Transcription factor OsRAV9 gene for regulating resistance of rice to rice blast and application of transcription factor OsRAV9 gene

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an elongation factor subunit OsRAV9 gene for regulating and controlling resistance of rice to rice blast and application of the elongation factor subunit OsRAV9 gene. The elongation factor subunit OsRAV9 gene induced to express by magnaporthe oryzae is screened, and the nucleotide sequence of the elongation factor subunit OsRAV9 gene is as shown in SEQ ID NO: 1; the sequence of the protein coded by the gene is as shown in SEQ ID NO: 2. By means of agrobacterium tumefaciens-mediated transformation, an OsRAV9 over-expression transgenic strain and a CRISPR / Cas9 mutant strain are obtained. The rice blast inoculation identification on the transgenic material finds that the resistance of the OsRAV9 over-expression strain to the rice blast is enhanced, and the mutant strain is more susceptible to the rice blast bacteria, which indicates that the OsRAV9 is a positive regulation factor of the rice to the rice blast resistance. The OsRAV9 gene plays a positive regulation role in the rice blast resistance, and the resistance of rice to the rice blast can be remarkably improved by over-expression of the gene.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to functional identification and application of transcription factor OsRAV9 gene in regulating rice resistance to rice blast. Background Art

[0002] Rice is one of the most important food crops in my country, with an annual planting area of ​​about 30 million hectares, accounting for about 33% of the total planting area of ​​food crops, and a total output of 45% of the total food output in my country. Biological disasters are one of the important factors affecting the stable and high yield of rice in my country (Lin MM, Liu XL, Lin X. Status and Development Trend of Rice Production in China. Hans Journal of Agricultural Sciences, 2023, 13(6): 562-567). Rice blast is a rice disease caused by heterothallic ascomycete fungi. The rice blast fungus can infect the roots of rice and the aboveground parts including stems, leaves, leaf sheaths and panicle necks. It has become one of the three major diseases that seriously hinder rice production. The annual yield loss caused by it is as high as 11% to 30%, and in severe cases, even no grain can be harvested (Yang Can, Wang Yucui, Wu Weihuai, etc. Research progress on the genetic structure and pathotype of rice blast fungus population [J]. Anhui Agricultural Sciences, 2015, 43(13): 111-114.). At present, the use of chemical agents is still the main measure to prevent and control rice blast. Although chemical pesticide control is effective in the short term, the environmental pollution, ecological damage, and human health risks it brings cannot be ignored. Therefore, it is necessary to continue to explore rice blast resistance genes, analyze their molecular mechanisms of disease resistance, and provide theoretical guidance and germplasm resources for the breeding of rice blast-resistant varieties, which is of great reference value to the safe production of rice.

[0003] The RAV gene family is a plant-specific transcription factor that belongs to the B3 superfamily and has one or more DNA binding domains, including the B3 domain and the AP2 domain. These genes play an important role in plant growth and development, signal transduction, and stress response (Genome-wide identification and expression analysis of transcription factors of RAV family in litchi. Yue XQ, Yang CK, Yue Z, Kai BZ. 2022). AP2 / ERF (APETALA2 / ethylene responsive factor) transcription factors are one of the largest transcription factor families in plants and play an important role in regulating rice stress response. When rice encounters adversity, AP2 / ERF transcription factors can bind to cis-acting elements such as GCAC(A / G)N(A / T)TCCC(A / G)ANG(C / T), GCC-box(AGCCGCC), DRE / CRT(A / GCCGAC) in the promoter region of adversity-related genes to regulate the expression of related genes and improve the adaptability of rice to adverse environments (Tsubasa SJ, Ling Y.ERF gene clusters: working together to regulate metabolism. Trends Plant Sci, 2021, 26:23-32.). In addition, the AP2 / ERF transcription factor family plays an important role in plant growth and development and metabolite synthesis. The AP2 / ERF transcription factor family proteins all contain at least one highly conserved AP2 DNA binding domain consisting of 60 to 70 amino acid residues (Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol, 2006, 140: 411-432.). Some AP2 / ERF proteins contain transcriptional repression domains, and transcription factors containing the EAR (L / FDLNL / F(X)P) motif play a negative regulatory role in the expression of plant stress response genes.Most RAV genes can encode the conserved sequence R / KLFGV, called BRD domain (B3repressiondomain), which mainly plays a role in transcriptional repression (Kagaya Y, Tsukaho H. Arabidopsis transcription factors, RAV1 and RAV2, are regulated by touch-related stimuli in a dose-dependent and biphasic manner. Genes Genet Syst, 2009, 84: 95-99.). In addition, each AP2 / ERF transcription factor contains one or more nuclear localization signal regions, which mainly contain arginine and lysine, which can regulate the transcription factor to enter the cell nucleus to perform its function (Wang YH. Rice ERF Transcriptional Activator DRF2 Regulates Wax Biosynthesis in Leaf Surface. MS Thesis of Chinese Academic of Agricultural Sciences, Beijing, China, 2010). AP2 / ERF transcription factors, especially ERF and DREB subfamilies, occupy an important position in the rice stress response signal transduction pathway. Under normal growth conditions, the expression level of AP2 / ERF gene is usually low, but it increases significantly when encountering adverse stress. AP2 / ERF can bind to GCC-box, DRE / CRT or GT-1 (GAAAAA) and other elements to regulate the expression of downstream target genes, ultimately causing physiological and biochemical changes and helping to resist external adverse stress.

