Molecular marker related to branch number of medicago sativa and application of molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the number of branches of medicago sativa and application of the molecular marker. The invention solves the technical problems that the traditional new variety breeding of alfalfa with a large number of branches is single plant selection according to the number of branches of breeding offspring, and the method is time-consuming, labor-consuming and low in accuracy. The technical scheme of the invention is a molecular marker related to the number of branches of medicago sativa. The specific information is as follows: chromosome: chr2; the position is 57649197; sNP (Single Nucleotide Polymorphism) typing: C / A. The invention also designs a primer combination aiming at the molecular marker, and the primer combination can be used for directly and specifically distinguishing and detecting A or C basic groups of SNP mutation sites.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to the branch number of alfalfa and application thereof. Background Art

[0002] Alfalfa is an important legume forage, known as the "king of forage grasses". The yield of alfalfa is determined by multiple factors, among which the number of branches is one of the key factors. The number of branches directly determines the plant size and biomass of alfalfa. Studies have shown that increasing the number of branches can significantly increase the dry matter yield of alfalfa.

[0003] At present, alfalfa breeding in my country is still in the conventional breeding stage, and the exploration and identification of important traits such as branch number is not in-depth enough. By studying the genes related to branch number and its regulatory mechanism, molecular markers closely linked to branching traits can be developed for molecular marker-assisted breeding to improve breeding efficiency and accuracy.

[0004] Traditionally, the breeding of new alfalfa varieties with more branches is based on the selection of individual plants according to the number of branches of the breeding offspring. This method is time-consuming, labor-intensive, and has low accuracy. The best way to improve the selection efficiency is to develop specific molecular markers for auxiliary selection by utilizing the base differences of the target gene. Competitive allele-specific PCR (Kompetitive Allele-Specific PCR, KASP) molecular markers are a new SNP typing method based on allele-specific amplification (Amplification Refractory Mutation System, ARMS) and highly sensitive fluorescence detection. The principle is to design two forward primers and a universal reverse primer for the allele SNP site. Each forward primer has a specific sequence that can be combined with different fluorescent markers. The DNA of the sample to be tested is amplified by PCR using forward primers with different fluorescent binding sequences and universal reverse primers, and its allelic variation can be reflected by different fluorescent signals (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75-86).

[0005] Therefore, developing KASP markers that are closely linked to the number of alfalfa branches for use in early selection in breeding is crucial to reducing the breeding workload and accelerating high-yield breeding of alfalfa, while also having significant economic benefits. Summary of the invention

[0006] The technical problem solved by the invention is that the traditional breeding of new alfalfa varieties with a large number of branches is to select individual plants according to the number of branches of breeding offspring, which is time-consuming, labor-intensive and has low accuracy.

[0007] The technical solution of the present invention is a molecular marker related to the branch number of alfalfa, and the specific information is as follows: specific information: chromosome: chr2; position: 57649197; SNP typing: C / A.

[0008] Furthermore, the nucleotide sequence of the molecular marker is shown as SEQ ID No.1 or SEQ ID No.2.

[0009] The present invention also provides a primer combination for amplifying the molecular marker, and the nucleotide sequence thereof is shown in SEQ ID No.3-5.

[0010] The present invention also provides a molecular marker detection kit, comprising primers shown in SEQ ID No.3-5.

[0011] The present invention also provides a molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

[0012] The present invention also provides the use of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following: a. Predict alfalfa index; b. Identify and screen alfalfa with different branch numbers; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare alfalfa breeding products.

[0013] The present invention also provides a method for screening alfalfa materials with different branch numbers, comprising the following steps: extracting genomic DNA of the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No.3-5, sequencing the amplified products, and performing typing screening.

[0014] Specifically, the amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

[0015] In particular, the typing screening criteria are as follows: if the typing result is AA, it is a material with a large number of branches; if the typing result is AC or CC, it is a material with a small number of branches.

[0016] Beneficial effects of the present invention: The present invention found a site (Chr2_57649197) significantly associated with the number of alfalfa branches near 57.64Mb of chromosome 2, with an LOD value of 7.23 and an explainable phenotypic contribution rate of 11.25%. A primer combination was designed for the site. The KASP primer combination developed by the present invention can directly distinguish and detect the A or C base of the SNP mutation site specifically, has good application value, can realize the pre-selection and molecular-assisted breeding of the number of alfalfa branches, and has important theoretical and practical significance for improving the selection efficiency. The molecular marker of the present invention has good application value, can realize the pre-selection and molecular-assisted breeding of the number of alfalfa branches trait, and has important theoretical and practical significance for accelerating the genetic improvement process of breeding materials with suitable number of branches and improving the selection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 GWAS found that the Chr2_57649197 site was significantly associated with the number of branches.

[0018] Figure 2 , KASP marker typing results, red represents AA genotype, purple represents AC genotype, and blue represents CC genotype.

