Fusarium oxysporum FOZJ2024 strain and application thereof

Abstract

The invention provides a fusarium oxysporum FOZJ2024 strain and an application of the fusarium oxysporum FOZJ2024 strain. The strain is preserved in Guangdong Province Microbial Culture Collection Center on November 20, 2024, the preservation number is GDMCC No: 65511, the preservation address is the fifth floor of building 59, No.100 Courtyard, Xianlie Middle Road, Guangzhou City, and the strain has an excellent killing effect on crape myrtle leaf aphid, mealybug, Spodoptera frugiperda and Solenopsis invicta, and is suitable for preventing and treating plant insect pests and agriculture and forestry harms caused by the crape myrtle leaf aphid, mealybug, Spodoptera frugiperda and Solenopsis invicta.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and more specifically, relates to a Fusarium oxysporum FOZJ2024 strain and an application thereof. Background Art

[0002] Lagerstroemia indica Tinocallis kahawaluokalani ) belongs to the family Aphididae in the order Hemiptera. It mainly harms crape myrtles. It not only likes to cluster and harm on the back of leaves, but also on young leaves, making the leaves uneven and falling off early. It also harms new shoots, inhibits the development of flower buds, shortens the inflorescence, and affects flowering. It also secretes honeydew, induces sooty mold, makes the leaves black, and spreads viruses.

[0003] Mealybugs Pseudococcidae sp.) is small, covered with wax powder, polyphagous, with a wide range of hosts, aggregated distribution, and secretive occurrence. It is one of the most difficult pests to prevent. It mainly harms tropical agricultural and forestry crops, subtropical agricultural and forestry crops, and greenhouse cultivated plants. It not only sucks a large amount of plant juice in a short period of time, causing the plants to grow slowly, reduce leaves, become thin, drop flowers, and develop poor fruits, but also secretes honeydew, inducing sooty mold, which further leads to the decline of plants. Moreover, its reproduction and spread speed is very fast, especially in warm and humid environments. If it is not handled in time, it will quickly spread to the entire plant and even infect other plants.

[0004] Fall Armyworm Spodoptera frugiperda ) is an insect of the family Noctuidae in the order Lepidoptera. The sudden, explosive and destructive nature of the fall armyworm poses a serious threat to crops such as corn. It eats the leaves, stems and other key parts of crops, affecting the photosynthesis, nutrient absorption and growth of crops, thereby reducing the yield and quality of crops. In addition, the fall armyworm is migratory and can migrate with the wind, further increasing the difficulty of prevention and control.

[0005] Fire ant ( Solenopsis invicta ) belongs to the family Formicidae in the order Hymenoptera. Red fire ants not only eat the roots, stems, tender stems, buds, fruits and seeds of plants, causing them to grow slowly, wither and turn yellow, or even directly cause their death; they are also highly aggressive and will prey on insects, birds, soil-dwelling animals, etc. in large numbers, posing a threat to other organisms in the ecosystem and affecting biodiversity.

[0006] Therefore, finding a method that can kill the above four insects at the same time is crucial for agricultural and forestry production. Summary of the invention

[0007] The present invention aims to provide a strain of Fusarium oxysporum ( Fusarium oxysporum) FOZJ2024 strain can effectively kill crape myrtle aphids, mealybugs, fall armyworms, and red fire ants, and is suitable for preventing and controlling plant pests and agricultural and forestry damage caused by these insects.

[0008] The first object of the present invention is to provide a strain of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0009] The second objective of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing Lagerstroemia indica aphids.

[0010] The third object of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in preventing and controlling plant pests caused by Lagerstroemia indica.

[0011] The fourth object of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing mealybugs.

[0012] The fifth object of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in preventing and controlling plant pests caused by mealybugs.

[0013] The sixth objective of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing the fall armyworm.

[0014] The seventh objective of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products in preventing and controlling plant pests caused by Spodoptera frugiperda.

[0015] The eighth objective of the present invention is to provide the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing red fire ants.

