Root-knot nematode resisting method and system for regulating and expressing hpRNA by targeting plant root white body and application of root-knot nematode resisting method and system

Abstract

The invention relates to the technical field of biology, in particular to an anti-root-knot nematode method and system for regulating and expressing hpRNA by targeting a plant root white body and application of the anti-root-knot nematode method and system. According to the invention, it is found for the first time that root-knot nematode can uptake a plastid endogenous nucleic acid RNA molecule rbcL and dsRNA of an expressed exogenous non-nematode target, so that a vector for starting hpPAS4 expression by a T7 promoter is constructed, and plant plastid transformation is mediated by a gene gun, so that a plastid-transformed transgenic plant is obtained. Besides, T-DNA insertion is mediated by agrobacterium tumefaciens, a root-specific promoter TobRB7 and a transport peptide RecA1 plastid are subjected to localization expression of T7RNA polymerase, and the T7RNA polymerase is integrated into a plant nuclear genome, so that nucleoplasm co-transformation is realized, and the plastid of the plant can efficiently express hpPAS4 by means of a T7 system. By utilizing the system, the expression of RNAi interference molecules is realized in the plastid (especially the white body of the root), the insufficient cell nucleus transformation is made up, a new way is opened up for the prevention and control of the root-knot nematode, and the system has great prevention and control value and application potential.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method and system for resisting root-knot nematodes by targeting leucoplasts in plant roots to regulate the expression of hpRNA and an application thereof. Background Art

[0002] Plant-parasitic nematodes (PPNs) are bilaterally symmetrical pseudocoelomates with tiny bodies, mostly linear, and usually colorless or silvery white. Based on the parasitic mode, PPNs can be subdivided into migratory ectoparasitic nematodes, migratory endoparasitic nematodes, and sedentary parasitic nematodes. Their parasitic range covers various parts of plants, including roots, stems, leaves, flowers, and fruits. PPNs are not only numerous and rich in species, but also have a very wide host range. As of now, more than 4,100 species have been discovered. Almost all plant species containing vascular bundles cannot escape their parasitic damage, resulting in the decline of plant product quality, a sharp drop in yield, or even a total loss of harvest, posing a huge challenge to global food security. In addition, a large number of economic tree species are also severely affected. In the field of agricultural production, the losses caused by plant parasitic nematodes are second only to fungal diseases, causing losses of more than US$100 billion to the global agricultural economy each year. Among them, root-knot nematodes (RKNs) are the most harmful, and the economic losses caused by them account for 50% of the total PPNs.

[0003] The life cycle of RKNs includes five stages, starting with eggs, which develop into linear second-instar larvae (J2s) after embryonic development. J2s have the ability to migrate and penetrate the external barriers of plants, infect the roots of host plants, and build lifelong feeding sites in the vascular column of the roots. They continue to feed and develop here, and after molting, they grow into J3 and J4 in turn, and J4 later differentiates into females or males. Males move from the roots to the soil. Given that most of the seriously harmful RKNs reproduce parthenogenetically, the specific role of males is still unclear; females lay eggs after sexual maturity, and the eggs hatch to start a new round of infection. Under suitable temperature and humidity, root-knot nematodes can complete their entire life cycle in 3-4 weeks. When conditions are favorable, a single female can lay up to 500-2000 eggs, and the eggs are protected by the aggregation of the gelatinous matrix secreted by the females.

[0004] Faced with the serious harm of root-knot nematodes, current prevention and control measures are relatively backward. In this context, biological control stands out with its advantages of being green, environmentally friendly, efficient, low-cost and sustainable, and has become a key path for the comprehensive management of root-knot nematodes. Related research focuses on the development of microbial agents for prevention and control, the excavation of plant resistance genes, and the exploration of plant-mediated RNAi technology. The RNAi mechanism originates from the unexpected discovery that when the dsRNA of the target gene is expressed in the body of Caenorhabditis elegans, it inhibits the transcription level of the target gene. Plant-mediated RNAi is a highly promising insect resistance strategy. Currently, dsRNA expressing key genes targeting pests is introduced into the plant nuclear genome or plastid genome through cell nucleus or plastid transformation to control pests. In comparison, plastid transformation has significant advantages, such as high gene copy number, multi-gene co-expression, maternal inheritance, high biosafety, and no RNAi mechanism in the plastid to accumulate more dsRNA. It can also integrate exogenous genes at fixed sites through homologous recombination, with strong stability to avoid affecting other essential genes of the plant.

[0005] At present, research on plant-mediated RNAi nematode control mainly focuses on the nuclear transformation method. Root-knot nematodes usually parasitize plant roots, and the plastids in this area mostly exist in the form of non-chloroplasts such as leucoplasts, and the efficiency of their own transcription and expression systems is at a low level. Therefore, it is of great research value and practical significance to explore whether it is possible to use the T7 RNA polymerase-T7 promoter expression system in non-chloroplasts to increase the expression of RNAi molecules, enhance plant resistance to root-knot nematodes, and further expand the application boundaries of plastid genetic engineering in the field of non-chloroplasts. Summary of the invention

[0006] In view of this, the present invention proposes a method for plastid-localized expression of T7 RNA polymerase (GenBank Accession No. MW248381.1) using root-specific promoter TobRB7 (GenBank Accession No. S45406.1) and transit peptide RecA1 (NCBI Reference Sequence Accession No. NM_106556.2), and combining the plastid-expressed T7 promoter to initiate hpRNA expression, which is used to resist root-knot nematodes and expand the application of plastid genetic engineering in non-chloroplasts.

