MMLV reverse transcriptase mutant

Abstract

The invention discloses an MMLV reverse transcriptase mutant. The invention provides an MMLV reverse transcriptase mutant, and compared with a wild type MMLV reverse transcriptase amino acid sequence, the mutant mutates at a plurality of sites such as a 62 site and the like, and the mutant has the characteristics that the template conversion performance is improved, the non-template basic group addition performance is improved or the heat resistance is improved. The MMLV reverse transcriptase mutant with improved conversion performance compared with a wild type template is screened out, and the MMLV reverse transcriptase mutant also has improved non-template base addition performance or thermal stability; the screened mutant is suitable for RNA (Ribonucleic Acid) sequencing, such as Smart-Seq, nanopore sequencing, 5 'RACE (Rapid Amplification of cDNA Ends) and the like, adopting a library preparation method based on template conversion, and can also be applied to RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) and the like.

Description

MMLV reverse transcriptase mutants Technical Field

[0001] The invention belongs to the field of enzyme engineering, and in particular relates to a MMLV reverse transcriptase mutant. Background Art

[0002] Reverse transcriptase, also known as RNA-dependent DNA polymerase, is a specialized DNA polymerase that synthesizes DNA using RNA as a template. Reverse transcriptases were first discovered in RNA viruses and are currently the most extensively studied and widely used. These include Moloney murine leukemia virus reverse transcriptase (MMLV RT), human immunodeficiency virus reverse transcriptase (HIV RT), and avian myeloblastosis virus reverse transcriptase (AMV RT).

[0003] In RNA research, reverse transcription is often used to convert RNA into more stable complementary DNA (cDNA), which is then studied and analyzed through cloning, PCR, gene expression microarrays, sequencing, and other technologies. Therefore, reverse transcription is a key step in many RNA experimental workflows.

[0004] With the rapid development of sequencing technology, RNA-Seq has become a key tool for whole-transcriptome analysis, differential gene expression, and mRNA alternative splicing studies. In recent years, single-cell transcriptome sequencing (scRNA-Seq) and spatial transcriptome sequencing have also gained popularity. Single-cell transcriptome sequencing, which sequences the transcriptome at the single-cell level, enables the investigation of gene expression within individual cells, addressing the challenge of cellular heterogeneity that cannot be addressed with tissue sample sequencing. This makes it possible to analyze the behavior and mechanisms of individual cells and their relationship to the organism. It has applications in areas such as the construction of a human cell atlas, the study of tumor heterogeneity, and research in areas such as immunity, development, and differentiation. While conventional transcriptome sequencing and scRNA-Seq can provide detailed data on tissues or cell populations, they struggle to capture the spatial location of cells, hindering the accurate understanding of the relationship between cellular environment and gene expression. Spatial transcriptome sequencing, however, enables the exploration of gene expression within the context of the tissue microenvironment. Spatial transcriptome sequencing combines spatial RNA information with morphological data to map gene expression, providing crucial insights into the relationship between cell function, phenotype, and location within the tissue microenvironment.

[0005] Furthermore, template-switch-based library preparation methods have become the preferred method for single-cell and spatial transcriptome sequencing due to their simple workflow and low RNA usage. In addition to leveraging the reverse transcriptase's ability to polymerize RNA as a template, template-switch-based library preparation methods also utilize two other properties of reverse transcriptase: non-templated base addition (NTA) and template switching (TS). In template switching-based library preparation, reverse transcription is first initiated at the 3' end of the mRNA using an oligo(dT) fused with a known sequence as a primer. The reverse transcriptase then adds a template-independent base (usually considered to be CCC) to the 3' end of the cDNA through its NTA activity. The protruding template-independent CCC base can bind to the rGrGrG at the 3' end of the template switching oligo (TSO). At this point, the reverse transcriptase exerts its template switching ability, switching from RNA as a template to TSO as a template for extension, ultimately forming a cDNA with known sequences at both ends. This cDNA can be used as a template for PCR amplification or library construction.