[0016] The ninth objective of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products in preventing and controlling agricultural and forestry damage caused by red fire ants.

[0017] The tenth object of the present invention is to provide a biocontrol agent.

[0018] The above-mentioned purpose of the present invention is achieved through the following technical solutions: The present invention provides a strain of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0019] The above-mentioned Fusarium oxysporum FOZJ2024 strain has an excellent killing effect on Lagerstroemia indica aphids, and is suitable for preventing and controlling plant pests caused by Lagerstroemia indica aphids. Therefore, the present invention provides the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing Lagerstroemia indica aphids, as well as the use in preventing and controlling plant pests caused by Lagerstroemia indica aphids.

[0020] Preferably, the crape myrtle aphid is a crape myrtle aphid nymph and / or a crape myrtle aphid adult.

[0021] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 Spores / mL or more, more preferably 1×10 5 Spores / mL or more.

[0022] The above-mentioned Fusarium oxysporum FOZJ2024 strain has an excellent killing effect on mealybugs and is suitable for preventing and controlling plant pests caused by mealybugs. Therefore, the present invention provides the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing mealybugs, as well as the use in preventing and controlling plant pests caused by mealybugs.

[0023] Preferably, the mealybugs are mealybug nymphs and / or mealybug adults.

[0024] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 Spores / mL or more, more preferably 1×10 8 Spores / mL or more.

[0025] The above-mentioned Fusarium oxysporum FOZJ2024 strain has an excellent killing effect on the fall armyworm, and is suitable for preventing and controlling plant pests caused by the fall armyworm. Therefore, the present invention provides the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing the fall armyworm, as well as the use in preventing and controlling plant pests caused by the fall armyworm.

[0026] Preferably, the fall armyworm is a larva of the fall armyworm.

[0027] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 Spores / mL or more, more preferably 1×10 7 Spores / mL or more.

[0028] The above-mentioned Fusarium oxysporum FOZJ2024 strain has an excellent killing effect on red fire ants, and is suitable for preventing and controlling agricultural and forestry damage caused by red fire ants. Therefore, the present invention provides the use of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing red fire ants, as well as the use in preventing and controlling agricultural and forestry damage caused by red fire ants.

[0029] Preferably, the red fire ants are red fire ants worker ants.

[0030] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 Spores / mL or more, more preferably 1×10 6 Spores / mL or more.

[0031] Based on this, the present invention also provides a biocontrol preparation containing the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products, which can be used to prevent and control plant pests and agricultural and forestry hazards caused by crape myrtle aphids, mealybugs, fall armyworms, and red imported fire ants.

[0032] The present invention has the following beneficial effects: The Fusarium oxysporum of the present invention ( Fusarium oxysporum ) The FOZJ2024 strain has excellent killing effects on crape myrtle aphids, mealybugs, fall armyworms, and red fire ants, and is suitable for preventing and controlling plant pests and agricultural and forestry hazards caused by these insects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Fusarium oxysporum Fusarium oxysporum ) Frontal morphology of colony of FOZJ2024 strain.

[0034] Figure 2 Fusarium oxysporum Fusarium oxysporum ) Back morphology of the colony of FOZJ2024 strain.

[0035] Figure 3 Fusarium oxysporum Fusarium oxysporum ) Spore morphology of FOZJ2024 strain.

[0036] Figure 4 Fusarium oxysporum Fusarium oxysporum ) Phylogenetic tree of molecular identification of FOZJ2024 strain based on ITS sequences.

[0037] Figure 5 Fusarium oxysporum Fusarium oxysporum ) Phylogenetic tree of molecular identification of FOZJ2024 strain based on RPB2 sequence.

[0038] Figure 6 Fusarium oxysporum Fusarium oxysporum) Phylogenetic tree of molecular identification of FOZJ2024 strain based on TEF sequences.

[0039] Figure 7 Fusarium oxysporum Fusarium oxysporum ) The results of the lethal effect of FOZJ2024 strain on the crape myrtle aphid.