[0007] The technical solution of the present invention is achieved in this way:

[0008] In a first aspect, the present invention provides a method for resisting root-knot nematodes by targeting the leucoplasts in plant roots to regulate the expression of hpRNA, comprising the following steps:

[0009] S1. Construct the first recombinant plasmid, which includes:

[0010] S1-1, extracting RNA from southern root-knot nematode and reversely transcribing it into cDNA, using cDNA as a template, and performing PCR amplification to obtain a first fragment; the first fragment includes a reverse sequence fragment of the target gene proteasome subunit PAS4 with a restriction site;

[0011] S1-2, respectively, with cDNA and pUC-RNAi plasmid (the source of pUC-RNAi, see the vector in the literature published by Luo et al. [1] )

[0012] Using the intermediate fragments as templates, PCR amplification is performed to obtain an intermediate fragment containing overlapping fragments (i.e., intermediate fragment 1 and intermediate fragment 2); and then PCR amplification is performed using the intermediate fragments as templates to obtain a second fragment; the second fragment includes a fusion fragment of the GA20 intron and the PAS4 forward sequence;

[0013] S1-3, then the first fragment and the second fragment were connected together to the nuclear transformation plasmid pHW25 previously stored in this laboratory

[0014] (pHW25 is derived from the backbone of the nuclear transformation plasmid pCB301, GenBank accession number AF139061.1, which was added to the CaMV35S promoter, Nos terminator and multiple cloning site, referring to the vector in the previous literature published by Wang et al. [2] ), obtaining a first recombinant plasmid;

[0015] S2, constructing a second recombinant plasmid, comprising:

[0016] Using tobacco (source: Nicotiana tabacum L.cv. Petit Havana) genomic DNA as a template, amplify the root-specific promoter TobRB7 sequence (GenBank accession number S45406.1) with SacII\XhoI restriction sites, and then insert the TobRB7 sequence into the linearized first recombinant plasmid to replace the 35S promoter to obtain the second recombinant plasmid;

[0017] S3. The second recombinant plasmid is transformed into a recipient plant through Agrobacterium-mediated transformation, and transgenic plants are obtained by screening and culturing.

[0018] In a second aspect, the present invention provides an anti-root-knot nematode system that targets the leucoplasts in plant roots and regulates the expression of hpRNA. According to the anti-root-knot nematode method, the anti-root-knot nematode system that targets the leucoplasts in plant roots and regulates the expression of hpRNAh is constructed.

[0019] In a third aspect, the present invention provides applications of the anti-root-knot nematode method or the anti-root-knot nematode system.

[0020] The beneficial effects of the present invention include at least the following:

[0021] The present invention proposes a highly effective method for resisting root-knot nematodes, and for the first time reveals that root-knot nematodes can ingest the endogenous nucleic acid RNA molecule rbcL in the plastid, and the dsRNA against the NDUFVII gene of cotton bollworm expressed by the plastid. Based on this, the present invention successfully achieves the efficient expression of hpPAS4 in tobacco plastids by constructing a variety of expression vectors, and then screens out high-expression strains.

[0022] The present invention uses a nuclear-cytoplasmic co-expression method for hpRNA targeting the PAS4 gene of the root-knot nematode, so that the resistance of plants to root-knot nematodes is significantly enhanced, and the root knot formation and egg reproduction of the root-knot nematodes are effectively curbed. In the plastid, especially the root leucoplast, the present invention successfully achieves the expression of RNAi interference molecules by means of the T7 RNA polymerase-T7 promoter expression system, effectively improves the problem of insufficient level of RNAi interference molecules expressed by nuclear transformation, and opens up a new way for the prevention and control of root-knot nematodes.

[0023] The transgenic plants provided by the present invention showed excellent insect resistance in key indicators such as root knot number, egg count and target gene PAS4 silencing. These results fully demonstrate the important value and application potential of the present invention in the prevention and control of root-knot nematodes, provide reliable technical support for the prevention and control of root-knot nematodes in agricultural production, and are expected to promote the development and progress of related fields.

[0024]

References

[0025] [1]Luo A.-D.,Liu L.,Tang Z.-S.,et al.Down-Regulation of OsGRF1 Genein Rice rhd1 Mutant Results in Reduced Heading Date[J].Journal ofIntegrativePlant Biology,2005,47(6):745-752.

[0026] [2]Wang Y.,Wang M.,Zhang Y.,et al.Resistance to both aphids andnematodes in tobacco plants expressing aBacillus thuringiensis crystalprotein[J].Pest Manag Sci,2024:

[0027] [3]Wu M.,Dong Y.,Zhang Q.,et al.Efficient control of western flowerthrips by plastid-mediated RNA interference[J].Proc NatlAcad Sci USA, 2022,119(15):e2120081119.

[0028] [4]Wu Y.,You L.,Li S.,et al.In vivo Assembly in Escherichia coli ofTransformation Vectors for Plastid Genome Engineering[J].Front Plant Sci,2017,8:1454.

[0029]

Term Explanation

[0030] In some specific embodiments of the present invention, the meanings of the terms include but are not limited to those shown in the following table:

[0031]

[0032] In some specific embodiments of the present invention, hpPAS4 represents the hpRNA (hairpin RNA) of PAS4; hpRNA is a special form of dsRNA structure, which can form a hairpin-like shape by itself. The hpRNA molecule is usually composed of an inverted repeat sequence and a spacer sequence. The inverted repeat sequence can form a double-stranded structure through complementary base pairing, while the spacer sequence forms a single-stranded ring structure, and the overall shape is similar to a hairpin, which is a typical structural feature of hpRNA. This structure enables hpRNA to effectively trigger the RNA interference (RNAi) process.

[0033] In the RNAi mechanism, hpRNA is recognized and cut by nucleases (such as Dicer) in cells to produce small interfering RNA (siRNA). These siRNAs can bind to the RNA-induced silencing complex (RISC) in the body, and then RISC uses the sequence information of siRNA to recognize and degrade complementary target mRNA, thereby achieving regulation of specific gene expression.

[0034] In some specific embodiments of the present invention, by constructing hpRNA targeting key nematode genes and expressing them in plant cells, when the nematodes ingest the contents of the plant cells, they will take the hpRNA into their bodies, triggering RNAi in the nematodes, thereby inhibiting the expression of nematode genes and achieving an anti-nematode effect.

[0035] In some specific embodiments of the present invention, dsRNA (double-stranded RNA) is a double-stranded structure composed of two RNA chains bound to each other through the principle of base complementary pairing. It plays a vital role in the RNA interference pathway and can trigger a series of complex gene silencing cascade reactions in cells.

