Key gene Pasc for masculinization of tomato leaf miner and application of key gene Pasc

Abstract

The invention relates to the technical field of agricultural biology, in particular to a key massic gene Pasc for masculinization of tomato leaf miner and application of the key gene Pasc. The tomato leaf miner masculinization key gene Pamasc encodes a protein with an amino acid sequence as shown in SEQ ID No: 2. The invention further provides the application of the tomato leaf miner Pasc. The tomato leaf miner Pasc can be used for preparing the tomato leaf miner. The CRISPR / Cas9 is utilized to induce mutation of the Pasc gene of the tomato leaf miner, and the result shows that the sex ratio is close to that of the female and the egg hatching rate is reduced, which indicates that the male embryonic stage death is caused by knockout of the masc gene, but the female is not influenced.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and in particular to a key gene Pamasc for masculinization of tomato leafminer and an application thereof. Background Art

[0002] The tomato leafminer, Phthorimaea absoluta (Meyrick), belongs to the Gelechiidae family of the Lepidoptera order. It is native to Peru in South America and is a devastating pest of tomatoes worldwide. The tomato leafminer has a fast reproduction rate, a wide range of host plants, and strong survival ability.

[0003] RNAi technology is a gene silencing phenomenon caused by dsRNA, which can be applied to bioengineering technology for pest control. The key to using RNAi technology is to obtain effective functional target genes. CRISPR-Cas9 technology is a new method for reliable, efficient and rapid gene knockout, and can introduce multiple mutations at different sites at the same time. Using CRISPR / Cas for gene editing can achieve a long-lasting and stable effect, and is an effective genetic tool for studying gene function.

[0004] Insects are the most numerous biological population in the world. Sex differentiation is the process of embryo development towards female or male, which determines the sex phenotype. Sex determination is the result of natural selection of species and the basic guarantee of life activities of organisms. Sex determination of insects is regulated by a complex cascade. In the ZW / ZZ sex regulation system of Lepidoptera insects, the masculinizer (masc), a key gene for masculinization, can regulate downstream genes (such as Doublesex (dsx)) to form male-specific spliceosomes and achieve male sex differentiation; if the masc gene is silenced, the dsx gene is spliced ​​by female-specific splicing, thereby regulating the expression of female-biased genes. The functional study of masc, a key gene for masculinization of tomato leafminers, will help to gain a deeper understanding of its mechanism for regulating sex differentiation of tomato leafminers, which is of great significance for controlling and preventing damage caused by tomato leafminers. Summary of the invention

[0005] The purpose of the present invention is to provide a key gene for masculinization of tomato leafminer.

[0006] Another object of the present invention is to provide the role of the above gene in sex differentiation and egg development of tomato leafminer.

[0007] According to a specific embodiment of the present invention, the key gene Pamasc for masculinization of tomato leafminer was cloned for the first time, and its full-length cDNA nucleotide sequence is shown in SEQ ID No: 1:

[0008]

[0009] The amino acid sequence encoded by the Pamasc gene of the tomato leafminer is shown in SEQ ID NO: 2:

[0010] .

[0011] The present invention provides the application of the above-mentioned Pamasc of tomato leafminer. CRISPR / Cas9 was used to induce mutation in the Pamasc gene of tomato leafminer, and the results showed that the sex ratio was biased towards females and the egg hatching rate was reduced, indicating that knocking out the masc gene caused embryonic death in males but had no effect on females.

[0012] Based on CRISPR / Cas technology, the present invention explores the function of the key gene for masculinization of tomato leafminer, and clarifies the role of masc gene in sex differentiation and egg development of tomato leafminer. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Shows the expression analysis of Pamasc at different developmental stages in tomato leafminer;

[0014] Figure 2 To show the effect of Pamasc gene of tomato leafminer on egg hatching rate;

[0015] Figure 3 Shows the effect of the Pamasc gene on sex ratio in the tomato leafminer;

[0016] Figure 4 Shows the effect of the Pamasc gene of the tomato leafminer on the genital pores of male pupae;

[0017] Figure 5 Showing the effect of Pamasc gene of tomato leafminer on testes and external genitalia of male adults. DETAILED DESCRIPTION

[0018] Example 1: Cloning of the full-length cDNA sequence of the Pamasc gene of the tomato leafminer

[0019] Place the adult sample of the tomato leafminer in a 1.5 mL centrifuge tube, freeze it in liquid nitrogen for 5 minutes, then grind it with a grinding rod, extract RNA, and store it at -80°C for later use. Use a reverse transcription kit to reverse transcribe the extracted RNA into cDNA. Design primers and use cDNA as a template for PCR amplification. The primers used are as follows:

[0020] Upstream primer: 5'GGTGAAACTGTGGTGGATAA 3',

[0021] Downstream primer: 5'GACGACGAGGAATGTGGAAG 3'.

[0022] The cDNA sequence of the Pamasc gene obtained by PCR amplification is 1740 bp in length. The obtained gene has a nucleotide sequence as shown in SEQ ID No: 1, and the gene encodes 579 amino acid sequences as shown in SEQ ID No: 2.

[0023] Example 2: Expression analysis of the Pamasc gene in different developmental stages of the tomato leafminer

[0024] Eggs, 1st instar larvae L1, 2nd instar larvae L2, 3rd instar larvae L3, 4th instar larvae L4, female pupae FP, male pupae MP, female adults F and male adults M were collected. RNA was extracted and cDNA was synthesized as in Example 1.