[0006] Currently, the reverse transcriptases used in single-cell transcriptome sequencing, spatial transcriptome sequencing, and Smart-Seq are primarily modified versions of the Moloney murine leukemia virus (MMLV) reverse transcriptase. Modified MMLV reverse transcriptases generally exhibit high reverse transcription activity, reduced RNase H activity, or higher temperature tolerance. However, modifications to the non-templated base addition and template switching performance required for template-switch-based library preparation methods are rare. Although these modified reverse transcriptases have been commercialized and applied in various RNA sequencing applications, they still have limitations, such as low cDNA yield and low gene capture, which to some extent limit the development of transcriptome sequencing technologies. Therefore, developing a reverse transcriptase with enhanced template-switch performance is crucial.

[0007] Invention Disclosure

[0008] The object of the present invention is to provide a MMLV reverse transcriptase mutant having improved template switching performance, improved non-templated base addition performance or improved heat resistance.

[0009] In a first aspect, the present invention provides an MMLV reverse transcriptase mutant. Compared with the wild-type MMLV reverse transcriptase amino acid sequence shown in SEQ ID NO. 2, the mutant has mutations in amino acid residues at one or more of the following positions: 62, 65, 70, 81, 105, 109, 124, 152, 175, 176, 186, 269, 284, 334, 425, and the mutant has reverse transcriptase activity.

[0010] In the above text, positions 62, 65, 70, 81, 105, 109, 124, 152, 175, 176, 186, 269, 284, 334, and 425 are positions 62, 65, 70, 81, 105, 109, 124, 152, 175, 176, 186, 269, 284, 334, and 425 on SEQ ID NO. 2. The above mutations are all point mutations and will not cause insertions, deletions, or frameshifts.

[0011] In the above, the mutation modes of the various sites are as follows:

[0012] K at position 62 mutated to R;

[0013] The P at position 65 is mutated to N, T, K, or L;

[0014] The A at position 70 mutated to S;

[0015] L at position 81 mutated to A;

[0016] The G at position 105 mutated to R;

[0017] The Y at position 109 mutated to R;

[0018] The D at position 124 mutated to a K;

[0019] K at position 152 mutated to R;

[0020] The P at position 175 mutated to S;

[0021] E at position 176 mutated to R;

[0022] The T at position 186 mutated to an A;

[0023] L at position 269 mutated to R;

[0024] The R at position 284 mutated to a T;

[0025] F at position 334 mutated to N;

[0026] The K at position 425 mutated to R.

[0027] In a second aspect, the present invention provides an MMLV reverse transcriptase mutant, wherein the mutant is based on the mutant described in the first aspect, and the amino acid residues of the mutant are mutated at one or more of the following sites: 39, 66, 67, 68, 69, 80, 99, 116, 200, 286, 289, 302, 306, 313, 333, 435, 450, 454, 524, 562, 583 and 653.

[0028] In the above text, positions 39, 66, 67, 68, 69, 80, 99, 116, 200, 286, 289, 302, 306, 313, 333, 435, 450, 454, 524, 562, 583 and 653 are mutant positions, which are the same as the positions 39, 66, 67, 68, 69, 80, 99, 116, 200, 286, 289, 302, 306, 313, 333, 435, 450, 454, 524, 562, 583 and 653 of SEQ ID NO. 2.

[0029] In the above, the mutation methods of each site are as follows:

[0030] The M at position 39 mutated to D or R;

[0031] The M at position 66 mutated to V, K, Y, or L;

[0032] The S at position 67 mutated to a T;

[0033] The Q at position 68 was mutated to N or K;

[0034] E at position 69 mutated to K or R;

[0035] The R at position 80 mutated to a T;

[0036] The mutation of L at position 99 was to A;

[0037] The R at position 116 mutated to a D;

[0038] The D at position 200 mutated to N;

[0039] E at position 286 mutated to R;

[0040] The M at position 289 mutated to an L;

[0041] E at position 302 mutated to K;

[0042] T at position 306 mutated to R;

[0043] The W at position 313 mutated to F;

[0044] L at position 333 mutated to A or K;

[0045] L at position 435 mutated to G;

[0046] The R at position 450 mutated to H;

[0047] The N at position 454 mutated to a K;

[0048] The D at position 524 mutated to G or A;

[0049] E at position 562 mutated to Q;

[0050] The D at position 583 mutated to N;

[0051] The D at position 653 was mutated to N.