[0036] In some specific embodiments of the present invention, T7 RNA polymerase (T7 RNAP) is a highly specific enzyme that can recognize and bind to the T7 promoter sequence, and then catalyze the synthesis of RNA using DNA as a template. In the plastid system, when T7 RNAP interacts with the T7 promoter encoded and expressed by the plastid, it can very efficiently initiate the transcription process of downstream genes (such as hpPAS4), and this mechanism significantly improves the expression efficiency and level of the target gene in the plastid environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0038] Figure 1 The results of RT-PCR analysis of the endogenous nucleic acid rbcL and the exogenous dsHaNDUFVII expressed by the plant root-knot nematode feeding plastids in the embodiments of the present invention;

[0039] Figure 2 Schematic diagram of the plant expression vector pSQ4 in the embodiment of the present invention (A) and the RT-qPCR detection result of the expression amount of the nuclear transfected tobacco PAS4 (B);

[0040] Figure 3 Schematic diagram of the plant plastid expression vector SQ2 in the embodiment of the present invention (A) and the seed test results of homogeneity identification of transgenic tobacco (B and C);

[0041] Figure 4 Schematic diagram of the plant expression vector YL2 in the embodiment of the present invention (A) and the RT-qPCR analysis results of the nuclear-cytoplasmic co-transfer T7 RNA polymerase and hpPAS4 expression level identification (B);

[0042] Figure 5 The results of Northern blot analysis of the nuclear transfection of hpPAS4 and the nuclear-cytoplasmic co-expression of hpPAS4 in the examples of the present invention are as follows;

[0043] Figure 6The figures are statistical analysis results of the root knot number (A) and egg number (B) of plants infected by root-knot nematodes in the embodiments of the present invention;

[0044] Figure 7 This is the down-regulation analysis result of the root-knot nematode target gene PAS4 in transgenic plants or under specific treatment conditions in the examples of the present invention. DETAILED DESCRIPTION

[0045] To make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to the normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0046] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor). The various ways of obtaining biological materials described in the examples are only to provide an experimental way to achieve the specific disclosed purpose, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples. The genes, proteins or fragments thereof involved in the present invention can be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants, etc.) using recombinant technology.

[0047] In some specific embodiments of the present invention, the following methods and steps are also included:

[0048] First, the present invention constructs a vector for initiating hpPAS4 expression with a T7 promoter, and integrates it into the plant plastid genome through gene gun-mediated plastid transformation to obtain a transgenic plant initiating hpPAS4 expression with a T7 promoter. Subsequently, the root-specific promoter TobRB7 and the transit peptide RecA1 are inserted into the plastid to express T7 RNA polymerase, which is integrated into the nuclear genome of the plant cell by Agrobacterium-mediated T-DNA insertion method to achieve nuclear-cytoplasmic co-transformation, and obtain a transgenic plant that can efficiently express hpPAS4 in the plastid using the T7 RNA polymerase-T7 promoter expression system.

[0049] The present invention also provides application of the preparation method in the preparation of an anti-root-knot nematode product, and a specific preparation method of the anti-root-knot nematode product.

[0050] In the preparation of hpRNA (hairpin RNA) molecules for controlling root-knot nematodes, the target gene selected is a partial sequence of the root-knot nematode proteasome subunit PAS4 (the full-length nucleic acid sequence of the coding region of southern root-knot nematode PAS4 is shown in SEQ ID NO: 26).

[0051] The RNA of southern root-knot nematode was extracted and reverse transcribed into cDNA, which was used as a template to amplify the 289 bp target gene proteasome subunit PAS4 sequence and loaded into the pUC-RNAi vector containing intron GA20 to construct the hpRNA expression cassette (refer to the vector in the literature published by Luo et al. [1] ), and then transferred into the nuclear transformation vector pHW25 (this plasmid is derived from the backbone of the nuclear transformation plasmid pCB301, GenBank accession number AF139061.1, and CaMV35S promoter, Nos terminator and multiple cloning site are added to it. The vector can be referred to in the literature published by Wang et al. [2]) Next, the TobRB7 sequence (GenBank accession number S45406.1) was amplified using tobacco gDNA as a template, and the CaMV35S promoter in pSQ1 was replaced to construct pSQ4 (TobRB7 promoter expressing hpPAS4 nuclear transformation vector).

[0052] In the plant transformation operation, the target gene is first introduced into Agrobacterium using the freeze-thaw method. For tobacco transformation, tobacco seeds are cultured under specific conditions (temperature 25℃ / 20℃, photoperiod 16h / 8h light / darkness, light intensity 25μE), young leaves are cut and co-cultured with Agrobacterium, and then nuclear-transfected tobacco is obtained through selection medium screening and PCR detection, and the expression level is detected by RT-qPCR and Northern blot, and plants with high expression levels are selected for subsequent experiments.

[0053] In some specific embodiments of the present invention, for plastid transformation, the TobRB7 promoter is replaced with the T7 promoter to construct the plasmid pSQ2, and the tobacco seeds are cultured to a certain height under a sterile environment and young leaves are taken, and the target gene is introduced into the plastid using a gene gun, and the plastid-transformed tobacco is obtained by screening with an antibiotic medium and identifying by Southern blot.

[0054] In some specific embodiments of the present invention, further, the synthesized RecA1+T7 RNAP gene fragment is loaded into the nuclear transformation vector pSQ4 to construct the pYL2 vector, which is also transformed into tobacco through Agrobacterium-mediated transformation. The subsequent operations are similar to those described above, and finally transgenic plants for root-knot nematode bioassay experiments are obtained.

[0055] Example 1

[0056] In this example, the effect of the expression of the cotton bollworm NDUFVII gene in tobacco plastids on the infection of tobacco by southern root-knot nematodes was investigated. The present invention studies whether the expression of the cotton bollworm NDUFVII gene in tobacco plastids can enhance the resistance of tobacco to southern root-knot nematodes. This provides basic comparative data for subsequent examples and clarifies the detection method of indicators related to nematode infection.

[0057] 1. Methods

[0058] 1.1 Root-knot nematode inoculation

[0059] Inoculation objects and materials: To investigate the effect of NDUFVII gene expression in cotton bollworm on tobacco's ability to resist nematodes, tobacco strains (transgenic Nt-pt-dsNDUFVII and wild-type Nt-wt) were selected. The method is as follows:

[0060] In a plant growth greenhouse environment with a temperature of 25°C (light) / 20°C (dark) and a photoperiod of 16 h light / 8 h dark, the second-instar larvae of the infective southern root-knot nematode were inoculated into a tobacco line expressing the NDUFVII gene of the cotton bollworm in the tobacco plastid (labeled as Nt-pt-dsNDUFVII, for details, see reference Wu et al. [3] ) and the root system of wild-type tobacco lines (Nt-wt), and the infection time after inoculation was set at 35 to 45 days; to explore the effect of the expression of the cotton bollworm NDUFVII gene in tobacco plastids on the infection of tobacco by southern root-knot nematodes.