[0004] In summary, the RAV gene family plays a variety of roles in plant biology, and its functions involve growth and development, stress response, hormone signal transduction and other aspects. In-depth research on the RAV gene family helps us understand how plants adapt and respond to complex environmental changes, and provides a theoretical basis and molecular tools for crop improvement and agricultural production. However, the function of the RAV family in rice resistance to rice blast is still unclear. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an application of a transcription factor gene OsRAV9 in rice blast resistance. The application is to enhance rice blast resistance by overexpressing OsRAV9, thereby providing a new genetic resource for rice blast resistant rice.

[0006] (1) Cloning of OsRAV9 gene

[0007] Leaf RNA was extracted from the japonica rice variety Nipponbare and reverse transcribed into cDNA using reverse transcriptase SuperscriptⅢ (purchased from Invitrogen, USA). Reaction conditions: 65℃5min, 50℃60min, 70℃10min. Using rice genome information, amplification primers forward primer OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and reverse primer OsRAV9-full-R (5'ATCACCAGAGTCCAACACATTACCT3') were synthesized to amplify the full-length cDNA of OsRAV9 gene (1722bp). PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 59℃30sec, 72℃2min 50sec, 28 cycles; 72℃ extension for 7min. The amplified PCR product was connected to the pGEM-T vector (purchased from Promega, USA), and positive clones were screened and sequenced to obtain the desired gene ORF, whose sequence was the nucleotide sequence shown in SEQ ID NO: 1, encoding a 365 amino acid sequence (sequence shown in SEQ ID NO: 2).

[0008] (2) Construction of OsRAV9 gene overexpression and CRISPR / Cas9 knockout strains

[0009] The present invention respectively constructed the overexpression vector pU1301-OsRAV9-Flag (see Figure 2 Figure A) and CRISPR / Cas9-OsRAV9 gene knockout vector ( Figure 2 B in the figure), the applicant used the Agrobacterium transformation method to transform the two vectors into the japonica rice variety Nipponbare, respectively, to obtain the gene overexpression positive strain and CRISPR / Cas9 positive strain, detected their expression levels and selected two T1 generation overexpression strains (numbered OE-RAV9-14 and OE-RAV9-13, see Figure 3 Figure A in Figure 2) and two CRISPR / Cas9 transformed strains (designed detection primers upstream and downstream of the target site, amplified the corresponding fragments and sequenced them, screened the target site for gene editing, caused large fragment deletions or premature translation termination materials for subsequent experiments, and finally selected two premature termination strains numbered rav9-4 and rav9-9 (see Figure 2). Figure 3 Figure B in the figure) as the subsequent test material.

[0010] (3) Identification of OsRAV9 gene in rice blast resistance

[0011] The present invention conducted rice blast inoculation identification on OsRAV9 transgenic materials (overexpression strains and CRISPR / Cas9 mutant strains), and found that compared with the control materials, the OsRAV9 overexpression materials had enhanced resistance to rice blast, while the mutant materials were more susceptible to rice blast ( Figure 4 ). The results of hydrogen peroxide detection 5 days after inoculation with rice blast showed that the hydrogen peroxide content in the overexpression plants was higher ( Figure 5 ). This indicates that OsRAV9 is a positive regulator of rice resistance to rice blast.

