sarcosinate in the amplification reagent has a strong tolerance to interference from high concentrations of non-target nucleic acids.

[0079] Example 2

[0080] The nucleic acid sample extracted from sputum and mixed with plasmid DNA were used as the test sample (i.e., the nucleic acid in the nucleic acid sample extracted from sputum was used as the background nucleic acid in the test sample, and the PCR inhibitors that inhibited the amplification of plasmid DNA in the test sample amplification process were derived from the nucleic acid sample). The sample preparation process was as follows: the sputum was extracted with a magnetic bead nucleic acid extraction reagent, and the concentration of the extracted nucleic acid was 193 ng / μL and OD260 / 280 was 1.8 using a spectrophotometer, and the nucleic acid was fixed using digital PCR, and the concentration after the fixed value was 1E6 copies / reaction; plasmid DNA was added as a PCR detection template, and the added concentration was 10 copies / reaction. The following PCR amplification reagents were used and the following amplification procedures were used for PCR amplification, and the amplification products were analyzed according to the melting curve analysis procedure:

[0081] Reagent 1: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0082] Reagent 2: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0083] Reagent 3: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0084] Reagent 4: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0085] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 65°C for 30 min, and extension at 72°C for 30 min, for a total of 50 cycles.

[0086] Melting curve analysis procedure: heating from 50 to 90 °C to make melting curve, with a heating rate of 0.05 °C / s.

[0087] The obtained melting curve is as follows Figure 2 , 3 , 4 (each reagent was analyzed twice). Figure 2 , 3 , 4 can be seen that the detection rate and amplification signal of reagent 1 without arginine and sodium lauroyl sarcosinate are the weakest. The detection rate and amplification signal of reagent 3 containing only arginine or reagent 4 containing only sodium lauroyl sarcosinate are improved compared with the amplification of reagent 1 without arginine and sodium lauroyl sarcosinate. When reagent 2 containing arginine and sodium lauroyl sarcosinate is used for amplification, the detection rate and amplification signal are the highest and the detection rate and amplification signal are significantly improved compared with reagents 1, 3, and 4, indicating that the addition of arginine and sodium lauroyl sarcosinate in the amplification reagent has a strong tolerance to the inhibitors of the test sample.

[0088] Example 3

[0089] The nucleic acid sample extracted from sputum and mixed with plasmid DNA were used as the test sample (i.e., the nucleic acid in the nucleic acid sample extracted from sputum was used as the background nucleic acid in the test sample, and the PCR inhibitors that inhibited the amplification of plasmid DNA in the test sample amplification process were derived from the nucleic acid sample). The sample preparation process was as follows: the sputum was extracted with a magnetic bead nucleic acid extraction reagent, and the concentration of the extracted nucleic acid was 193 ng / μL and OD260 / 280 was 1.8 using a spectrophotometer, and the nucleic acid was fixed using digital PCR, and the concentration after the fixed value was 1E6 copies / reaction; plasmid DNA was added as a PCR detection template, and the added concentration was 10 copies / reaction. The following PCR amplification reagents were used and the following amplification procedures were used for PCR amplification, and the amplification products were analyzed according to the melting curve analysis procedure:

[0090] Reagent 1: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0091] Reagent 2: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0092] Reagent 5: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.75g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0093] Reagent 6: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.2g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0094] Reagent 7: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.3g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0095] Reagent 8: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.1g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0096] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 65°C for 30 min, and extension at 72°C for 30 min, for a total of 50 cycles.

[0097] Melting curve analysis procedure: heating from 50 to 90 °C to make melting curve, with a heating rate of 0.05 °C / s.

[0098] The obtained melting curve is as follows Figure 5 , 6 As shown. Figure 5 It can be seen that when the concentration of sodium lauroyl sarcosinate is 0.5 g / mL, the detection rate and amplification signal are the strongest; Figure 6 It can be seen that when the concentration of arginine is 0.2 g / mL, the detection rate and amplification signal are the strongest.