[0061] 1.2 Isolation of female root-knot nematodes

[0062] Root-knot nematodes have different stages in their life cycle, such as eggs, larvae (including larvae of different ages, such as J2, J3, J4, etc.) and adults. These nematodes in different stages differ in size, shape and weight. In addition, even nematodes in the same stage may have certain differences between individuals. Therefore, these differences can be used to separate nematodes through physical screening methods. The specific method is as follows:

[0063] 1) After 35-45 days, pull up the tobacco roots and clean the soil around the roots.

[0064] 2) Cut the roots into 2-3cm segments, then put them into a mortar and pound them to break the root knots.

[0065] 3) Re-spin with ddH2O, then sieve through 18 mesh, 60 mesh, 100 mesh, 200 mesh, 300 mesh and 500 mesh in sequence. Female root-knot nematodes are at 60 mesh; J3 and J4 are at 200 mesh and 300 mesh; eggs remain at 500 mesh.

[0066] 4) Rinse the female worms on the 60-mesh plate with ddH2O and collect them in a plate.

[0067] 5) Under a dissecting microscope, use a 200uL pipette (with the tip cut off) to transfer the female worms to a new dish containing ddH2O.

[0068] 6) Wash the female insects 3-4 times with sterile ddH2O to clean the plant tissue.

[0069] 7) The female insects were placed into sterile EP tubes and stored at -80°C for later use.

[0070] 1.3 Extraction of RNA from female root-knot nematodes and reverse transcription to form cDNA

[0071] 1) According to the instructions of Takara Trizol kit (RNAiso Plus Code NO.9108), RNAiso Plus reagent was used to extract total RNA from root-knot nematodes of different ages and their host plant roots.

[0072] 2) Then, according to the instructions of the Yisheng kit (Cat. No. 11139ES10 / 11139ES60), 1 μg of total RNA sample was used for cDNA synthesis using the Hifair II 1st Strand cDNA Synthesis Super Mix kit.

[0073] 1.4 RT-PCR detection of plastid nucleic acid feeding by root-knot nematodes

[0074] 1) Host plant root cDNA was used as a positive control, and sterile water, the washing solution used for the last female separation, and uninfected pre-J2s larvae were used as negative controls. The 18SrRNA (18S ribosomal RNA) gene of the root-knot nematode was used as an internal reference gene, and the primer pair sequences were qRT-Mi18S-F (SEQ ID NO: 1) and qRT-Mi18S-R (SEQ ID NO: 2).

[0075] Table 1

[0076]

[0077]

[0078]

[0079] 2) The cDNA of these samples was used as a template for PCR amplification to detect the presence of rbcL (1'5-bisphosphate ribulose carboxylase large subunit) transcripts in a 20 μL total reaction system (the detection primer pair was: rbcL-RT-F ACCACAAACAGAGACTAAAGCAA and rbcL-RT-RTAATAGTACATCCCAACAGGGG) and dsNDUFVII expressed by plastid transformation, the detection primer pair was: Ha-NDUFVII-F (SEQ ID NO: 3) and Ha-NDUFVII-R (SEQ ID NO: 4), and the root-knot nematode internal reference gene 18S amplification, the detection primers were qRT-Mi18S-F (SEQ ID NO: 1) and qRT-Mi18S-R (SEQ ID NO: 2), and the PCR reaction conditions were as follows:

[0080] Table 2

[0081]

[0082] The PCR reaction system is as follows:

[0083] Table 3

[0084] Components Usage 10 μM rbcL-RT-F 1μL 10 μM rbcL-RT-R 1μL template 1μL 2×TaqPlusMasterMix 15μL <![CDATA[ddH2O]]> To20μL

[0085] 3) The results of RT-PCR were detected by 1% agarose gel electrophoresis. Figure 1 shown.

[0086] As shown in Figure A, the target gene rbcL bands appeared in the Nt-wt group (wild-type tobacco strain) and the Nt-pt-dsNDUFVII group (tobacco strain expressing the cotton bollworm NDUFVII gene in tobacco plastids). No target gene bands appeared in the other control groups (such as the H2O group, Washbuffer group, Eggs group, and pre-J2s group).

[0087] As shown in Figure B, in the Nt-wt group and the Nt-pt-dsNDUFVII group, dsNDUFVII could be detected only in the Nt-pt-dsNDUFVII group but not in the wild-type strain (Nt-wt group).

[0088] This result proves that when female root-knot nematodes parasitize wild-type tobacco strains or tobacco strains expressing the cotton bollworm NDUFVII gene in tobacco plastids, they feed on the nucleic acid components in the root plastids.

[0089] It can be seen that through RT-PCR detection of root-knot nematode feeding on plastid nucleic acid, the present invention determined that the root-knot nematode Mi-18SrRNA gene can be used as a reliable internal reference for subsequent experiments. At the same time, it also confirmed that root-knot nematodes can feed on endogenous nucleic acids in plastids, such as rbcL and exogenously expressed dsRNA, such as dsNDUFVII.

[0090] Example 2

[0091] In this embodiment, the first recombinant plasmid pSQ1 is first constructed. The vector pSQ1 is a transformation vector driven by the T7 promoter to express the hpPAS4 gene in the plastid, so that the hpPAS4 gene plays a role in the plastid. Then, a second recombinant plasmid pSQ4 is constructed, that is, a nuclear transformation vector driven by the root-specific promoter TobRB7 to express hpPAS4. The nuclear transformation vector pSQ4 driven by TobRB7 to express hpPAS4 can specifically initiate transcription in the root. The transgenic tobacco produced by Agrobacterium-mediated nuclear transformation of pSQ4 is used as a control group for root plastid expression as follows:

[0092] 1. Construction of plasmid pSQ1

[0093] Plasmid pSQ1 is a CaMV35S promoter expressing hpPAS4 nuclear transformation vector, and its construction method is as follows:

[0094] First, RNA of the southern root-knot nematode was extracted and reverse transcribed into cDNA. The cDNA was used as a template to amplify a 289 bp fragment of the reverse sequence of the target gene proteasome subunit PAS4 and a PAS4 forward sequence fragment with restriction sites. At the same time, pUC-RNAi was used as a template to amplify the GA20 intron fragment. Then, the above two fragments were used as templates to obtain a fusion fragment of the PAS4 forward sequence and GA20 intron by overlap extension PCR. Then, these fragments and the existing plasmid pHW25 in the laboratory (refer to the vector in the previous literature published by Wang et al.) were cleaved with restriction endonucleases. [2] ) was digested by enzyme, and then pSQ1 was obtained through gel recovery and enzyme ligation. The specific construction method is as follows:

[0095] a) Extracting RNA from Meloidogyne incognita (Mi) and then reverse transcribe it into cDNA. Using the cDNA as a template, a 289 bp fragment of the reverse sequence of the target gene proteasome subunit PAS4 with a restriction site was amplified using primers MiPAS4(EcoR I)-F (SEQ ID NO: 5) and MiPAS4(Xba I)-R (SEQ ID NO: 6).