[0012] Advantages of the present invention:

[0013] (1) The present invention screens and identifies the OsRAV9 gene by analyzing the expression pattern of rice elongation factor complex genes induced by rice blast, and finds that OsRAV9 is a positive regulatory factor for rice resistance to rice blast. Through genetic transformation, the gene is overexpressed to obtain a new rice strain resistant to rice blast, which can also be used as a potential marker gene for rice resistance materials.

[0014] (2) Rice overexpressing OsRAV9 showed significantly enhanced resistance to rice blast, while the rav9 mutant was more susceptible to rice blast. This indicates that the OsRAV9 gene is involved in the resistance response of rice to rice blast and plays an important role. Increasing the expression of the OsRAV9 gene can regulate the accumulation of hydrogen peroxide in rice, thereby improving the resistance of rice to rice blast. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 :OsRAV9 induced expression pattern and phylogenetic tree analysis. Figure 1 Figure A shows that OsRAV9 was significantly induced in wild-type Nipponbare rice at 0, 48, 72, 96, and 144 hours after inoculation with rice blast fungus, compared with the control.

[0016] Figure 2 :Construction of OsRAV9 overexpression vector and CRISPR / Cas9 gene knockout vector. Figure 2 Figure A in the figure is a map of the pU1301-OsRAV9-3*Flag overexpression vector. Figure 2 Figure B is the map of the CRISPR / Cas9-OsRAV9 gene knockout vector.

[0017] Figure 3 :Detection results of transgenic offspring. Figure 3Figure A in the figure is the detection result of the expression level of OsRAV9 overexpression material (T1 generation). Explanation of the accompanying drawings: Two rice transgenic lines, OE-RAV9-14 (high expression level) and OE-RAV9-13 (medium expression level), were selected for subsequent research. Figure 3 Figure B is the detection of gene editing types of RAV9 mutants. Two mutant strains, rav9-4 and rav9-9, with premature translation termination, were selected for subsequent studies.

[0018] Figure 4 :Identification of resistance to rice blast of control materials and transgenic materials. Figure 4 Figure A in the middle shows the phenotypic observation of the control material (WT) and transgenic materials (OE-14, OE-13, rav9-4, rav9-9) 5 days after inoculation with rice blast fungus. Figure 4 Figure B in the middle shows the statistical results of plaque area. The results showed that compared with the control material, OsRAV9 overexpression was more resistant to rice blast, while RAV9 mutant was more susceptible to rice blast.

[0019] Figure 5 : Determination of hydrogen peroxide content in control materials and transgenic materials 5 days after inoculation with rice blast fungus. DETAILED DESCRIPTION

[0020] Description of the sequences in the sequence listing

[0021] SEQ ID NO: 1 is the nucleotide sequence of the OsRAV9 gene cloned in the present invention.

[0022] SEQ ID NO: 2 is the protein sequence encoded by the OsRAV9 gene.

[0023] The following examples define the present invention and describe the methods of isolating and cloning a cDNA segment containing the complete coding region of the OsRAV9 gene and verifying the function of the OsRAV9 gene. Based on the following description and these examples, those skilled in the art can determine the essential characteristics of the present invention and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to adapt it to different uses and conditions.

[0024] Example 1: Isolation and cloning of OsRAV9 gene

[0025] 1. Rice RNA extraction and reverse transcription

[0026] Total RNA was extracted from fresh leaves of wild-type japonica rice variety Nipponbare (a publicly used rice material) using a plant RNA extraction kit (MiniBEST Plant RNA Extraction Kit) to extract total RNA. The method of use was referred to the instructions of TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. The RNA sample was first subjected to a genomic DNA elimination reaction. The DNA removal reaction solution system was: 2.0μL 5×gDNAEraser Buffer, 1.0μL gDNAEraser, 1.0μg RNA, 6.0μL RNase free ddH2O. After mixing, the reaction was carried out in a 42℃ dry bath for 2min. The digested mixture was taken out for reverse transcription reaction. The reaction system was: 1.0μL Prime Script RT EnzymeMix I, 4.0μL RT Primer Mix, 4.0μL 5×Prime Script Buffer 2, 1.0μL RNase-FreeddH2O, and 10.0μL digested mixture. Reverse transcription reaction conditions: 37°C, 15 min; 85°C, 5 sec, stored at 4°C.