[0040] Figure 8 The crape myrtle aphid was infected with Fusarium oxysporum ( Fusarium oxysporum ) Status diagram of FOZJ2024 strain.

[0041] Figure 9 Fusarium oxysporum Fusarium oxysporum ) The lethal effect of FOZJ2024 strain on mealybugs.

[0042] Figure 10 Mealybugs infected with Fusarium oxysporum ( Fusarium oxysporum ) Status diagram of FOZJ2024 strain.

[0043] Figure 11 Fusarium oxysporum Fusarium oxysporum ) The lethal effect of FOZJ2024 strain on the fall armyworm.

[0044] Figure 12 Fall armyworm infected with Fusarium oxysporum ( Fusarium oxysporum ) Status diagram of FOZJ2024 strain.

[0045] Figure 13 Fusarium oxysporum Fusarium oxysporum ) The lethal effect of FOZJ2024 strain on red fire ants.

[0046] Figure 14 Red imported fire ants infected with Fusarium oxysporum ( Fusarium oxysporum ) Status diagram of FOZJ2024 strain. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0048] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0049] Potato dextrose agar (PDA) medium: Take 200.0 g of peeled potatoes, cut into small pieces, boil in water and remove the residue, then add 15.0 g of agar, continue to boil until melted, add 20.0 g of glucose, and then add distilled water to make up to 1000 mL, finally sterilize at 121 ℃, 103.4 KPa high pressure steam for 30 min and set aside.

[0050] Example 1 Isolation, purification, identification and preservation of strain FOZJ2024 1. Isolation of strain FOZJ2024 A dead lepidopteran larva with mycelium on its body was collected from a farmland in Potou District, Zhanjiang City, Guangdong Province, and 75% ( v / v ) alcohol to disinfect the surface of the dead insect samples, then wash them three times with sterile water, cut them into pieces with sterile surgical scissors, and transfer them to PDA plates containing 50 mg / L penicillin. Culture them in a 28°C incubator until colonies are formed and store them in a 4°C refrigerator for later use.

[0051] 2. Purification of strain FOZJ2024 The isolated dominant colonies were inoculated onto PDA plates containing 50 mg / L penicillin using an inoculation needle and cultured in a 28°C incubator for 3 days. The mycelium with vigorous growth at the edge of the colony was then picked and transferred to a new PDA plate for culture to obtain a purified strain.

[0052] 3. Identification of strain FOZJ2024 (1) Morphological identification The purified strain was spread on a PDA plate and cultured at 28°C. It was observed that the colony grew rapidly and could cover the entire plate in 9 to 10 days and produce a large number of small and large conidia.

[0053] The front morphology of the colony is as follows Figure 1 As shown, it can be seen that the colonies are round, white, cotton-like in texture, very fluffy, and have protruding flocs.

[0054] The back morphology of the colony is Figure 2 As shown, it can be seen that the colonies are milky white with a slight lavender tint, which becomes more obvious in the later stages of growth.

[0055] The morphology of conidia was observed using a biological microscope (Leica M125). Figure 3 As shown, small conidia are single-celled, oval and colorless; large conidia are sickle-shaped, not obviously curved, slightly pointed at both ends, multicellular and colorless.

[0056] (2) Molecular biological identification Three genes were selected for sequence amplification and alignment in molecular biological identification. After PCR amplification of ITS (primer sequence ITS1 as shown in SEQ ID NO:1: TCCGTAGGTGAACCTGCGG; ITS4 as shown in SEQ ID NO:2: TCCTCCGCTTATTGATATGC), RPB2 (primer sequence PmRpb2_4 as shown in SEQ ID NO:3: GCAAGCTCAACTGCTGGTG; PMRpb2_6R as shown in SEQ ID NO:4: TCCAGCGATGTGCTGTTGG) and TEF (primer sequence EF1-728F as shown in SEQ ID NO:5: CATCGAGAAGTTCGAGAAGG; EF1-986R as shown in SEQ ID NO:6: TACTTGAAGGAACCCTTACC) genes of the purified strain, the three gene sequences were compared by Nucleotide BLAST in the GenBank database of the NCBI website. The results showed that the ITS and TEF genes of the strain were similar to those of Fusarium oxysporum ( Fusarium oxysporum ) both have similarities of 100%, and that of the RPB2 gene reaches 99.41%.

