Application of spore-associated unknown function domain 679 membrane protein gene spduf679 in plant drought tolerance
By cloning and overexpressing the SpDUF679 gene of *Potamogeton crispus*, a recombinant plasmid was constructed and transformed into plants, solving the problem of insufficient drought stress resistance in plants in existing technologies and achieving a significant enhancement of drought tolerance in plants.
Patent Information
- Application Number
- CN202510097246.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2045-01-22
AI Technical Summary
Existing technologies have failed to effectively utilize unknown functional domain protein genes of *Symplocos rubrum* to enhance drought stress resistance in plants, resulting in plants exhibiting lower tolerance under drought conditions.
The SpDUF679 gene of the unknown functional domain 679 membrane protein of *Potentilla pubescens* was cloned and overexpressed, and a recombinant plasmid was constructed and transformed into plants, especially *Arabidopsis thaliana*, to enhance their resistance to drought stress.
The SpDUF679 gene was verified in transgenic plants to significantly enhance plant tolerance to drought stress, enriching the molecular biology theory of plant stress resistance and improving the plant's stress tolerance.
Smart Images

Figure CN119842734B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the SpDUF679 gene of the unknown functional domain 679 membrane protein of *Hemiberlesia argyi* in plant tolerance to drought stress. Background Technology
[0002] Climate change is a major global issue, concerning sustainable development, ecological and environmental protection, and energy and water security, and has received high attention from governments worldwide. Drought is a major natural disaster globally, causing severe damage to human society and the environment. Against the backdrop of global warming, droughts are showing a trend of increasing frequency and escalating losses.
[0003] *Stipagrostis pennata*, belonging to the genus *Stipagrostis* of the family Gramineae, primarily grows on sandy lands, dunes, and ridges, especially on the windward slopes of semi-mobile crescent dunes and the tops of semi-fixed dunes. It is a pioneer plant for sand fixation in the Gurbantünggüt Desert. Due to its arid environment with low rainfall, severe wind erosion, and high degree of soil sandification, *Stipagrostis pennata* exhibits desert adaptability characteristics such as drought resistance, wind erosion resistance, and tolerance to sand burial. It can promote the stabilization of shifting sand and improve desert soil composition. In recent years, *Stipagrostis pennata* has received widespread attention for its important role in desertification control and ecological restoration.
[0004] Proteins with unknown functional domains (DUFs) belong to a family of proteins whose protein structures contain at least one highly conserved domain, termed the DUF domain (Rizwana Begum SyedNabi et al., 2020). Studies have shown that proteins containing DUF domains play a crucial role in plant stress responses. For example, in wheat, TaSRG (Triticum aestivum salt response gene) containing the DUF622 domain increases salt tolerance in overexpressed transgenic Arabidopsis and affects gene expression levels in rice under salt stress (He et al., 2011). Another study on rice plants showed that DUF1645 is upregulated in response to various stress factors and exhibits higher drought tolerance when overexpressed (Cui et al., 2016). Similarly, in Arabidopsis thaliana, ABA and drought-induced ubiquitin ligase genes AtRDUF1 and AtRDUF2 (RING-DUF1117E3) regulate ABA signaling and drought stress, while single and double knockout (KO) mutants of AtRDUF1 and AtRDUF2 exhibit reduced tolerance to ABA-mediated drought stress compared to wild-type (WT) plants (Kim et al., 2013). Although some DUF gene families have been characterized, a large number of DUF members remain unknown. Summary of the Invention
[0005] The purpose of this invention is to provide the application of the SpDUF679 gene, a membrane protein with an unknown functional domain 679 in *Symplocos rubrum*, in regulating plant tolerance to drought stress, thereby addressing the problems existing in the prior art. This invention discovers a novel membrane protein with an unknown functional domain 679 in *Symplocos rubrum*, named SpDUF679, and verifies in transgenic plants that this gene has an important function in enhancing plant resistance to drought stress. This is of great significance for revealing the stress resistance mechanism of *Symplocos rubrum*, enriching the molecular biology theory of plant stress resistance, and improving plant stress tolerance.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides an unknown functional domain 679 membrane protein gene SpDUF679 of *Potamogeton crispus*, the CDS sequence of which is shown in SEQ ID NO.5.