[0027] 2. Analysis of the expression pattern of OsRAV9 gene induced by rice blast fungus

[0028] In order to explore whether the OsRAV9 gene is involved in the disease resistance process of rice, the present invention uses the RT-qPCR method to detect the relative expression changes of the OsRAV9 gene transcription level in wild-type rice not inoculated with rice blast fungus and rice inoculated with rice blast fungus after 0, 48, 72, 96, and 144 hours. The results show that the OsRAV9 gene is significantly induced by the rice blast fungus to up-regulate expression. Wild-type Nipponbare rice belongs to conventional japonica rice. When it grows to the 4-leaf stage in the greenhouse, the rice blast detached leaf inoculation is carried out. The rice blast strain Guy11 is a conventional rice blast fungus. The rice blast fungus inoculation adopts the conventional leaf cutting method, that is, the leaf segment of about 5 cm in the front of the rice plant that has grown to the four-leaf and one-heart stage is inoculated. The rice blast fungus culture follows the publicly published method. After inoculation, the inoculated leaves are taken at different time points to extract total RNA, and reverse transcribed into cDNA as a template. OsRAV9 specific primers were designed, including forward primer qOsRAV9-F (5'CGTCTGTTGTTTCATCTTCGAT 3') and reverse primer qOsRAV9-R (5'CATTTGCAATCTCTGACCTGAC 3'), and rice endogenous actin Actin (gene accession number AK101613) was used as the internal reference gene Actin-F (forward primer 5'GAGACCTTCAACACCCCTGCTA-3') and reverse primer Actin-R (5'ATCACCAGAGTCCAACACATTACCT3'). Real-time quantitative RT-qPCR analysis kit ( Geeen PCR Master Mix, refer to the instructions for use of the kit), and the reaction was carried out on a BIO-Rad CFX Connect (manufactured by BIO-Rad) fluorescence quantitative PCR instrument. The results showed that OsRAV9 was significantly upregulated by rice blast, suggesting that OsRAV9 may be involved in the resistance response of rice to rice blast fungus.

[0029] 3. OsRAV9 gene sequence acquisition

[0030] The full-length sequence of OsRAV9 was cloned using the forward primer OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and the reverse primer OsRAV9-full-R (5'TAGGTGCCCTGCTGTTATAG 3') and the cDNA of japonica rice Nipponbare as a template. PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 59℃30sec, 72℃1min 330sec, 30 cycles; 72℃ extension for 7min. The amplified PCR product was connected to the pGEM-T vector, the positive clones were screened and sequenced, and the positive strains were stored at -80℃. The desired open reading frame (ORF) of the OsRAV9 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 574 amino acids corresponding to the open reading frame (ORF) of the OsRAV9 gene were determined by BlastX (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the OsRAV9 gene was inferred to be as shown in SEQ ID NO: 2 in the sequence listing.

[0031] Example 2: Construction of OsRAV9 overexpression and CRISPR / Cas9 gene knockout vector

[0032] 1. Construction of overexpression vector

[0033] In order to verify the gene function of OsRAV9, the applicant constructed an overexpression vector to transform Nipponbare embryonic callus. Using the plasmid of the OsRAV9 positive clone obtained in Example 1 as a template, overexpression primers were designed, and homologous recombination linker bases were added to both ends of the primers. The primers were named forward primer OsRAV9-OE-F (5'GAACGATAGCCGGTACCATGGGGGTGGTCAGCTT') and reverse primer OsRAV9-OE-R (5'CTTTGTAATCGGATCCCTATAACAGCAGGGCACC 3'), and PCR amplification was performed. The obtained PCR product was subjected to agarose electrophoresis and purified and recovered and stored at -20°C for standby use. The pU1301-3*Flag strain was activated in liquid LB medium (with 50 mg / L kanamycin added), and after extracting the plasmid, it was double-digested with KpnI and BamHI, and the enzyme digestion product was purified and recovered and stored at -20°C for standby use. The OsRAV9 target fragment to be connected after the above enzyme digestion was connected with the linearized vector pU1301-3*Flag by homologous recombinase to obtain a recombinant vector (pU1301-OsRAV9-3*Flag). The specific reaction system was: 1.0 μL of pU1301-3*Flag vector linearized after double enzyme digestion, 1.0 μL of 5×CEⅡBuffer, 0.5 μL of ExnaseⅡ homologous recombinase, 0.8 μL of PCR purification and recovery product of OsRAV9 with vector connector, and the volume was supplemented to 5.0 μL with sterile ddH2O. After reacting at 37℃ for 0.5h, heat shock transformation of E. coli was performed, and the strain used was E. coli DH5α. The specific transformation process is as follows: melt the E. coli DH5α competent cells stored at -80℃ in an ice bath, add 50μL competent cells to 5μL ligation reaction, mix gently, and place on ice for 15-30min; after the ice bath, place in a 42℃ water bath for 90sec, and then quickly place on ice for 3min; add 400μL LB liquid culture medium, and resuscitate at 37℃, 200rpm for 45min; after the recovery, centrifuge at 5000rpm for 2min, discard 300μL of supernatant, and resuspend the bacteria with the remaining supernatant; evenly spread the bacterial liquid on the solid culture medium of LB (add 50mg / L kanamycin), and invert and culture at 37℃ overnight. Pick a single clone, select 2-3 positive clones for sequencing, save the strain without any mutation and the corresponding plasmid, and name it as the recombinant plasmid pU1301-OsRAV9-3*Flag.The correctly sequenced recombinant plasmid pU1301-OsRAV9-3*Flag was transferred into the competent cell of Agrobacterium tumefaciens EHA105 by freeze-thaw method, and a single colony was picked and placed in YEP liquid medium (YEP liquid medium is a commonly used medium, and 30 mg / L rifampicin and 50 mg / L kanamycin were added in this embodiment), and cultured at 28°C with shaking for 36-48 h. After PCR detection, the positive strains were added with an appropriate amount of glycerol and stored at -80°C for later use.