[0057] The neighbor-joining (NJ) Bootstrap method of MEGA11.0 software was used to repeatedly sample the ITS, RPB2, and TEF gene sequences 1000 times, and p-distance was selected as the phylogenetic tree model to construct the phylogenetic tree. Figures 4 - 6 As shown, Figure 4 Fusarium oxysporum Fusarium oxysporum ) Phylogenetic tree of molecular identification of FOZJ2024 strain based on ITS sequence, Figure 5 Fusarium oxysporum Fusarium oxysporum ) Phylogenetic tree of molecular identification of FOZJ2024 strain based on RPB2 sequence, Figure 6 Fusarium oxysporum Fusarium oxysporum ) Phylogenetic tree of molecular identification of FOZJ2024 strain based on TEF sequence. It can be seen that the three genes of this strain are all related to Fusarium oxysporum ( Fusarium oxysporum ) are clustered on the same branch and can be distinguished from other closely related species.

[0058] Combining the morphological identification results with the molecular biological identification results, it can be determined that the strain is Fusarium oxysporum ( Fusarium oxysporum ), named Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0059] IV. Deposit of strain FOZJ2024 Fusarium oxysporumFusarium oxysporum ) The FOZJ2024 strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0060] Example 2 Determination of the toxicity of strain FOZJ2024 to Aphidida spp. 1. Test insects At the Huguang Campus of Guangdong Ocean University, we broke off leaves of crape myrtle containing crape myrtle aphids, put them in a plastic box with a lid, put a layer of paper towels on the bottom of the box, and wrap absorbent cotton balls around the petioles to supply water.

[0061] 2. Treatment of test strains Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain was spread on PDA plate and cultured in a constant temperature box at 28 ℃ for 10 days. The colonies with good growth were selected and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in 20 mL of 0.05% ( v / v ) Tween 80 aqueous solution in a beaker, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, and filter with two layers of medical gauze. Count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 Spore suspensions of spores / mL are biocontrol agents of different concentrations. v / v ) Tween 80 aqueous solution was used as the control solution.

[0062] 3. Insect test treatment methods and results Spray the spore suspension and control solution onto the body surface of the nymphs of the crape myrtle aphid until obvious water droplets were formed, and set up 3 replicates for each treatment. Then, place them in a constant temperature environment of 25 ℃ and RH above 90% for breeding, and record the number of deaths every 2 days. Because the aphid life span is short, it is recorded for a total of 6 days.

[0063] The cumulative adjusted mortality rate was calculated according to "Cumulative adjusted mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1-Cumulative control mortality rate) × 100%" (wherein, the cumulative treatment mortality rate refers to the total mortality rate of the crape myrtle aphids sprayed with spore suspension on the day before and after the statistics, and the cumulative control mortality rate refers to the total mortality rate of the crape myrtle aphids sprayed with control solution on the day before and after the statistics). The results are as follows Figure 7 and as shown in Table 1. SPSS software was used to analyze the results in Table 1 and obtain theFusarium oxysporum ) The toxicity regression equation, median lethal concentration (LC50, Table 2), and median lethal time (LT50, Table 3) of FOZJ2024 to Lagerstroemia indica.

[0064] On the 6th day, the control solution was mixed with 1×10 8 The crape myrtle aphids treated with spore suspension of spores / mL were placed under a dissecting microscope (Jiangnan JSZ5B) for observation. Figure 8 shown.