[0096] b) respectively with the cDNA of southern root-knot nematode and pUC-RNAi plasmid (refer to the vector in the literature published by Luo et al. [1] ) as a template, primer pair MiPAS4(Xho I)-F (SEQ ID NO: 7) and MiPAS4-intron-PR (SEQ ID NO: 8), and primer pair GA20intron-MiPAS4-IF (SEQ ID NO: 9) and GA20 intron(EcoRI)-R (SEQ ID NO: 16) were used to obtain the PCR template PAS4 forward fragment and GA20 fragment with overlapping fragments, and then GA20 intron(EcoRI)-R (SEQ ID NO: 10) and MiPAS4(Xho I)-F (SEQ ID NO: 7) were used to amplify the fusion fragment of 289 bp length of GA20 intron and PAS4 forward sequence. The reaction conditions are as follows:

[0097] Table 4

[0098]

[0099] The PCR reaction system is as follows:

[0100] Table 5

[0101] Components Usage 10 μM rbcL-RT-F 1μL 10 μM rbcL-RT-R 1μL template 1μL 2×TaqPlusMasterMix 15μL <![CDATA[ddH2O]]> To20μL

[0102] c The PAS4-intron DNA fragment was digested with restriction endonucleases Xho I and EcoR I. The PAS4 gene fragment was digested with restriction endonucleases Xba I and EcoR I. The existing plasmid pHW25 in the laboratory (the plasmid was derived from the backbone of the nuclear transformation plasmid pCB301, GenBank accession number AF139061.1, to which the CaMV35S promoter, Nos terminator and multiple cloning site were added) was digested with restriction endonucleases Xho I and Xba I.

[0103] d) Then, two restriction enzyme-cut DNA fragments and a restriction enzyme-cut plasmid backbone were obtained by gel recovery, and the PAS4-intron DNA fragment, the PAS4 reverse sequence gene fragment and the restriction enzyme-cut plasmid pHW25 were then ligated, transformed and extracted to obtain plasmid pSQ1.

[0104] 2. Construction of plasmid pSQ4

[0105] Plasmid pSQ4 is a nuclear transformation vector expressing hpPAS4 with the TobRB7 promoter, and its construction method is as follows:

[0106] e) Using tobacco (source: Nicotiana tabacum L.cv. Petit Havana) gDNA as a template, the tobacco root-specific promoter TobRB7 sequence (GenBank accession number S45406.1) was amplified with primer pair Sac II-TobRB7-F (SEQ ID NO: 11) and XhoI-TobRB7-R (SEQ ID NO: 12), and the amplification procedure and system were the same as above. pSQ1 and TobRB7 sequences were double-digested with Xho I and Sac II, and the digested pSQ1 and TobRB7 sequences were connected to obtain pSQ4 (TobRB7 promoter expression hpPAS4 nuclear transformation vector) vector (the schematic diagram of pSQ4 is shown in FIG. 1 ). Figure 2 A).

[0107] 3. Introduction and cultivation of Agrobacterium

[0108] f) The target gene was introduced into Agrobacterium EHA105 using the freeze-thaw method and spread on YEB medium with 50 mg / L kanamycin. After 12 hours, single colonies were randomly picked from the medium and inoculated into YEB liquid medium containing kanamycin (50 mg / L) and cultured overnight (37°C, 220 rpm). The cultured bacterial liquid was directly used as a PCR template. The PCR reaction system was the same as above, and PCR positive clones were selected for restriction digestion and sequencing verification. The correct single clones were screened and the correct strains were stored at -80°C for future use.

[0109] The freeze-thaw method process is as follows:

[0110] 1) Add 2-10 μL (about 1-10 μg) plasmid DNA to 200 μL Agrobacterium EHA105 competent cells, place on ice for 5 minutes, and freeze in liquid nitrogen for 5 minutes;

[0111] 2) Rapidly transfer to a 37°C water bath and heat shock for 5 minutes;

[0112] 3) Add 1 mL YEB (without antibiotics) liquid culture medium and culture at 28°C with shaking at 180-200 rpm for 2-4 hours;

[0113] 4) Centrifuge at 3000 rpm for 4 min, remove part of the supernatant, and use 200 μL of the bacterial solution to spread on a YEB plate containing 50 mg / L Kan and 50 mg / L Rif;

[0114] 5) Leave it for about 0.5 hours, wait for the water to dry up, and then culture it at 28℃ for about 24 hours until colonies grow.

[0115] 4. Nuclear transformation of tobacco cells

[0116] g) The plant includes tobacco, and the variety is Nicotiana tabacum L.cv.PetitHavana. The tobacco seeds are cultured under sterile conditions. The culture conditions are: temperature: 25°C / 20°C, photoperiod: 16h / 8h light / dark, light intensity: 25μE. Take 2-4 pieces of young tobacco and cut the leaves into pieces, put the chopped tobacco leaves into the cultured Agrobacterium and shake them, then dry the tobacco leaf pieces with Agrobacterium and put them into dark culture medium (MS+30g / L Sucrose+0.1mg / L NAA+1mg / L 6-BA, pH=5.8) to induce Agrobacterium infection.

[0117] 5. Resistance bud screening and rooting culture

[0118] h) After two days of dark cultivation, the leaves were moved to selection medium (MS + 30 g / L Sucrose + 0.1 mg / L NAA + 1 mg / L 6-BA + 100 mg / L Kana + 200 mg / L Tim, pH = 5.8) for resistant bud screening.

[0119] i) The resistant shoots were transferred to rooting medium (MS + 30 g / L Sucrose + 0.1 mg / L NAA + 100 mg / L Kana + 200 mg / L Tim, pH = 5.8) for rooting.

[0120] j) The rooted nuclear-transformed tobacco was moved to a greenhouse and grown in soil.

[0121] 6. RT-qPCR detection

[0122] k) Extract RNA from the new roots and then reverse transcribe to form cDNA. RT-qPCR was performed to detect the expression level of PAS4 in the nuclear transfected tobacco using primer pairs Nt-hpPAS4-QF (SEQ ID NO: 13) and Nt-hpPAS4-QR (SEQ ID NO: 14) ( Figure 2 B), select the tobacco with the highest expression level for subsequent bioassay experiments.