[0008] The present invention also provides a protein encoded by the unknown functional domain 679 membrane protein gene SpDUF679, the amino acid sequence of which is shown in SEQ ID NO.6.
[0009] The present invention also provides a recombinant plasmid containing the unknown functional domain 679 membrane protein gene SpDUF679.
[0010] The present invention also provides a recombinant bacterium containing the recombinant plasmid.
[0011] The present invention also provides the application of the unknown functional domain 679 membrane protein gene SpDUF679, the protein, the recombinant plasmid, or the recombinant bacteria in enhancing the drought stress resistance of plants.
[0012] The present invention also provides the application of the unknown functional domain 679 membrane protein gene SpDUF679, the protein, the recombinant plasmid, or the recombinant bacteria in cultivating plants with strong resistance to drought stress.
[0013] Optionally, the plant includes Arabidopsis thaliana.
[0014] The present invention also provides a method for enhancing the drought stress resistance of plants, comprising the step of introducing the unknown functional domain 679 membrane protein gene SpDUF679 into plants to overexpress the unknown functional domain 679 membrane protein gene SpDUF679.
[0015] The present invention also provides a method for cultivating plants with strong resistance to drought stress, comprising the step of introducing the unknown functional domain 679 membrane protein gene SpDUF679 into a plant to obtain a transgenic plant overexpressing the unknown functional domain 679 membrane protein gene SpDUF679.
[0016] Optionally, the plant includes Arabidopsis thaliana.
[0017] The present invention discloses the following technical effects:
[0018] This invention discovered a novel, previously unknown functional domain membrane protein 679 in *Symplocos rubrum*, named SpDUF679. A plant expression vector for this gene was successfully constructed and transformed, and the gene's important function of enhancing drought stress resistance was verified in transgenic plants. This invention is of great significance for elucidating the stress resistance mechanism of *Symplocos rubrum*, enriching the molecular biology theory of plant stress resistance, and improving plant stress tolerance. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 The image shows a gel electrophoresis diagram of the PCR amplification product of the SpDUF679 gene CDS sequence; where M is the marker and 1 is the PCR amplification product.
[0021] Figure 2 The image shows a gel electrophoresis diagram of PCR products of Agrobacterium monoclonal strains transformed with the SpDUF679 gene overexpression vector; where M is the marker and 1-8 are positive monoclonal clones.
[0022] Figure 3 The image shows the gel electrophoresis results of PCR products from Arabidopsis thaliana overexpressing the SpDUF679 gene; where M is the marker and 1-6 are the selected transgenic plants.
[0023] Figure 4 The phenotypes of four Arabidopsis species after 12 h of treatment with 20% PEG were shown; CK was the control group with normal culture, and PEG was the drought stress group treated with 20% PEG for 12 h. Detailed Implementation
[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0029] The total RNA extraction kit, cDNA first-strand reverse transcription kit, 2×TaqPCRMaster Mix II, DNA gel extraction kit, and plasmid extraction kit used in this invention were all purchased from TIANGEN Biotech. The pMD-19T cloning vector and Real-time PCR reagent were purchased from TaKaRa Biotech. Kpn I, Xba I, and other related enzymes were purchased from TaKaRa Biotech. The chemical reagents, including penicillin ampicillin, kanamycin, gentamicin, MES, acetylsuccione, MgCl2, and culture medium preparation reagents, were all domestically produced analytical grade and purchased from Shanghai Sangon Biotech Co., Ltd. The competent Escherichia coli strain DH 5α was purchased from Beijing TransGen Biotech Co., Ltd. The synthesis of PCR primers and DNA sequencing were performed by Xinjiang Youkang Biotechnology Co., Ltd. and Shanghai Sangon Biotech Co., Ltd.
[0030] Biological materials used in the experiment:
[0031] Agrobacterium strain GV 3101 and plant expression vector pCAMBIA 1300 were provided by the Key Laboratory of Agricultural Biotechnology, College of Life Sciences, Shihezi University, Xinjiang. They can also be obtained by the public through any open channels.