[0065] Table 1 Fusarium oxysporum ( Fusarium oxysporum ) Cumulative corrected mortality of FOZJ2024 strain against Aphidida crape myrtle

[0066] Table 2 Fusarium oxysporum ( Fusarium oxysporum ) The lethal concentration of FOZJ2024 strain to the crape myrtle aphid

[0067] In the regression equation of Table 2, x is the logarithm of the spore suspension concentration (base 10), and y is the probability value of the cumulative corrected mortality rate (Probit( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0068] Table 3 Fusarium oxysporum ( Fusarium oxysporum ) The lethality of FOZJ2024 strain to the crape myrtle aphid

[0069] In the regression equation of Table 3, x is the natural logarithm of time, and y is the probability value of cumulative adjusted mortality (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0070] visible: (1) After treatment with spore suspensions of different concentrations, the death of the crape myrtle aphid can be caused within 2 days, and the cumulative corrected mortality rate of the crape myrtle aphid gradually increases with the extension of time.

[0071] (2) With the increase of spore suspension concentration, the cumulative corrected mortality of the crape myrtle aphid gradually increased. On the 6th day after treatment, 1×10 5 ~1×10 8 At the concentration of spores / mL, the cumulative corrected mortality of the crape myrtle aphid reached 95.07% to 100%.

[0072] (3) Compared with the second day, the LC50 values ​​of the spore suspension treatment on the fourth and sixth days were significantly reduced. In addition, compared with the fourth day, the LC50 value on the sixth day increased. This may be because the growth cycle of the crape myrtle aphid is short and it can molt every few days. From the fourth to the sixth day, the crape myrtle aphid entered the molting stage and shed its original epidermis, thereby blocking the infection of some strains of FOZJ2024.

[0073] (4) With the increase of spore suspension concentration, the LT50 value of spore suspension to Aphididae gradually decreased. 8 Spores / mL concentration of Fusarium oxysporum ( Fusarium oxysporum ) The median lethal time of FOZJ2024 strain to the crape myrtle aphid was 1.95 days.

[0074] (5) Compared with the results of the control solution treatment, a large number of white hyphae grew on the surface of the insects treated with the spore suspension.

[0075] Combining (1) to (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) The FOZJ2024 strain is highly toxic and lethal to the crape myrtle aphid, and can effectively kill the crape myrtle aphid.

[0076] Example 3 Determination of the toxicity of strain FOZJ2024 to mealybugs 1. Test insects At the Huguang Campus of Guangdong Ocean University, Zephyranthes leaves containing mealybugs were broken off and placed in a plastic box with a lid. The base of the leaves were wrapped with absorbent cotton balls to supply water.

[0077] 2. Treatment of test strains Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain was spread on PDA plate and cultured in a constant temperature box at 28 ℃ for 10 days. The colonies with good growth were selected and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in 20 mL of 0.05% ( v / v ) Tween 80 aqueous solution in a beaker, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, and filter with two layers of medical gauze. Count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 Spore suspensions of spores / mL are biocontrol agents of different concentrations. v / v) Tween 80 aqueous solution was used as the control solution.

[0078] 3. Insect test treatment methods and results Spray the spore suspension and control solution onto the body surface of mealybug nymphs until obvious water droplets are formed, and set up 3 replicates for each treatment. Then, place them in a constant temperature environment of 25 ℃ and RH above 90% for breeding, and record the number of deaths every 2 days for a total of 6 days.

[0079] The cumulative adjusted mortality rate was calculated according to "Cumulative adjusted mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1-Cumulative control mortality rate) × 100%" (wherein, the cumulative treatment mortality rate refers to the sum of mealybug mortality rates of spraying spore suspension on the day of statistics and before, and the cumulative control mortality rate refers to the sum of mealybug mortality rates of spraying control solution on the day of statistics and before). The results are as follows Figure 9 and as shown in Table 4. SPSS software was used to analyze the results in Table 4 and obtain the Fusarium oxysporum ) The regression equation of toxicity of FOZJ2024 to mealybugs, median lethal concentration (LC50, Table 5), and median lethal time (LT50, Table 6).