[0034] 2. Construction of CRISPR / Cas9 gene knockout vector

[0035] Using CRISPR-P 2.0 ( CRISPR- Pv2.0(hzau.edu.cn) ) designed the guide RNA (gRNA) of OsRAV9. Based on the DNA sequence and gene structure of OsRAV9, two gRNAs were designed (i.e., gRNA1: 5'GCAGTCGTCGCGGTACAAGG 3'; gRNA2: 5'CGCGGCCACCAACTTCCCCG 3'). The synthetic linker primers RAV9-gRNA1-U3F (5'GCAGTCGTCGCGGTACAAGGgttttagagctagaaata 3'), RAV9-gRNA1-U3R (5'CCTTGTACCGCGACGACTGCtgcaccagccgggaat3'), RAV9-gRNA2-U3F (5'

[0036] CGCGGCCACCAACTTCCCCGgttttagagctagaaata 3'),RAV9-gRNA2-U3R(5'

[0037] CGGGGAAGTTGGTGGCCGCGtgcaccagccgggaat 3'), and the linker primers S5AD5-F (5'CAGATGATCCGTGGCAACAAAG3') and S5AD5-R (5'TTTCTAGCTCTAAAACAAAA 3') required for gRNA to be linked into the expression vector pRGEB32; L5AD5-F (5'CAGATGATCCGTGGCAACAAAGCACCAGTGGTCTAG3') and L5AD5-R (5'

[0038] TTTCTAGCTCTAAAACAAAAAAAAAAGCACCGACTCG3'). Using pGTR plasmid as template, PCR amplification was performed with three pairs of primers: L5AD5-F / RAV9-gRNA1-U3R, RAV9-gRNA1-U3F / RAV9-gRNA2-U3R, and RAV9-gRNA2-U3F / L5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 59℃30sec, 72℃30sec, 26 cycles; 72℃ extension for 7min. The three PCR products obtained were diluted 20-50 times and mixed in equal volumes. Take 1μL of the above mixture as a template and amplify with the S5AD5-F / S5AD5-R primer pair. PCR reaction conditions: 94℃ pre-denaturation for 3min; 94℃30sec, 59℃30sec, 72℃45sec, 26 cycles; 72℃ extension for 7min. The obtained product (i.e., the DNA fragment of two gRNAs in series) was purified and recovered, and the concentration was determined; the CRISPR / Cas9 expression vector pRGEB32 was digested with BsaI, and the digestion product was purified and recovered to obtain a linearized pRGEB32 vector. The purified PCR product was connected to the linearized pRGEB32 vector using the infusion recombination method. Specific reaction conditions: 100ng of PCR product, 50-80ng of linearized pRGEB32 vector, 1μL of infusion enzyme (takara), 1μL of 10×infusion buffer, ddH2O was added to 10μL, and the reaction was carried out at 50℃ for 30min. The above reaction product was heat-shocked and transformed into Escherichia coli DH5α, single clones were selected for positive detection and sequencing, positive strains and plasmids were saved, and the positive plasmids were transformed into Agrobacterium tumefaciens EHA105 competent cells. A single colony was picked and placed in YEP liquid medium (YEP liquid medium is a commonly used medium, and 30 mg / L rifampicin and 50 mg / L kanamycin were added in this example), and cultured at 28°C with shaking for 36-48 h. After PCR detection, positive strains were added with an appropriate amount of glycerol and stored at -80°C for later use.