[0123] It can be seen from this that the present invention successfully constructed recombinant plasmids pSQ1 and pSQ4, introduced the vector containing the PAS4 gene into the tobacco cell nucleus, and produced tobacco plants in which PAS4 was expressed under the regulation of the tobacco cell nuclear genome, and detected the expression level of the nuclear-transfected tobacco PAS4 to study its association with the anti-root-knot nematode effect, providing a basis for subsequent exploration of gene expression regulation and plant insect resistance.

[0124] Example 3

[0125] 1. Construction of pSQ2 vector

[0126] pSQ2 is a plant plastid expression vector. It is first amplified multiple times using the PAS4-intron DNA fragment as a template to obtain a fragment containing key sequences such as the T7 promoter. The pYY12 plasmid (see the literature vector published by Wu et al. [4]) already available in the laboratory for plastid transformation is then digested with enzymes. The relevant fragments are then connected, transformed, and extracted. The specific method is as follows:

[0127] 1) Amplification using PAS4-intron DNA fragment as template:

[0128] Using primer pair PT7-MiPAS4(Not I)-F(SEQ ID NO:15) and GA20 intron(EcoR I)-R(SEQ ID NO:10) for amplification (amplification procedure and system are the same as above), a sequence with a length of 550 bp and containing the T7 promoter was successfully obtained; using primer pair MiPAS4(EcoR I)-F(SEQ ID NO:5) and TT7-PAS4-R1(SEQ ID NO:16) for PCR amplification, a 329 bp intermediate fragment was obtained (see SEQ ID NO:27); using the intermediate fragment as a template, with the help of primer pair MiPAS4(EcoR I)-F(SEQ ID NO:5) and TT7-PAS4(Pst I)-R2(SEQ ID NO:17), a TT7-PAS4 DNA fragment with a T7 terminator sequence was obtained (see SEQ ID NO:28).

[0129] 2) Enzyme digestion of pYY12 plasmid, fragment ligation and transformation and extraction of pSQ2 vector:

[0130] The existing plasmid pYY12 in the laboratory was double-digested with restriction endonucleases Pst I and Not I (37°C for 40 min) to obtain a linearized pYY12 plasmid. After the digestion was completed, the PT7-PAS4-intron fragment, TT7-PAS4 fragment and the digested plasmid pYY12 were subjected to enzyme ligation reaction, and then introduced into Escherichia coli to achieve transformation. Finally, the plasmid was extracted and the plant plastid expression vector was successfully constructed, namely the third recombinant plasmid pSQ2 ( Figure 3 ).

[0131] Double enzyme digestion system:

[0132] Table 6

[0133] Components Usage Enzyme 1 1μL Enzyme 2 1μL PCR amplified fragment / backbone plasmid 10-15 μL Cut.Buffer 5μL <![CDATA[ddH2O]]> To50μL

[0134] Enzyme-linked system:

[0135] Table 7

[0136]

[0137] The E. coli transformation process is as follows:

[0138] 1). Take out the competent E. coli and add the ligation system on ice;

[0139] 2). After ice bathing for 30 minutes, heat shock at 42℃ for 60 seconds, and then ice bathing for 3 minutes;

[0140] 3). Add 100uLLB culture medium and culture at 37℃200rpm shaking for 40min;

[0141] 4). Centrifuge the liquid at 3000g / min for 1min and remove most of the supernatant;

[0142] 5). Mix the bacterial precipitate and spread it on the LB plate containing the corresponding antibiotic.

[0143] 2. Use gene gun method to introduce target gene into tobacco plastid. The specific operation is as follows:

[0144] 1) First, the tobacco seeds were cultured under sterile conditions. The culture conditions were set at a temperature of 25°C / 20°C, a photoperiod of 16h / 8h light / darkness, and a light intensity of 25μE.

[0145] 2) Select 2-4 young tobacco leaves, encapsulate the plasmid pSQ2 with gold particles, and successfully bombard the gold particles encapsulated with pSQ2 into the tobacco plastids using a gene gun (PDS-1000 / HeTM biolistic Particle Delivery System, bombardment pressure of 1000 psi) according to the instructions.

[0146] 3. Screening of resistant buds and obtaining plastid-transformed tobacco

[0147] 1) Select medium to screen resistant buds: Cut the leaves into pieces and put them into selection medium (MS+30g / L Sucrose+0.1mg / L NAA+1mg / L 6-BA+500mg / L Spec, pH=5.8) to screen resistant buds.

[0148] 2) Southern blot and seed test detection and rooting and transplanting: After testing positive through Southern blot and seed test and ensuring homogeneity ( Figure 3 ), and then transplanted to rooting medium (MS+30g / L Sucrose+0.1mg / L NAA+500mg / L Spec, pH=5.8) to induce rooting, and finally successfully obtained plastid-transformed tobacco ( Figure 3 ). It can be seen that the present invention successfully constructed the pSQ2 vector and introduced the target gene into the tobacco plastid, and finally obtained the plastid-transformed tobacco after screening and detection.

[0149] Example 4

[0150] The vector pYL2 driven by the root-specific promoter TobRB7 and capable of initiating plastid-localized T7 RNA polymerase was constructed, and its nuclear-cytoplasmic co-transformation process was realized.

[0151] 1. Construction of pYL2 vector

[0152] pYL2 is a nuclear transformation vector expressing RecA and T7 RNAP under the TobRB7 promoter. It is constructed by inserting the RecA1+T7 RNAP gene fragment into the nuclear transformation vector pSQ4. The specific construction method is as follows:

[0153] 1) Acquisition of T7 RNA polymerase gene fragment: A T7 RNA polymerase gene fragment with Sal I / Xba I restriction sites (see SEQ ID NO: 29) was synthesized by a third-party company, Wuhan Jinkairui Biological Co., Ltd.;

[0154] 2) Obtaining overlapping TobRB7 and RecA1 sequence fragments:

[0155] A. Obtain the TobRB7 promoter with RecA1 homology arms: Using plasmid pSQ4 as template, use primer pair SacⅡ-TobRB7-F1

[0156] (SEQ ID NO: 18) and SOE-RECA1-R1 (SEQ ID NO: 19) were amplified by PCR to obtain the TobRB7 promoter with RecA1 homology arms.