[0080] On the 6th day, the control solution was mixed with 1×10 8 The mealybugs treated with spore suspension of spores / mL were placed under a dissecting microscope (Jiangnan JSZ5B) for observation. Figure 10 shown.

[0081] Table 4 Fusarium oxysporum ( Fusarium oxysporum ) Cumulative corrected mortality of FOZJ2024 strain against mealybugs

[0082] Table 5 Fusarium oxysporum ( Fusarium oxysporum ) The median lethal concentration of FOZJ2024 strain to mealybugs

[0083] In the regression equation of Table 5, x is the logarithm of the spore suspension concentration (base 10), and y is the probability value of the cumulative corrected mortality rate (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0084] Table 6 Fusarium oxysporum ( Fusarium oxysporum ) The lethality of FOZJ2024 strain to mealybugs

[0085] In the regression equation of Table 6, x is the natural logarithm of time, and y is the probability value of cumulative adjusted mortality (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0086] visible: (1) As time went by, the cumulative corrected mortality rate of mealybugs increased gradually.

[0087] (2) With the increase of spore suspension concentration, the cumulative corrected mortality of mealybugs gradually increased. On the 6th day after treatment, 1×10 7 The cumulative corrected mortality of mealybugs at the concentration of spores / mL reached 43.33%, and 1×10 8 The cumulative corrected mortality of mealybugs at the concentration of spores / mL reached 76.67%.

[0088] (3) As time went by, the LC50 value of the spore suspension against mealybugs gradually decreased. On the 6th day after treatment, Fusarium oxysporum ( Fusarium oxysporum ) The median lethal concentration of FOZJ2024 strain to mealybugs is 7.89×10 6 Spores / mL.

[0089] (4) As the concentration of spore suspension increases, the LT50 value of spore suspension to mealybugs gradually decreases. 8 spores / mL concentration, Fusarium oxysporum ( Fusarium oxysporum ) The median lethality time of FOZJ2024 strain to mealybugs was 3.76 days.

[0090] (5) Compared with the results of the control solution treatment, the mealybugs treated with the spore suspension grew obvious fluffy white hyphae on their body surface.

[0091] Combining (1) to (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) The FOZJ2024 strain is highly toxic and lethal to mealybugs and can effectively kill them.

[0092] Example 4 Determination of the toxicity of strain FOZJ2024 to Spodoptera frugiperda 1. Test insects Fall armyworms were collected from corn in the experimental field of Zhanjiang Agricultural Machinery Extension Center, placed in plastic boxes with lids, and raised individually using corn leaves.

[0093] 2. Treatment of test strains Fusarium oxysporum Fusarium oxysporumFOZJ2024 strain was spread on PDA plate and cultured in a constant temperature box at 28 ℃ for 10 days. The colonies with good growth were selected and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in 20 mL of 0.05% ( v / v ) Tween 80 aqueous solution in a beaker, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, and filter with two layers of medical gauze. Count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 Spore suspensions of spores / mL are biocontrol agents of different concentrations. v / v ) Tween 80 aqueous solution was used as the control solution.

[0094] 3. Insect test treatment methods and results Spray the spore suspension and control solution onto the body surface of the fall armyworm larvae until obvious water droplets are formed. Each treatment is repeated 3 times. Then, the larvae are placed in a constant temperature environment of 25 ℃ and RH above 90% for breeding. The number of deaths is recorded every 2 days. The life span of fall armyworm larvae is generally 2 to 3 weeks, so a total of 8 days are recorded.

[0095] The cumulative adjusted mortality rate was calculated according to "Cumulative adjusted mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1-Cumulative control mortality rate) × 100%" (wherein, the cumulative treatment mortality rate refers to the total mortality rate of fall armyworm sprayed with spore suspension on the day before and after the statistics, and the cumulative control mortality rate refers to the total mortality rate of fall armyworm sprayed with control solution on the day before and after the statistics). The results are as follows Figure 11 and as shown in Table 7. SPSS software was used to analyze the results in Table 7 and the results of Fusarium oxysporum ( Fusarium oxysporum ) The regression equation of toxicity of FOZJ2024 to Spodoptera frugiperda, median lethal concentration (LC50, Table 8), and median lethal time (LT50, Table 9) were obtained.