[0099] Example 4

[0100] The nucleic acid sample extracted from sputum and mixed with plasmid DNA were used as the test sample (i.e., the nucleic acid in the nucleic acid sample extracted from sputum was used as the background nucleic acid in the test sample, and the PCR inhibitors that inhibited the amplification of plasmid DNA in the test sample amplification process were derived from the nucleic acid sample). The sample preparation process was as follows: the sputum was extracted with a magnetic bead nucleic acid extraction reagent, and the concentration of the extracted nucleic acid was 193 ng / μL and OD260 / 280 was 1.8 using a spectrophotometer, and the nucleic acid was fixed using digital PCR, and the concentration after the fixed value was 1E6 copies / reaction; plasmid DNA was added as a PCR detection template, and the added concentration was 10 copies / reaction. The following PCR amplification reagents were used and the following amplification procedures were used for PCR amplification, and the amplification products were analyzed according to the melting curve analysis procedure:

[0101] Reagent 2: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0102] Reagent 9: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, spermidine 0.5M, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0103] Reagent 10: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.5M, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0104] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 65°C for 30 min, and extension at 72°C for 30 min, for a total of 50 cycles.

[0105] Melting curve analysis procedure: heating from 50 to 90 °C to make melting curve, with a heating rate of 0.05 °C / s.

[0106] The obtained melting curve is as follows Figure 7 As shown. Figure 7 It can be seen that the detection rate and amplification signal of the reagent 9 containing spermidine or the reagent 10 containing arginine for amplification are obviously inferior to those of the reagent 2 containing arginine.

[0107] Example 5

[0108] The nucleic acid sample extracted from sputum and mixed with plasmid DNA were used as the test sample (i.e., the nucleic acid in the nucleic acid sample extracted from sputum was used as the background nucleic acid in the test sample, and the PCR inhibitors that inhibited the amplification of plasmid DNA in the test sample amplification process were derived from the nucleic acid sample). The sample preparation process was as follows: the sputum was extracted with a magnetic bead nucleic acid extraction reagent, and the concentration of the extracted nucleic acid was 193 ng / μL and OD260 / 280 was 1.8 using a spectrophotometer, and the nucleic acid was fixed using digital PCR, and the concentration after the fixed value was 1E6 copies / reaction; plasmid DNA was added as a PCR detection template, and the added concentration was 10 copies / reaction. The following PCR amplification reagents were used and the following amplification procedures were used for PCR amplification, and the amplification products were analyzed according to the melting curve analysis procedure:

[0109] Reagent 2: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium lauroyl sarcosinate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0110] Reagent 11: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium dodecylbenzenesulfonate 0.75g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0111] Reagent 12: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium dodecyl sulfate 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0112] Reagent 13: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH=9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, sodium deoxycholate 0.75g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0113] Reagent 14: upstream primer 100mM, downstream primer 400mM, probe 200mM, Tris buffer pH = 9.3 40mM, MgCl2 4mM, KCl 20Mm, dNTPs 1mM, Taq enzyme 5U, UDG 1U, BSA 3g / mL, arginine 0.2g / mL, 12-3-12 type Gemini quaternary ammonium salt 0.5g / mL, nucleic acid dosage 5μL; total volume 25μL.

[0114] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 65°C for 30 min, and extension at 72°C for 30 min, for a total of 50 cycles.

[0115] Melting curve analysis procedure: heating from 50 to 90 °C to make melting curve, with a heating rate of 0.05 °C / s.

[0116] The obtained melting curve is as follows Figure 8 , 9 As shown. Figure 8 , 9 It can be seen that the detection rate and amplification signal of the reagent containing sodium dodecylbenzene sulfonate, sodium dodecyl sulfate, sodium deoxycholate, and 12-3-12 Gemini quaternary ammonium salt for amplification are not as good as those of the reagent containing sodium lauroyl sarcosinate.

[0117] It should be noted that the embodiments described above are only used to explain the present invention and do not constitute any limitation of the present invention. The present invention has been described with reference to the embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present invention may be modified as specified within the scope of the claims of the present invention, and the present invention may be revised without departing from the scope and spirit of the present invention. Although the present invention described therein relates to specific methods, materials and embodiments, it does not mean that the present invention is limited to the specific examples disclosed therein, on the contrary, the present invention can be extended to all other methods and applications with the same functions.

Claims

1. Use of a combination of arginine and sodium lauroyl sarcosinate in enhancing PCR inhibitor tolerance.

2. The use according to claim 1, characterized in that: In the composition, the mass ratio of arginine to sodium lauroyl sarcosinate is (0.1-1):(0.1-2); preferably, the mass ratio of arginine to sodium lauroyl sarcosinate is (0.2-0.3):(0.4-0.8); more preferably, the mass ratio of arginine to sodium lauroyl sarcosinate is 0.2:0.

5.

3. A reagent for enhancing PCR inhibitor tolerance, characterized in that The reagents include arginine and sodium lauroyl sarcosinate.