[0157] B. Obtaining the RecA1 sequence with TobRB7 homology arms: The laboratory contains the RecA1 transit peptide sequence (see SEQ ID NO:

[0158] 30; NCBI Reference Sequence: NM_106556.2) as a template, and primer pair SOE-RecA-F2 (SEQ ID NO:

[0159] 20) and SOE-Xba I-R2 (SEQ ID NO: 21) were amplified by PCR to obtain the RecA1 sequence with TobRB7 homology arms.

[0160] C. Obtaining overlapping TobRB7 and RecA1 sequence fragments: The above two PCR products were mixed in an equimolar ratio as a template, and PCR amplification was performed with primer pair SacⅡ-TobRB7-F1 (SEQ ID NO: 18) and SOE-Xba I-R2 (SEQ ID NO: 21) to obtain overlapping TobRB7 and RecA1 sequence fragments.

[0161] 3) Construction of an intermediate vector: Use restriction endonucleases Sac II and Xba I to digest and ligate the vector pSQ4 and the overlapping fragment products to construct an intermediate vector.

[0162] 4) Obtaining pYL2 vector: The intermediate vector and the synthetic T7 RNA polymerase gene fragment were digested and ligated using restriction endonucleases SalI and XbaI, followed by transformation, and the pYL2 vector (TobRB7 promoter expressing RecA and T7 RNAP nuclear transformation vector) was successfully obtained; Figure 4 )

[0163] 2. Agrobacterium transformation and tobacco transformation

[0164] The target gene was introduced into Agrobacterium EHA105 using the freeze-thaw method.

[0165] Using plastid transformation tobacco Nt-SQ2 as the material, select 2-4 young and tender tobacco leaves, put the chopped tobacco leaves into the cultured YL2 Agrobacterium, and shake them to make the leaves fully contact with the Agrobacterium.

[0166] Afterwards, the tobacco leaf fragments were placed in dark culture medium (MS+30g / L Sucrose+0.1mg / L NAA+1mg / L 6-BA, pH=5.8), selection culture medium (MS+30g / L Sucrose+0.1mg / L NAA+1mg / L 6-BA+200mg / LSpec+100mg / L Kana+200mg / L Tim, pH=5.8) and rooting culture medium (MS+30g / L Sucrose+0.1mg / LNAA+200mg / L Spec+100mg / L Kana+200mg / L Tim, pH=5.8) in turn for culture to screen out resistant buds.

[0167] 3. Gene expression detection

[0168] RNA was extracted from the transformed plants and cDNA was generated by reverse transcription. RT-qPCR was performed using primer pairs Nt-hpPAS4-QF, Nt-hpPAS4-QR and primer pairs Nt-T7 RNAP-QF (SEQ ID NO: 22) and Nt-T7 RNAP-QR (SEQ ID NO: 23) to analyze the expression of hpPAS4 in nuclear-transfected tobacco plants and Western Blot was used to detect the expression of T7 RNA polymerase ( Figure 4 ). According to the RT-qPCR results, the tobacco with the highest expression level was selected for subsequent bioassay experiments. The difference in the expression of hpPAS4 between nuclear transfection and nuclear-cytoplasmic co-transfection tobacco was detected by RT-qPCR and Northern blot ( Figure 5 ).

[0169] The results of Northern blot showed that there were significant differences in the intensity and position of the RNA band of hpPAS4 in different samples (Nt-wt, Nt-pSQ4, Nt-pSQ2-YL2). It was found that the expression of the nuclear-cytoplasmic cotransfer material increased by more than 100 times, and the expression of the nuclear-cytoplasmic cotransfer hpPAS4 in the root white body accounted for about 0.4% of the total cell RNA. Compared with the wild-type tobacco, the changes in the intensity and position of the RNA band of hpPAS4 in the transgenic strains indicated that nuclear transfer or nuclear-cytoplasmic cotransfer operation had an effect on the RNA expression level of hpPAS4. It can be seen that the present invention successfully constructed the root-specific promoter TobRB7 starting plastid localization T7 RNA polymerase vector pYL2, and transformed tobacco through Agrobacterium-mediated transformation, and analyzed the expression levels of related genes using RT-qPCR and Northern blot technology, revealing the effects of nuclear transfer and nuclear-cytoplasmic cotransfer operation on gene expression.

[0170] Example 5

[0171] (I) Determination of the efficacy of different plant expression vectors against southern root-knot nematodes

[0172] 1. Methods

[0173] Plant cultivation and nematode inoculation: Select tobacco seeds and sow them in the soil to germinate. After the seedlings grow out, transplant them into a pot with a diameter of 11 cm and a height of 9 cm and filled with sand and soil in a ratio of 1:1. When the tobacco plants grow to 4-5 true leaves, carefully dig out the plants and inoculate the second-instar larvae of southern root-knot nematodes J2s around the rhizosphere soil, with an inoculation amount of 1000 J2s / pot.

[0174] The experiment was conducted in a greenhouse environment with the conditions set at 25°C / 20°C (day and night alternation) and a photoperiod of 16h / 8h (light / darkness).

[0175] 2. Results

[0176] 1) Root knot count:

[0177] from Figure 6 It can be clearly seen from the data of A that the number of root knots of wild-type plants (Nt-wt) fluctuates within a certain range, while the number of root knots of transgenic plants (including Nt-pSQ4 and Nt-pSQ2-YL2) is significantly reduced compared with wild-type plants. TukeyHSD analysis shows that this difference is significant. For example, the number of root knots of Nt-pSQ4 and Nt-pSQ2-YL2 plants is significantly lower than that of Nt-wt plants, indicating that in these transgenic plants, the introduced related genes (possibly related to nematode resistance) play a role in inhibiting root-knot nematode infection and root knot formation.

[0178] 2) Egg count ( Figure 6 B):

[0179] Statistical results of the number of nematode eggs in root knots ( Figure 6 B) shows that the number of eggs in transgenic plants is significantly reduced compared to wild-type plants. This further proves that transgenic manipulation has a significant inhibitory effect on the reproductive capacity of root-knot nematodes.

[0180] 3) Combined with the statistical results of root knot number and egg number, these quantitative indicators show that the transgenic plants are resistant to nematodes.

[0181] (II) Downregulation of the root-knot nematode target gene PAS4

[0182] 1. Methods

[0183] Female root-knot nematodes feeding on transgenic plants (including plants expressing hpPAS4 in both nucleocytoplasm and plants expressing hpPAS4 in only nucleocytoplasm) were selected, their RNA was extracted, and reverse transcribed into cDNA. Then, the expression of the target gene PAS4 was detected using primer pairs Mi-hpPAS4-qRT-2F3 (SEQ ID NO: 24) and Mi-hpPAS4-qRT-2R3 (SEQ ID NO: 25).