[0019] Figure 3 , comparison of branches between different genotype materials. DETAILED DESCRIPTION

[0020] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation mode, structure, characteristics and effects of the present invention are described in detail below in combination with the accompanying drawings and preferred embodiments.

[0021] Example 1 Acquisition of molecular markers This experimental population consists of 150 alfalfa germplasm materials, including core germplasm, germplasm from different regions and with different phenotypes. Taking into account the differences between different plants of the same variety of alfalfa, this study cut branches from the germplasm resource nursery in 2021 and carried out cuttings in the greenhouse. After the cuttings successfully took root, these germplasm materials were transplanted to experimental fields in Langfang, Hebei and Changping, Beijing. In these experimental sites, the establishment of the experimental population adopted a randomized block design, with three replications set up, each replication containing 10 cuttings. In order to ensure sufficient growth space, the interval between replications was 150 cm, and the distances between rows and plants were set to 150 cm and 60 cm, respectively. During the growth period, no fertilization and irrigation measures were carried out, only manual weeding was carried out. In order to help the plants overwinter, winter watering was carried out.

[0022] At the initial flowering stage, the number of branches of each alfalfa germplasm was counted manually. After obtaining the number of branches in different replicates and different environments for each material, the average was calculated for subsequent GWAS analysis.

[0023] 100 mg of young leaves of alfalfa were selected and quickly frozen in liquid nitrogen. The total plant DNA was then extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were tested using a micro-spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGIDNBSEQ second-generation sequencing platform (BGI, Shenzhen, China).

[0024] About 36 GB of raw data were obtained for each material. The raw sequencing data were removed from the adapter and low-quality base sequences were filtered using Trimmomatic (version 0.39) (Bolger et al., 2014) software. The cleaned sequencing data were then aligned to the haplotype reference genome of "Zhongmu No. 1" alfalfa using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, and the filtered BAM files were obtained and sorted. The Mark Duplicates function in the Picard toolkit (version 2.23.0) was used to mark PCR duplicate sequences. Finally, the processed BAM files were used for variation detection using GATK Haplotype Caller (version 4.2.3.062). In the SNPs filtering strategy, the following parameters were set as screening criteria: quality depth (Qual By Depth, QD) less than 2.0, Fisher Strand (FS) greater than 60.0, mapping quality rank sum test (MQ Rank Sum Test) less than -12.5, read position rank sum test (Read PosRank Sum) less than -8.0, SOR (Strand Odds Ratio) greater than 3.0, mapping quality (Mapping Qualities, MQ) less than 40.0. Subsequently, the screening conditions for the subset of alfalfa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a missing rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter the basic SNP set based on linkage disequilibrium (LD), setting the LD filtering window size to 100 SNPs, the window step to 50 SNPs, and the r2 threshold to 0.2 to obtain a core SNP marker set. The missing genotypes in the SNP marker set after LD filtering were filled in by Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, and only biallelic markers with a missing rate less than 20% and a MAF greater than 0.05% were retained.

[0025] 1,303,375 high-quality SNP markers were used for GWAS analysis. To ensure the accuracy and reliability of the analysis, a variety of software and statistical models were used: TASEEL5.0 (GLM and MLM) (Bradbury PJ et al., 2007), BLINK (v1.01) (Huang et al., 2019). The QQ plot (quantile-quantile plot) is a measure of whether the model is reliable. By comparing the QQ plots generated by different models, we found that the GLM model in TASSEL 5.0 performed better. Therefore, the GLM model of TASSEL 5.0 was selected to present our final results. The SNP data were subjected to principal component analysis, and the first three principal component variables were used as covariates to correct the population structure. The Manhattan plot was visualized using the R package CMplot (Yin et al., 2021). The linkage disequilibrium (LD) analysis of the associated SNPs was calculated and visualized using LDBlockShow (Dong et al., 2021). A locus (Chr2_57649197) significantly associated with the number of alfalfa branches was found near 57.64 Mb on chromosome 2, with a LOD value of 7.23 and an explained phenotypic contribution rate of 11.25% ( Figure 1 ).

[0026] Example 2 Chr2_57649197 site KASP marker development The Chr2_57649197 site is near 57.64Mb of chromosome 2. Specific information: Chromosome: chr2; Position: 57649197; SNP typing: C / A.