[0096] On the 8th day, the control solution was mixed with 1×10 8 The fall armyworms treated with spore suspensions of spores / mL were placed under a dissecting microscope (Jiangnan JSZ5B) for observation. Figure 12 shown.

[0097] Table 7 Fusarium oxysporum ( Fusarium oxysporum ) Cumulative corrected mortality of FOZJ2024 strain against fall armyworm

[0098] Table 8 Fusarium oxysporum ( Fusarium oxysporum ) The lethal concentration of FOZJ2024 strain to fall armyworm

[0099] In the regression equation of Table 8, x is the logarithm of the spore suspension concentration (base 10), and y is the probability value of the cumulative corrected mortality rate (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0100] Table 9 Fusarium oxysporum ( Fusarium oxysporum ) The lethality of FOZJ2024 strain to fall armyworm

[0101] In the regression equation of Table 9, x is the natural logarithm of time, and y is the probability value of cumulative adjusted mortality (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0102] visible: (1) After treatment with spore suspensions of different concentrations, the fall armyworm can die within 2 days, and the cumulative corrected mortality of the fall armyworm gradually increases with the extension of time.

[0103] (2) With the increase of spore suspension concentration, the cumulative corrected mortality of Spodoptera frugiperda increased gradually. On the 8th day after treatment, 1×10 7 ~1×10 8 The cumulative corrected mortality of Spodoptera frugiperda at the concentration of spores / mL reached 76.67% to 93.33%.

[0104] (3) As time went by, the LC50 value of the spore suspension against Spodoptera frugiperda gradually decreased. Fusarium oxysporum The median lethal concentration of FOZJ2024 strain to fall armyworm is 3.33×10 5 Spores / mL.

[0105] (4) With the increase of spore suspension concentration, the LT50 value of spore suspension to Spodoptera frugiperda gradually decreased. 8 spores / mL concentration, Fusarium oxysporum ( Fusarium oxysporum ) The median lethal time of FOZJ2024 strain to the fall armyworm was 3.48 days.

[0106] (5) Compared with the results of the control solution treatment, the surface of the fall armyworm treated with the spore suspension was covered with a layer of white hyphae.

[0107] Combining (1) to (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) The FOZJ2024 strain is highly toxic and lethal to the fall armyworm and can effectively kill the fall armyworm.

[0108] Example 5 Determination of the toxicity of strain FOZJ2024 to red imported fire ants 1. Test insects Red fire ants were collected from the Huguang Campus of Guangdong Ocean University and placed in a glass bottle. A layer of paper towel was placed on the bottom to keep it moist. The mouth of the bottle was smeared with anti-escape liquid (75% ( v / v ) Mix alcohol and 5000 mesh talcum powder in a mass ratio of 1:1), and then place a small piece of ham sausage in the glass bottle for red fire ants to eat.

[0109] 2. Treatment of test strains Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain was spread on PDA plate and cultured in a constant temperature box at 28 ℃ for 10 days. The colonies with good growth were selected and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in 20 mL of 0.05% ( v / v ) Tween 80 aqueous solution in a beaker, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, and filter with two layers of medical gauze. Count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 Spore suspensions of spores / mL are biocontrol agents of different concentrations. v / v ) Tween 80 aqueous solution was used as the control solution.

[0110] 3. Insect test treatment methods and results The spore suspension and control solution were sprayed on the body surface of the red fire ant workers until obvious water droplets were formed. Each treatment was repeated 3 times. After that, they were placed in an environment with a constant temperature of 25 ℃ and a relative humidity of more than 90%. The number of deaths was recorded every 2 days. The life span of the red fire ant workers was relatively long, so the number was recorded for a total of 14 days.