[0039] Example 3: Rice genetic transformation

[0040] 1. Induce callus: Prepare sterile callus induction medium in advance, and pour 40-50mL of induction medium into a 100mL Erlenmeyer flask. Peel off the husks of rice seeds (variety Nipponbare, same as above), perform aseptic operation in a clean bench, first soak the seeds in 75% ethanol solution for 1 minute, then soak the seeds in 0.1% HgCl2 solution for 15-20 minutes, and finally wash with sterile water 5-10 times. Plant 8-12 seeds in each bottle of culture medium, and culture in the dark at 28°C for 40-50 days to induce the production of callus;

[0041] 2. Subculture: Prepare the subculture medium 2-3 days in advance. The formula of the subculture medium is callus induction medium. Sterilize the medium according to the conventional method and make the medium dry (a medium with too much humidity is not conducive to the growth of callus). From the induced callus, select the light yellow, granular, dry, and vigorous callus and transfer it to the subculture medium. Culture it in the dark at 28℃ for 20 days;

[0042] 3. Pre-culture: Use 500mL triangular flasks to pack sterile pre-culture medium in advance. Before the test, add 300μL 100Mm acetosyringone and 5mL 40% glucose to every 250mL medium. After mixing, each bottle is filled with 8-10 dishes of medium. From the subcultured callus, pick the callus with a light yellow appearance, granular, dry and strong vitality and transfer it to the culture dish of the pre-culture medium. Inoculate each dish with about 60-80 pieces of mung bean-sized callus. If the callus is larger, it can be crushed with sterile tweezers. Culture it in the dark at 8℃ for 3d.

[0043] 4. Infection and co-cultivation: 2 days before the test, the Agrobacterium strain containing the target gene (OsRAV9) was streaked on a plate containing antibiotics (30 mg / L rifampicin and 50 mg / L kanamycin) to activate it. Prepare suspension culture medium (100 mL / strain), co-culture medium (250 mL / strain), large plate, small plate (with absorbent paper and filter paper inside, sterilized and dried before use), and several 250 mL sterile triangular flasks. Scrape the streaked cultured Agrobacterium into 1 / 2N6 suspension culture medium (N6 culture medium is a commonly used plant tissue culture medium, add 100 μL AS + 2mL50% glucose), and culture at 28°C, 200rpm, for 30 minutes. Shake the culture and collect the pre-cultured callus into a 250 mL sterile triangular flask. Pour the Agrobacterium bacterial solution into the callus and soak it for 30 minutes. Pour off the bacterial solution, first invert the triangular bottle containing the callus tissue on a sterile small dish, absorb the bacterial solution, then spread the callus tissue on the filter paper of the sterile large dish, cover it with a piece of filter paper, press the callus tissue lightly with sterile tweezers, absorb the surface bacterial solution, and dry it naturally for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue on the co-culture medium (it is best not to move it after spreading it to reduce the contact between the culture medium and the surface of the callus tissue and prevent excessive growth of Agrobacterium), and culture it in the dark at 19℃ for 3 days.

[0044] 5. Washing and screening (referred to as S1 medium): prepare sterile water, large dishes, small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and screening medium; transfer the co-cultivated callus tissue to a water washing cup, pour in sterile distilled water until the callus tissue is completely immersed, cover the lid and shake for 20-30 seconds, and pour out the sterile distilled water. Repeat this 2-3 times. Add sterile distilled water to completely immerse the callus tissue, cover the lid and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, and pour out the sterile distilled water. Add sterile distilled water to completely immerse the callus tissue, cover the lid and shake to mix, shake for 20-30 seconds, and let stand for 10 minutes. Finally, pour out the sterile distilled water, add sterile distilled water containing 500 mg / L carbenicillin, and shake at 200rpm for 30 minutes. Pour out the distilled water and dry the callus naturally. Transfer the treated callus tissue to the screening medium and culture it in the dark at 28°C for 20 days;