[0025] RNase-free water was used as negative control, and each sample was repeated three times for fluorescence quantitative PCR. -△△Ct The relative expression of genes was calculated by the SPSS software, and the significant differences were indicated by letters (P<0.05).

[0026] Expression profile analysis: Real-time fluorescence quantitative PCR primers are shown in Table 1. The results showed that Pamasc gene mRNA was expressed in all stages and was highly expressed in the egg stage, male pupa, and male adult stage ( Figure 1 ).

[0027] Table 1. Primers used for real-time quantitative PCR Pamasc

[0028]

[0029]

[0030] Example 3: Identification of the function of the Pamasc gene in Tomato Leafminer

[0031] 1. sgRNA design and in vitro synthesis

[0032] sgRNA was designed in the CDS region, and the editing efficiency and potential off-target effects were evaluated simultaneously. Finally, two sgRNAs were selected, and the sgRNA primer sequences are shown in Table 2:

[0033] Table 2 sgRNA primer sequences

[0034]

[0035] Total RNA extraction and cDNA synthesis were the same as in Example 1. sgRNA was synthesized and purified using a kit according to the kit instructions.

[0036] 2. Injection of Cas9 protein-sgRNA mixture

[0037] Purchase Cas9 protein and prepare injection solution. The total system is 10 μL, including 0.75 μL of synthetic 4 mg / mL Cas9 protein (final concentration 300 ng / μL) and Pamasc sgRNA (total final concentration 300 ng / μl, 150 ng / μL for each sgRNA), 1.5 μL each of sgRNA-Pamasc-1 and sgRNA-Pamasc-2, and the rest is made up with ddH2O.

[0038] Collect eggs from tomato leaves within two hours, stick them on coverslips with thin double-sided tape in sequence, and arrange them in a line vertically. Place the coverslip with eggs on a slide, and inject the injection solution into the egg embryo using a microinjection operation platform. Mark the coverslip where the eggs are after injection, transfer it to a 150mm disposable culture dish, put in a cotton ball with water for moisture retention, and culture it in an incubator.

[0039] After injection of the target gene, the hatching rate of eggs was significantly reduced compared with the control, only 55.76% ( Figure 2), indicating that it affects the embryonic development of tomato leafminers. After Pamasc was knocked out, the sex of male and female pupae was biased towards females, and the sex ratio was unbalanced ( Figure 3 ).

[0040] The genital pore of the male pupa of the tomato leafminer is located on the 8th to 9th abdominal segment, forming a dark brown longitudinal crack. After Pamasc was knocked out, the crack at the genital pore of the male pupa mutant became larger, large black blocks appeared, and the genital pore was deformed ( Figure 4 ).

[0041] Normal male adults consist of a penis and a clasper. The Pamasc mutant has a defective external genitalia, with only one clasper on one side and the other missing. Compared with the wild type, the testes of male adults of the Pamasc mutant tomato leafminer change from dark red to orange-red and become smaller ( Figure 5 ).

[0042] The above embodiments are only used to understand the technical solution of the present application and do not limit the protection scope of the present application.

Claims

1. Pamasc, a key gene for masculinization of tomato leafminer, is characterized by: The tomato leafminer masculinization key gene Pamasc encodes a protein with an amino acid sequence as shown in SEQ ID No:

2.

2. The key gene Pamasc for masculinization of tomato leafminer according to claim 1, characterized in that: The nucleotide sequence of the key gene Pamasc for masculinization of the tomato leafminer is shown in SEQ ID No:

1.

3. Use of the key gene Pamasc for masculinization of tomato leafminer according to claim 1 for preventing and controlling tomato leafminer.

4. The use according to claim 3, characterized in that: The key gene Pamasc for masculinization of tomato leafminer is used for: Reduce the hatching rate of tomato leafminer eggs; Regulating the sex bias of male and female pupae of tomato leafminer towards female.

5. The use according to claim 4, wherein: By knocking out the key gene Pamasc for masculinization of the tomato leafminer, the cracks in the genital pore of the male pupa mutant became larger, large black patches appeared, and the genital pore was deformed; the clasperm on one side was missing; the testicles of the male adults changed from dark red to orange-red, and the testicles became smaller.

6. A method for reducing the hatching rate of eggs of tomato leafminers and regulating the sex of male and female pupae of tomato leafminers to be biased towards females, characterized in that: The method comprises the following steps: Knock out the key gene Pamasc for masculinization of tomato leafminer according to claim 1 for tomato leafminer eggs.

7. The method for reducing the hatching rate of eggs of tomato leafminer and regulating the sex of male and female pupae of tomato leafminer to be biased towards female according to claim 6, characterized in that: The method knocks out the key gene Pamasc for masculinization of tomato leafminer by the following steps: The sgRNA fragment of the key gene Pamasc for masculinization of the tomato leafminer is fed to the eggs of the tomato leafminer.

8. The method for reducing the hatching rate of eggs of tomato leafminer and regulating the sex of male and female pupae of tomato leafminer to be biased towards female according to claim 7, characterized in that: The sgRNA fragment was obtained by amplifying the CDNA fragment of the key gene Pamasc for masculinization of the tomato leafminer using the following primers: sgRNA-Pamascsg-1: 5′CCCCAGATGATGATGTTTGTTAC3′; sgRNA-Pamascsg-2: 5′CCGCGCTAGCTGAGGCTTCAAAC3′.

Images