[0111] The cumulative adjusted mortality rate was calculated according to "Cumulative adjusted mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1-Cumulative control mortality rate) × 100%" (wherein, the cumulative treatment mortality rate refers to the total mortality rate of red fire ants sprayed with spore suspension on the day of statistics and before, and the cumulative control mortality rate refers to the total mortality rate of red fire ants sprayed with control solution on the day of statistics and before). The results are as follows Figure 13 and as shown in Table 10. SPSS software was used to analyze the results in Table 10 and obtain the Fusarium oxysporum ) The regression equation of toxicity of FOZJ2024 to red imported fire ants, median lethal concentration (LC50, Table 11), and median lethal time (LT50, Table 12).

[0112] On the 14th day, the control solution was mixed with 1×10 8 The red fire ants treated with spore suspension of spores / mL were placed under a dissecting microscope (Jiangnan JSZ5B) for observation. Figure 14 shown.

[0113] Table 10 Fusarium oxysporum ( Fusarium oxysporum ) Cumulative corrected mortality of FOZJ2024 strain against red imported fire ants

[0114] Table 11 Fusarium oxysporum ( Fusarium oxysporum ) The lethal concentration of FOZJ2024 strain to red fire ants

[0115] In the regression equation of Table 11, x is the logarithm of the spore suspension concentration (base 10), and y is the probability value of the cumulative corrected mortality rate (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0116] Table 12 Fusarium oxysporum ( Fusarium oxysporum ) The lethality of FOZJ2024 strain to red fire ants

[0117] In the regression equation of Table 12, x is the natural logarithm of time, and y is the probability value of cumulative adjusted mortality (Probit ( p )=Φ -1 ( p )+5, p is the cumulative adjusted mortality rate).

[0118] visible: (1) As time goes by, the cumulative corrected mortality rate of red fire ants gradually increases.

[0119] (2) With the increase of spore suspension concentration, the cumulative corrected mortality of red fire ants gradually increased. On the 10th day after treatment, 1×10 8 The cumulative corrected mortality of red fire ants at the concentration of spores / mL reached 100%; on the 14th day after treatment, 1×10 6 ~1×10 8 The cumulative corrected mortality of red fire ants reached 80% to 100% at spores / mL.

[0120] (3) As time went by, the LC50 value of the spore suspension against red imported fire ants gradually decreased. On the 14th day after treatment, Fusarium oxysporum ( Fusarium oxysporum The median lethal concentration of FOZJ2024 strain to red fire ants is 7.70×10 4 Spores / mL.

[0121] (4) As the concentration of spore suspension increases, the LT50 value of spore suspension to red fire ants gradually decreases. 8 spores / mL concentration, Fusarium oxysporum ( Fusarium oxysporum ) The median lethality time of FOZJ2024 strain to red fire ants is 5.06 days.

[0122] (5) Compared with the results of the control solution treatment, many white hyphae grew on the body surface of the red fire ants treated with the spore suspension.

[0123] Combining (1) to (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) The FOZJ2024 strain is highly toxic and lethal to red fire ants and can effectively kill them.

[0124] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A strain of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain, characterized in that The Fusarium oxysporum FOZJ2024 strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 20, 2024, with the collection number GDMCCNo: 65511, and the collection address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in killing Lagerstroemia indica aphids.

3. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in preventing and controlling plant pests caused by Lagerstroemia indica.

4. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in killing mealybugs.

5. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in preventing and controlling plant pests caused by mealybugs.

6. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in killing fall armyworm.

7. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in preventing and controlling plant pests caused by Spodoptera frugiperda.

8. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in killing red imported fire ants.

9. Use of the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product according to claim 1 in preventing and controlling agricultural and forestry damage caused by red fire ants.

10. A biocontrol agent, characterized in that: Contains the Fusarium oxysporum FOZJ2024 strain and / or its fermentation product as described in claim 1.

Images