[0184] 2. Results

[0185] from Figure 7 The results show that after root-knot nematodes feed on nuclear-cytoplasmic co-transformed materials, the downregulation level of the target gene PAS4 is significantly higher than that of feeding on simple nuclear-transformed materials and the control group (WT).

[0186] In the interaction between plants and root-knot nematodes, downregulation of the target gene PAS4 may interfere with the normal physiological metabolism, growth and development or reproduction of nematodes. This result shows that the anti-nematode protein Cry5Ba2 expressed in plastids through transit peptides can significantly enhance the insect resistance effect of simple nuclear transfection, and can effectively inhibit the root knot formation of root-knot nematodes and reduce the number of their offspring.

[0187] In summary, this example determined the effects of different plant expression vectors against southern root-knot nematodes, and studied the number of root knots, egg counts, and down-regulation of root-knot nematode target genes. The results showed that nuclear-cytoplasmic co-expression of hpPAS4 has significant advantages in resisting root-knot nematodes, providing strong data support for the further development of nematode-resistant plant varieties.

[0188] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for resisting root-knot nematodes by targeting the leucoplasts in plant roots and regulating the expression of hpRNA, characterized in that: The steps include: S1. Construct the first recombinant plasmid, which includes: S1-1, extracting the RNA of southern root-knot nematode and reversely transcribing it into cDNA, using the cDNA as a template, and performing PCR amplification to obtain the first fragment; the first fragment includes a reverse sequence fragment of the target gene proteasome subunit PAS4 with a restriction site; S1-2, using cDNA and pUC-RNAi plasmid as templates, respectively, to obtain an intermediate fragment containing overlapping fragments by PCR amplification; then using the intermediate fragment as a template for PCR amplification to obtain a second fragment; the second fragment includes a fusion fragment of GA20 intron and PAS4 forward sequence; S1-3, then the first fragment and the second fragment are connected together to the plasmid pHW25 to obtain a first recombinant plasmid; S2, constructing a second recombinant plasmid, comprising: Using tobacco genomic DNA as a template, amplifying the root-specific promoter TobRB7 sequence with a restriction site, and then inserting the TobRB7 sequence into the linearized first recombinant plasmid to replace the 35S promoter to obtain a second recombinant plasmid; S3. The second recombinant plasmid is transformed into a recipient plant through Agrobacterium-mediated transformation, and transgenic plants are obtained by screening and culturing.

2. The method for resisting root-knot nematodes according to claim 1, characterized in that: The following steps are also included: S4. Construct a third recombinant plasmid, comprising: S4-1, using the PAS4 forward fragment-intron DNA fragment of the second recombinant plasmid as a template for PCR amplification to obtain a third fragment, wherein the third fragment includes a T7 promoter and a PAS4 forward fragment-intron DNA fragment; Using the PAS4 reverse fragment of the second recombinant plasmid as a template for PCR amplification, a 329 bp middle fragment including part of the T7 terminator was obtained; Using the middle fragment as a template, amplifying to obtain a fourth fragment, wherein the fourth fragment includes a TT7-PAS4 fragment with a full-length T7 terminator sequence; S4-2, then the third fragment and the fourth fragment are connected together to the linearized plasmid pYY12 to obtain a third recombinant plasmid; S5. Introducing the third recombinant plasmid into tobacco plastids, and screening and culturing to obtain plastid-transformed tobacco.

3. The method for resisting root-knot nematodes according to claim 2, characterized in that: The following steps are also included: S6. Constructing a fourth recombinant plasmid, comprising: S6-1, synthesizing the fifth segment T7 RNAP, comprising SEQ ID NO: 29; S6-2, obtaining the sixth segment, which includes: PCR was used to obtain the TobRB7 promoter fragment with RecA1 homology arms and the RecA1 sequence fragment with TobRB7 homology arms; Then, the two PCR products were mixed and used as templates for PCR amplification again to obtain a fusion fragment overlapping the TobRB7 and RecA1 sequences. S6-3, constructing an intermediate vector, comprising inserting the sixth fragment into a linearized second recombinant plasmid; S6-4. Then, the intermediate vector and the fifth fragment are connected to obtain the fourth recombinant plasmid, and the recipient plant is transformed through Agrobacterium-mediated transformation, and the transgenic plant is obtained by screening and culturing.

4. The method for resisting root-knot nematodes according to any one of claims 1 to 3, characterized in that: In the step S1-1, the PCR amplification primers include: SEQ ID NO: 5-6.

5. The method for resisting root-knot nematodes according to any one of claims 1 to 3, characterized in that: In the step S1-2, The PCR amplification primers for the intermediate fragment containing overlapping fragments include: SEQ ID NO: 7-10; The second fragment amplification primers include: SEQ ID NO:10 and SEQ ID NO:

7.

6. The method for resisting root-knot nematodes according to any one of claims 1 to 3, characterized in that: In step S2, the PCR amplification primers include: SEQ ID NO: 11-12.

7. The method for resisting root-knot nematodes according to claim 2 or 3, characterized in that: In the step S4-1, The PCR amplification primers for the third fragment include: SEQ ID NO: 15 and SEQ ID NO: 10; The PCR amplification primers for the 329 bp middle fragment include: SEQ ID NO: 5 and SEQ ID NO: 16; The PCR amplification primers for the fourth fragment include: SEQ ID NO:5 and SEQ ID NO:

17.

8. The method for resisting root-knot nematodes according to claim 3, characterized in that: In the step S6-2, Primers for PCR amplification of the TobRB7 promoter fragment with RecA1 homology arms include: SEQ ID NOs: 18-19; Primers for PCR amplification of RecA1 sequence fragments with TobRB7 homology arms include: SEQ ID NOs: 20-21; The PCR amplification primers for the fusion fragment overlapping the TobRB7 and RecA1 sequences include: SEQ ID NO: 18 and SEQ ID NO:

21.

9. An anti-root-knot nematode system that targets the leucoplasts in plant roots and regulates the expression of hpRNA, characterized in that: According to the anti-root-knot nematode method according to any one of claims 1 to 8, the anti-root-knot nematode system for regulating the expression of hpRNA by targeting the leucoplasts in plant roots is constructed.

10. Use of the anti-root-knot nematode method according to any one of claims 1 to 8 or the anti-root-knot nematode system according to claim 9.

Images