[0032] Arabidopsis mutant material: The Atduf679 gene deletion mutant, serial number AT1G26560 (publicly available at https: / / www.arabidopsis.org / pagenotfound), was purchased from AraShare Science, publicly available at https: / / www.arashare.cn / index / Product / index.html.
[0033] Example 1: Cloning of the SpDUF679 gene, an unknown functional domain membrane protein from the grass *Hemiberlesia lataniae*.
[0034] 1. Cultivation and planting of *Symplocos pubescens*
[0035] Seeds of *Symplocos pubescens* were collected in June in the desert near Mosuowan Reservoir in Shihezi City, Xinjiang Uygur Autonomous Region, under bags. After drying the collected seeds and removing the seed coat, the seeds were soaked in gibberellin for 24 hours and then planted in sand at a depth of 1 cm. Samples were collected 45 days later for later use.
[0036] 2. Extraction of total RNA and synthesis of cDNA from *Symplocos rubrum*
[0037] Total RNA was extracted from the collected *Gnaphalium affine* samples using a total RNA extraction kit, following the instructions of the TIANGEN plant total RNA extraction kit. After extraction, RNA integrity was assessed by 1.1% agarose gel electrophoresis, and RNA concentration was determined. cDNA was then synthesized using a reverse transcription kit. The samples were stored at -20°C.
[0038] 3. Cloning of the feather needle gramine transporter SpDUF679
[0039] Primers SpDUF679-F and SpDUF679-R, as well as homologous arm primers SpDUF679-tong-F and SpDUF679-tong-R containing KpnI and XbaI restriction sites, were designed. PCR amplification was performed using *Hemiberlesia argyi* cDNA as a template. The reaction system was as follows: cDNA (50 ng / μL) -1 2 μL of 2×Taq PCR Master Mix, 25 μL of primer SpDUF679-F, 2 μL of primer SpDUF679-R, and 19 μL of ddH2O, for a total of 50 μL. The amplification program was: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min; and stored at 4℃. The target band was detected and recovered using a 1.2% agarose gel electrophoresis. Figure 1 The sample was sent to Xinjiang Youkang Biotechnology Co., Ltd. for sequencing. The primer sequences and the CDS sequence of the SpDUF679 gene obtained by amplification are as follows.
[0040] SpDUF679-F: 5'-ATGACACACCAAGAGCAGCATCG-3', SEQ ID NO.1;
[0041] SpDUF679-R: 5'-GTACTTGTGCTCGGCGTCCT-3', SEQ ID NO. 2.
[0042] SpDUF679-tong-F: atttggagaggacagggtaccATGACACACCAAGAGCAGCATCG, SEQ IDNO.3;
[0043] SpDUF679-tong-R:ggtactagtgtcgactctagaGTACTTGTGCTCGGCGTCCT, SEQ ID NO.4.