[0045] 6. Screening (referred to as medium S2): Prepare screening medium S2, add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to each 250 mL medium, open the cover and blow with sterile air for 1.5-2 hours on the clean bench after inverting the plate, the surface of the screening medium should not be too wet, otherwise it will be detrimental to the inhibition of Agrobacterium and the growth of resistant callus during screening; select dry calli without Agrobacterium contamination from S1 medium, place them on S2 medium (inoculate 25 to 30 calli per plate), and culture them in the dark at 28°C for 20 days;

[0046] 7. Callus differentiation: Prepare differentiation medium 3-4 days in advance. Select small pieces of light yellow, dense, dry resistant callus, inoculate them into differentiation medium, and culture them at 28℃ (light intensity 3000Lux) for 40 days. Seedlings will differentiate in the later stage of culture.

[0047] 8. Rooting: Prepare the rooting medium 2-3 days in advance. Prepare 4-5 sterilized empty dishes; pull out the differentiated seedlings from the differentiation medium, take only one seedling from a piece of callus, cut off the overlong leaves and roots with scissors, and insert them into the rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000Lux) for 15-20 days, wait for the roots to grow fully, harden the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0048] The special culture medium formula and preparation thereof for rice genetic transformation involved in the embodiments of the present invention are as follows:

[0049] Mother solution formula:

[0050] 1.MSmax stock solution (10X)

[0051]

[0052] Dissolve gradually, then add distilled water to make up to 1000mL.

[0053] 2.MSmin stock solution (100X)

[0054]

[0055] Note: Na2MoO4 must be dissolved separately, then mixed with other components, made up to 1000mL with distilled water, and stored at room temperature.

[0056] 3.N6max stock solution (10X)

[0057]

[0058] Dissolve gradually, then add distilled water to make up to 1000mL.

[0059] 4.N6min stock solution (100X)

[0060]

[0061] Make up to 1000 mL with distilled water and store at room temperature.

[0062] 5.Fe2+-EDTA stock solution (100X)

[0063] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0064] Add 300 mL of distilled water to another reagent bottle and heat to 70°C, then add 3.73 g of Na2EDTA·2H2O. After dissolution, mix the solutions in the two reagent bottles, keep warm at 70°C for 2 hours, then add distilled water to make up to 1000 mL, and store at 4°C away from light.

[0065] 6. Vitamin stock solution (100X)

[0066]

[0067]

[0068] Add distilled water to make up to 1000 mL and store at 4°C.

[0069] 7.AAmax stock solution (10X)

[0070]

[0071] Add distilled water to make up to 1000 mL and store at room temperature away from light.

[0072] 8.AAmin stock solution (100X)

[0073]

[0074] Na2MoO4 was dissolved separately, then mixed with other components and made up to 1000 mL with distilled water and stored at room temperature away from light.

[0075] 9.6-BA stock solution (1 mg / mL)

[0076] 6-BA 100 mg, add 1.0 mL 1 M KOH and shake until 6-BA is dissolved, then add distilled water to make up to 100 mL and store at room temperature.

[0077] 10. KT stock solution (1 mg / mL)

[0078] KT 100 mg; add 1.0 ml 1M KOH and shake until KT is dissolved, then add distilled water to make up to 100 ml and store at room temperature.

[0079] 11.2,4-D stock solution (1 mg / mL)

[0080] To 100 mg of 2,4-D, add 1.0 ml of 1 M KOH and shake for 5 min. Then add 10 ml of distilled water and shake until the 2,4-D is dissolved. Add distilled water to make up to 100 ml and store at room temperature.

[0081] 12. 100 μM AS stock solution

[0082] AS 0.196g;

[0083] DMSO 10mL;

[0084] Aliquot into 1.5 mL centrifuge tubes and store at 4°C.

[0085] 13.IAA stock solution (1 mg / mL)

[0086] IAA 100mg, add 1.0ml 1N KOH and shake until IAA dissolves, then dilute to 100ml with dH2O and store at room temperature away from light.

[0087] 14. NAA stock solution (1 mg / mL)

[0088] NAA 100mg, add 1.0mL 1M KOH and shake until NAA is dissolved, then dilute to 100mL with distilled water and store at room temperature away from light.

[0089] Culture medium formula:

[0090] 1. Induction medium

[0091]

[0092] pH: 5.9

[0093] Add distilled water to make up to 1000 mL.