[0027] The reference genome "Zhongmu 1" was used to obtain the sequence of about 200bp upstream and downstream of Chr2_57649197: SEQ ID No. 1, where lowercase letters represent SNP sites; TCCTTGCGTGACTAGCTTTAGTTGTCCAAGAAGTACGTGCTTCCCTCCTTCAACACCAAATTGCATTCGTCGTATTTGTGAATGCATCTAAGTATAACAATTAAGTTAAAAAATAATGTTATGTTGCTTGTAATCCAACAATTTTATATAATGTTGCTACTCCTATAATTTTCCTCACTTTTATTTGTATTTTTGTCCTTTaAACTCATTTGCTTGATTTAGAACTCTCATTAGGGGGATTAGTGGACGATCTTAGTACTTGTTAGGCAGGCCTTACTAATTGCTAGTGGCCTTTACTTTTAGTGCTTATGTTCTATAAATTAGACACATTGGGTTGTAAATGATACACCTTAAAGAATACAATACGATCTTGTTCACTTTTTGTTCTTCCACCTTCATCTATATTCTTCTAATAT。

[0028] SEQ ID No.2, where lowercase letters represent SNP sites; TCCTTGCGTGACTAGCTTTAGTTGTCCAAGAAGTACGTGCTTCCCTCCTTCAACACCAAATTGCATTCGTCGTATTTGTGAATGCATCTAAGTATAACAATTAAGTTAAAAAATAATGTTATGTTGCTTGTAATCCAACAATTTTATATAATGTTGCTACTCCTATAATTTTCCTCACTTTTATTTGTATTTTTGTCCTTTcAACTCATTTGCTTGATTTAGAACTCTCATTAGGGGGATTAGTGGACGATCTTAGTACTTGTTAGGCAGGCCTTACTAATTGCTAGTGGCCTTTACTTTTAGTGCTTATGTTCTATAAATTAGACACATTGGGTTGTAAATGATACACCTTAAAGAATACAATACGATCTTGTTCACTTTTTGTTCTTCCACCTTCATCTATATTCTTCTAATAT。

[0029] Bacthprimer 3 software was used to design KASP primers for the Chr2_57649197 site and flanking sequences (SEQ ID No.1 and SEQID No.2). Each set of KASP markers consisted of 2 specific primers and 1 universal primer, and a fluorescent linker sequence was connected to the 5' end of the specific primer (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent linker sequence).

[0030] KASP marker primers are as follows: Specific primer 1 (SEQ ID No. 3): GAAGGTGACCAAGTTCATGCTTGAGAGTTCTAAATCAAGCAAATGAGTTT; Specific primer 2 (SEQ ID No. 4): GAAGGTCGGAGTCAACGGATTGAGAGTTCTAAATCAAGCAAATGAGTTG; Universal primer (SEQ ID No. 5): TGTTGCTACTCCTATAATTTTCCTCACTT.

[0031] Example 3 Use of molecular markers Another 99 alfalfa materials were planted, sampled, and DNA extracted using the method in Example 1, and then analyzed using the Array Tape system of Douglas Scientific. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0032] The PCR system was assembled using NEXAR. The PCR reaction system is shown in Table 1.

[0033] Table 1 KASP reaction system PCR amplification was performed using SOELLEX. The touch down PCR amplification conditions were as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

[0034] After the PCR reaction is completed, ARAYA is used to scan the fluorescence signal of the reaction system; then INTELLICS is used for data analysis and genotyping. Figure 2 As shown, the red one is the AA allele type, the purple one is the A / C allele type, and the blue one is the CC allele type. The allele types of the 99 materials at this site are shown in Table 2. At the same time, the number of branches of each material was counted. The AA allele type germplasm had a higher number of branches (the average value was 72.06), the average number of branches of the A / C allele type germplasm was 49.06, and the CC allele type germplasm had the lowest number of branches, which was 45.16 ( Figure 3 ).

[0035] Table 2 Allele types at this locus in 99 germplasm materials The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technical personnel in this field can make some changes or modify the technical contents disclosed above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A molecular marker associated with the number of branches of alfalfa, characterized in that: The specific information is as follows: Specific information: Chromosome: chr2; Position: 57649197; SNP typing: C / A.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown as SEQ ID No.1 or SEQ ID No.

2.

3. A primer combination for amplifying the molecular marker according to claim 2, characterized in that: Its nucleotide sequence is shown in SEQ ID No.3~5.

4. A molecular marker detection kit, characterized in that: Including primers shown in SEQ ID No.3~5.

5. A molecular marker chip, characterized in that: Including primers shown in SEQ ID No.3~5.

6. Use of the molecular marker according to claim 1 or 2, the primer combination according to claim 3, the kit according to claim 4 and / or the molecular marker chip according to claim 5 in any one of the following: a. Predict the number of alfalfa branches; b. Identify and select alfalfa with different branch numbers; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare alfalfa breeding products.

7. A method for screening alfalfa materials with different branch numbers or predicting the branch number of alfalfa, characterized in that: The method comprises the following steps: extracting genomic DNA of alfalfa materials to be tested, amplifying molecular markers using primers described in SEQ ID No. 3-5, sequencing the amplified products, and performing typing screening.

8. The method according to claim 7, characterized in that: The amplification program was as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

9. The method according to claim 7, characterized in that: The typing screening criteria are as follows: if the typing result is AA, it is a material with a large number of branches; if the typing result is AC or CC, it is a material with a small number of branches.

Images