[0044] SpDUF679 gene CDS sequence (SEQ ID NO.5):
[0045] ATGACACACCAAGAGCAGCATCGCGATCTGCAGCAGCCTCTCATCACCACCGGCGATCTGCAGGAAGGTCCAGCAATGGCGGCGCCACCGAGCAGGAGCATGAGCGTGGCGGACCGGGCGCTGCGCGGGGTGGCGGACCTCATCAAGCTGCTCCCCAGCGGCACGGTGTTCCTGTTCCAGTTCCTCAGCCCGCTCGTCACCAACAACGGCCACTGCGCGACCTTCAACAAGGTGCTCAGCGGCGCCCTCGTCGCGCTCTGCGGCGCTTTCTGCGCCTTCTCCTCCTTCACCGACAGCTACGTCGGCGCCGACGGCCGCGTCTACTACGGCGTCGTGACGCGCCGCGGGATGCGCACCTTCGCCGCCGACCCGGACGCCGCCGCCAGGGACATGTCGGCGTACTGCCTCCGCGCGGGGGACTTCGTCCACGCGGGGCTCTCGCTGCTGGTGTTCGCCAGCATCGCGCTCCTCGACACGGACACCGTCTCCTGCCTCTACCCGGCGCTGGAGCTCAGCGAGCGCACCATGATGGCCGTGCTGCCGCCGGTCGTCGGCGGCGTCGCGGGCTACGTGTTCATGGTGTTTCCCAACAACCGGCACGGCATCGGGTACCAGCCGGCTGCCGCCGCCACCGAGGACGCCGAGCACAAGTACTAG。
[0046] Amino acid sequence encoded by the CDS sequence of the SpDUF679 gene (SEQ ID NO.6):
[0047] MTHQEQHRDLQQPLITTGDLQEGPAMAAPPSRSMSVADRALRGVADLIKLLPSGTVFLFQFLSPLVTNNGHCATFNKVLSGALVALCGAFCAFSSFTDSYVGADGRVYYGVVTRRGMRTFAADPDAAARDMSAYCLRAGDFVHAGLSLLVFASIALLDTDTVSCLYPALELSERTMMAVLPPVVGGVAGYVFMVFPNNRHGIGYQPAAAATEDAEHKY。
[0048] Example 2: Construction of a plant expression vector for the SpBGLU25 gene
[0049] Using the CDS sequence of the SpDUF679 gene as a template, PCR amplification was performed using homologous arm primers SpDUF679-tong-F and SpDUF679-tong-R. The amplification system and procedure were the same as in Example 1. The PCR products were excised from the gel and sequenced, then compared with the original sequence. Once the alignment was correct, the sequence was used for further processing.
[0050] The plant expression vector pCAMBIA1300 containing the 35S promoter was double-digested with Kpn I and Xba I to obtain the vector fragment. The vector fragment was recovered. The gel-recovered product, after correct alignment, was ligated to the double-digested vector fragment using a homologous recombination kit. The reaction system was: 2 μL vector fragment; 3 μL target gene fragment; 5 μL C1162×CE Mix; the reaction program was 50℃ for 30 min. The reaction product was plated on LB solid medium containing ampicillin and incubated at 37℃ for 12 h. After incubation, positive single colonies were picked for colony PCR verification and then sent to Xinjiang Youkang Biotechnology Co., Ltd. for testing.
[0051] Example 3 Agrobacterium transformation
[0052] The submitted sequence was compared with the original sequence using SnapGene. Plasmids were extracted from the bacterial culture that matched correctly according to the plasmid extraction kit instructions. The plasmids were then transformed into Agrobacterium GV 3101 using the freeze-thaw method, in a solution containing triple antibodies (Gen 50 μg / mL). -1 Kan 50μg·mL -1 Rif 50 μg·mL -1 Spread the bacteria onto LB solid medium and incubate at 28°C for 36-48 hours. Select single colonies for colony PCR verification. Figure 2 The verified Agrobacterium tumefaciens solution is then preserved.
[0053] Example 4: Inoculation of Arabidopsis thaliana using the dripping method
[0054] Wild-type and Atduf679 gene deletion mutant Arabidopsis seeds were sterilized and sown in 1 / 2 MS medium. Ten days later, the seedlings were transplanted into nutrient soil. Transformation was carried out after the seedlings bolted twenty days later.
[0055] Preparation of inoculum: Agrobacterium tumefaciens identified as containing the target gene was cultured overnight at 28°C in LB liquid medium containing triple antibodies (50 mg / L Kan, 50 mg / L Gen, 50 mg / L L LRif). The bacterial culture was then centrifuged at 25°C, 5000 rpm for 5 min. The supernatant was discarded, and the precipitate was resuspended in 1 / 2 MS liquid (5% sucrose + 0.02% Silwet L-77) to allow OD to adjust. 600The concentration was set to approximately 0.6. The inflorescences were immersed in the infection solution for 1 minute, then the residual solution was removed. The infected Arabidopsis were then cultured in the dark for 24 hours, followed by normal culture. Infection was repeated weekly until no inflorescences remained. After infection, the Arabidopsis were placed under normal light. Once the pods matured, the seeds were collected for subsequent screening experiments.