[0052] The MMLV reverse transcriptase mutant provided in the first or second aspect above has the following characteristics: compared with the wild-type MMLV reverse transcriptase, the MMLV reverse transcriptase mutant has improved template switching activity, improved non-templated base addition performance and / or improved thermal stability.

[0053] In some embodiments of the present invention, the MMLV reverse transcriptase mutant provided in the first aspect or the second aspect above has the following further feature: compared with the wild-type MMLV reverse transcriptase, the template switching activity of the MMLV reverse transcriptase mutant is increased to 1-42 times that of the wild-type MMLV reverse transcriptase.

[0054] In some embodiments of the present invention, the MMLV reverse transcriptase mutant provided in the first aspect or the second aspect above has the following further feature: compared with the wild-type MMLV reverse transcriptase, the non-templated base addition performance of the MMLV reverse transcriptase mutant is improved to 1-1.85 times that of the wild-type MMLV reverse transcriptase.

[0055] In some embodiments of the present invention, the MMLV reverse transcriptase mutant with improved template switching activity (template switching performance is improved to 1-42 times that of wild-type MMLV reverse transcriptase) is a mutant having any of the following mutation forms:

[0056] Single-site mutations: M39D, K62R, P65T, P65K, M66V, E69R, A70S, L81A, L99A, G105R, D124K, K152R, P175S, E176R, L269R, T306R, W313F, L333A, L333K, F334N, L435G, N454K, D524G, D524A, or D583N;

[0057] or, double-site mutations: M66L and S67T, M66V and S67T, E302K and E286R, D524G and R450H, D524G and E562Q, or, E562Q and D583N;

[0058] or, three point mutations: E286R, E302K, and D524A;

[0059] or, six mutations: E69K, E302K, W313F, N454K, D524G, and D653N;

[0060] Or, seven-site mutation:

[0061] M39D, E69K, E302K, W313F, N454K, D524G and D653N;

[0062] or, M39R, E69K, E302K, W313F, N454K, D524G and D653N;

[0063] or, K62R, E69K, E302K, W313F, N454K, D524G and D653N;

[0064] or, E69K, R80T, E302K, W313F, N454K, D524G and D653N;

[0065] or, E69K, L99A, E302K, W313F, N454K, D524G and D653N;

[0066] or, E69K, G105R, E302K, W313F, N454K, D524G and D653N;

[0067] or, E69K, Y109R, E302K, W313F, N454K, D524G and D653N;

[0068] or, E69K, D124K, E302K, W313F, N454K, D524G and D653N;

[0069] or, E69K, K152R, E302K, W313F, N454K, D524G and D653N;

[0070] or, E69K, D200N, E302K, W313F, N454K, D524G and D653N;

[0071] or, E69K, E286K, E302K, W313F, N454K, D524G and D653N;

[0072] or, E69K, E286R, E302K, W313F, N454K, D524G and D653N;

[0073] or, P65K, E69K, E302K, W313F, N454K, D524G and D653N;

[0074] or, P65N, E69K, E302K, W313F, N454K, D524G and D653N;

[0075] or, P65T, E69K, E302K, W313F, N454K, D524G and D653N;

[0076] or, M66V, E69K, E302K, W313F, N454K, D524G and D653N;

[0077] or, E69K, A70S, E302K, W313F, N454K, D524G and D653N;

[0078] or, E69K, E302K, T306K, W313F, N454K, D524G and D653N;