[0094] 2. Subculture medium

[0095]

[0096] pH: 5.9

[0097] Add distilled water to make up to 1000 mL.

[0098] 3. Pre-culture medium

[0099]

[0100]

[0101] pH value: 5.6. Add distilled water to make up to 250 mL.

[0102] 4. Co-culture medium

[0103] pH value: 5.6. Add distilled water to make up to 250 mL.

[0104] 5. Suspension culture medium

[0105] pH value: 5.4. Add distilled water to make up to 100 mL.

[0106] 6. Screening medium

[0107]

[0108] pH value: 6.0 Add distilled water to 250ml

[0109] 7. Differentiation Medium

[0110] pH value: 6.0. Add distilled water to make up to 1000 mL.

[0111] 8. Rooting medium

[0112] pH value: 5.8 Add distilled water to 1000 mL. Example 4: Inoculation and identification of rice blast fungus in transgenic materials

[0113] 1. Tomato oatmeal medium OM preparation: boil water, weigh 40g oatmeal, add to boiling water and boil for 30min, filter to extract juice; add 150mL fresh tomato juice to oatmeal juice, add water to make up to 1L, add 1.6% agar; sterilize at conventional high temperature and high pressure. For medium for spore production of rice blast fungus, add 0.6g CaCO3 to 1L medium.

[0114] 2. Purification and preservation of rice blast fungus strains: Use a pipette to apply the conidia liquid of rice blast fungus on a 1.6% water agar plate in a clean bench, place it in a 28°C incubator, and incubate it for 12 hours. Use a pick under a dissecting microscope to pick up the germinated single conidia, and dot it on the OM plate, which is placed in a 28°C incubator. After incubation for 2-3 days, transfer the hyphae formed by the germination of single conidia to a new OM plate. These single-spore purified strains can be used for subsequent experiments. Dot the hyphae blocks of the strain to be preserved on the OM plate covered with sterilized filter paper and place it in a 28°C incubator. After the colony fills the culture dish, take out the filter paper and place it in a sterilized sulfuric acid paper bag. Place the sulfuric acid paper bag in a desiccator for one week, transfer it to a sealed container, and store it at -20°C.

[0115] 3. Spore production: Inoculate the wild-type strain Guy11 on the OM plate and place it in an inverted incubator at 28°C for light culture. After 5 days of growth, use a bacterial loop to fully interrupt the hyphae, evenly spread them on a new OM plate, and place it in an inverted incubator at 28°C for light culture. After 36 hours, use a cotton swab to gently wash off the newly visible aerial hyphae, cover with a double layer of gauze, and place it in an inverted incubator at 28°C for light culture. After 48 hours, use 30 mL of distilled water to thoroughly wash the conidia on the OTA plate into a 50 mL centrifuge tube.

[0116] 4. Spore inoculation: Wash the conidia from the OM plate cultured for 5 days with 30 mL of 0.025% Tween solution, and then filter through a funnel made of three layers of lens paper into a 50 mL centrifuge tube. Adjust the conidia concentration to 2 × 10 5 Pipette 5-10 μL of the adjusted spore suspension and inoculate it onto the surface of rice leaves. Seal the inoculation box with a sealing film to keep warm and moisturize, and use a black cloth to shade the culture. Remove the black cloth after 36 hours, and culture in the light (light intensity). Continue to keep moist for 48 hours before removing the sealing film. Generally, the disease begins 5 days after inoculation.

[0117] 5. Identification of transgenic materials for resistance to rice blast at the seedling stage: 30 transgenic rice leaves and 30 control leaves after disease onset were selected, and plaque images were taken and obtained. The plaque area was counted using the image analysis software ImageJ. Weigh 0.1g of transgenic rice leaves and control leaves 5 days after inoculation, and measure the proline content according to the instructions attached to the hydrogen peroxide (H2O2) content detection kit. Take 3 to 5 replicates for each measurement line, and calculate the average value of the results.

Claims

1. Application of transcription factor OsRAV9 gene in regulating rice blast resistance.

2. The use according to claim 1, characterized in that: The invention discloses an application of a recombinant expression vector comprising a rice transcription factor OsRAV9 gene in improving rice resistance to rice blast, wherein the sequence of the OsRAV9 gene is as shown in SEQ ID NO.1, and the protein sequence encoded by the gene is as shown in SEQ ID NO.2, and the rice is Nipponbare.

Images