4. The reagent according to claim 3, characterized in that In the reagent, the concentration of arginine is 0.1-1 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL; preferably, in the reagent, the concentration of arginine is 0.2-0.3 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.4-0.8 g / mL; more preferably, in the reagent, the concentration of arginine is 0.2 g / mL, and the concentration of sodium lauroyl sarcosinate is 0.5 g / mL.

5. The reagent according to claim 3 or 4, characterized in that The reagents further include one or more of pH buffer, divalent salt particles, monovalent cations, DNA polymerase, dNTPs, UDG, and BSA; preferably, The pH buffer is selected from one of Tris buffer, PBS buffer, Trcine buffer, HEPES buffer, and MOPS buffer; and / or In the reagent, the concentration of the pH buffer is 30 to 50 mM; and / or The divalent salt particles are selected from one or more of MgCl2 and MnCl2; and / or In the reagent, the concentration of the divalent salt particles is 3-5 mM; and / or The monovalent cation is selected from K + NH4 + 、Na + , Li + One or more of the following; and / or In the reagent, the concentration of the monovalent cation is 10 to 30 mM; and / or The DNA polymerase is Taq DNA polymerase; and / or In the reagent, the concentration of the DNA polymerase is 4 to 6 U; and / or The dNTPs include dATP, dCTP, dGTP and dUTP, and the molar ratio of dATP, dCTP, dGTP and dUTP is 1:1:1:2; and / or In the reagent, the concentration of the dNTPs is 0.5-1.5 mM.

6. A method for enhancing PCR inhibitor tolerance, characterized in that: The method comprises adding arginine and sodium lauroyl sarcosinate into a reagent for PCR amplification.

7. The method according to claim 6, characterized in that In the reagent for PCR amplification, the concentration of arginine is 0.1-1 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.1-2 g / mL; preferably, in the reagent for PCR amplification, the concentration of arginine is 0.2-0.3 g / mL, and / or the concentration of sodium lauroyl sarcosinate is 0.4-0.8 g / mL; more preferably, in the reagent for PCR amplification, the concentration of arginine is 0.2 g / mL, and the concentration of sodium lauroyl sarcosinate is 0.5 g / mL.

8. The method according to claim 6 or 7, characterized in that: The reagents for PCR amplification also include one or more of pH buffer, divalent salt particles, monovalent cations, DNA polymerase, dNTPs, primers, probes, UDG, and BSA; preferably, The pH buffer is selected from one of Tris buffer, PBS buffer, Trcine buffer, HEPES buffer, and MOPS buffer; and / or In the reagent for PCR amplification, the concentration of the pH buffer is 30-50 mM; and / or The divalent salt particles are selected from one or more of MgCl2 and MnCl2; and / or In the reagent for PCR amplification, the concentration of the divalent salt particles is 3-5 mM; and / or The monovalent cation is selected from K + NH4 + 、Na + , Li + One or more of the following; and / or In the reagent for PCR amplification, the concentration of the monovalent cation is 10 to 30 mM; and / or The DNA polymerase is Taq DNA polymerase; and / or In the reagent for PCR amplification, the concentration of the DNA polymerase is 4 to 6 U; and / or The dNTPs include dATP, dCTP, dGTP and dUTP, and the molar ratio of dATP, dCTP, dGTP and dUTP is 1:1:1:2; and / or In the reagent for PCR amplification, the concentration of dNTPs is 0.5-1.5 mM; and / or The primers include an upstream primer and a downstream primer; preferably, in the reagent for PCR amplification, the concentration of the downstream primer is higher than the concentration of the upstream primer; more preferably, in the reagent for PCR amplification, the concentration of the downstream primer is 300-500 mM, and the concentration of the upstream primer is 50-150 mM; and / or In the reagent for PCR amplification, the concentration of the probe is 150-250 mM; and / or In the reagent for PCR amplification, the concentration of UDG is 0.5-1.5U; and / or In the reagent for PCR amplification, the concentration of BSA is 1-5 g / mL.

9. A nucleic acid detection kit, characterized in that: The kit comprises the reagent according to any one of claims 3 to 5 or the reagent for PCR amplification as defined in any one of claims 6 to 8.

10. Use of the reagent according to any one of claims 3 to 5, the method according to any one of claims 6 to 8, and the kit according to claim 9 in nucleic acid detection for the purpose of non-disease diagnosis and treatment; preferably, the nucleic acid is extracted from any one or more samples including whole blood, urine, sputum, alveolar lavage fluid, and exfoliated cells; more preferably, the nucleic acid extraction method includes a magnetic bead method.

Images