[0056] Example 5: Identification of transgenic Arabidopsis thaliana
[0057] The collected infected Arabidopsis seeds were sown on 1 / 2 MS (containing 4% hygromycin) solid medium under sterile conditions using standard planting methods. After two to three weeks of growth in an artificial climate chamber, untransformed Arabidopsis seedlings gradually turned white and died, while successfully transformed seedlings grew normally. The normally growing Arabidopsis were then transferred to culture soil for further cultivation. DNA was then extracted from the initially screened Arabidopsis seedlings for PCR identification. Figure 3 ).
[0058] Four types of Arabidopsis thaliana plants were subjected to 12 hours of 20% PEG drought stress: wild-type Arabidopsis thaliana (WT), Arabidopsis thaliana overexpressing SpDUF679 (SpDUF679), Arabidopsis thaliana Atduf679 gene deletion mutant (atduf679), and Arabidopsis thaliana overexpressing SpDUF679 gene Atduf679 gene deletion mutant (SpDUF679-atduf679). The results showed that the Arabidopsis thaliana Atduf679 gene mutant exhibited the most severe wilting and drying, followed by wild-type Arabidopsis thaliana. Arabidopsis thaliana overexpressing SpDUF679 gene showed the best resistance to drought stress, followed by the Arabidopsis thaliana Atduf679 gene mutant overexpressing SpDUF679 gene. Figure 4 This indicates that the SpDUF679 gene can indeed increase the plant's resistance to drought stress.
[0059] This invention not only yielded the SpDUF679 gene of *Symplocos rubra*, but also successfully constructed and transformed its plant expression vector. The important function of this gene in increasing drought stress resistance in transgenic plants was investigated. This is of great significance for revealing the stress resistance mechanism of *Symplocos rubra*, enriching the molecular biology theory of plant stress resistance, and improving the stress tolerance of plants.
[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A gene SpDUF679, representing an unknown functional domain 679 membrane protein from the bird *Hemiberlesia lataniae*, characterized in that... The CDS sequence of the unknown functional domain 679 membrane protein gene SpDUF679 is shown in SEQ ID NO.
5.
2. The protein encoded by the unknown functional domain 679 membrane protein gene SpDUF679 according to claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
6.
3. A recombinant plasmid comprising the SpDUF679 membrane protein gene with the unknown functional domain 679 as described in claim 1.
4. A recombinant bacterium comprising the recombinant plasmid of claim 3.
5. The application of the unknown functional domain 679 membrane protein gene SpDUF679 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the recombinant bacteria according to claim 4 in enhancing the drought stress resistance of plants, characterized in that, Overexpression of the unknown functional domain 679 membrane protein gene SpDUF679 enhances the plant's resistance to drought stress; the plant is Arabidopsis thaliana.
6. The application of the unknown functional domain 679 membrane protein gene SpDUF679 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the recombinant bacteria according to claim 4 in cultivating plants with strong resistance to drought stress, characterized in that, The gene SpDUF679, representing the unknown functional domain 679 membrane protein, was introduced into the plant and stably overexpressed. After overexpression, the plant's resistance to drought stress was enhanced. The plant was Arabidopsis thaliana.
7. A method for enhancing the drought stress resistance of plants, characterized in that, The method includes the step of introducing the unknown functional domain 679 membrane protein gene SpDUF679 as described in claim 1 into a plant, thereby overexpressing the unknown functional domain 679 membrane protein gene SpDUF679; the plant is Arabidopsis thaliana.
8. A method for cultivating plants with strong resistance to drought stress, characterized in that, The method includes the step of introducing the unknown functional domain 679 membrane protein gene SpDUF679 as described in claim 1 into a plant to obtain a transgenic plant overexpressing the unknown functional domain 679 membrane protein gene SpDUF679; the plant is Arabidopsis thaliana.
Citation Information
Patent Citations
Application of CRK5 protein and coding gene thereof in regulation of plant drought resistance
CN105950583A
Method for massively culturing Stipagrostis pennata callus
CN110367120A