[0079] or, E69K, E302K, T306R, W313F, N454K, D524G and D653N;

[0080] or, M66Y, E69K, E302K, W313F, N454K, D524G, and D653N;

[0081] or, E69K, P175S, E302K, W313F, N454K, D524G and D653N;

[0082] or, E69K, E176R, E302K, W313F, N454K, D524G and D653N;

[0083] or, E69K, E302K, W313F, L333K, N454K, D524G and D653N;

[0084] or, E69K, E302K, W313F, L333A, N454K, D524G and D653N;

[0085] Or, eight-point mutation:

[0086] M66L, S67T, E69K, E302K, W313F, N454K, D524G and D653N;

[0087] or, E69K, E176R, E302K, W313F, L333K, N454K, D524G and D653N;

[0088] Or, E69K, E176R, E302K, W313F, L333A, N454K, D524G and D653N.

[0089] In some embodiments of the present invention, the MMLV reverse transcriptase mutant having higher template switching activity than the commercial SSII enzyme is a mutant having any of the following mutation forms:

[0090] Single-site mutations: P65K, E69R, G105R, D124K, E176R, T306R, L333A, N454K, or D524G;

[0091] or, double-site mutations: D524G and E562Q or E562Q and D583N;

[0092] or, three point mutations: E286R, E302K, and D524A;

[0093] or, six mutations: E69K, E302K, W313F, N454K, D524G, and D653N;

[0094] Or, seven-site mutation:

[0095] M39D, E69K, E302K, W313F, N454K, D524G and D653N;

[0096] or, M39R, E69K, E302K, W313F, N454K, D524G and D653N;

[0097] or, K62R, E69K, E302K, W313F, N454K, D524G and D653N;

[0098] or, E69K, R80T, E302K, W313F, N454K, D524G and D653N;

[0099] or, E69K, L99A, E302K, W313F, N454K, D524G and D653N;

[0100] or, E69K, G105R, E302K, W313F, N454K, D524G and D653N;

[0101] or, E69K, Y109R, E302K, W313F, N454K, D524G and D653N;

[0102] or, E69K, D124K, E302K, W313F, N454K, D524G and D653N;

[0103] or, E69K, K152R, E302K, W313F, N454K, D524G and D653N;

[0104] or, E69K, D200N, E302K, W313F, N454K, D524G and D653N;

[0105] or, E69K, E286K, E302K, W313F, N454K, D524G and D653N;

[0106] or, E69K, E286R, E302K, W313F, N454K, D524G and D653N;

[0107] or, P65K, E69K, E302K, W313F, N454K, D524G and D653N;

[0108] or, P65N, E69K, E302K, W313F, N454K, D524G and D653N;

[0109] or, P65T, E69K, E302K, W313F, N454K, D524G and D653N;

[0110] or, M66V, E69K, E302K, W313F, N454K, D524G and D653N;

[0111] or, E69K, A70S, E302K, W313F, N454K, D524G and D653N;

[0112] or, E69K, E302K, T306K, W313F, N454K, D524G and D653N;

[0113] or, E69K, E302K, T306R, W313F, N454K, D524G and D653N;

[0114] or, M66Y, E69K, E302K, W313F, N454K, D524G, and D653N;

[0115] or, E69K, P175S, E302K, W313F, N454K, D524G and D653N;

[0116] or, E69K, E176R, E302K, W313F, N454K, D524G and D653N;

[0117] or, E69K, E302K, W313F, L333K, N454K, D524G and D653N;

[0118] or, E69K, E302K, W313F, L333A, N454K, D524G and D653N; or, eight mutations:

[0119] M66L, S67T, E69K, E302K, W313F, N454K, D524G and D653N;

[0120] or, E69K, E176R, E302K, W313F, L333K, N454K, D524G and D653N;

[0121] Or, E69K, E176R, E302K, W313F, L333A, N454K, D524G and D653N.

[0122] In a third aspect, the present invention provides a nucleic acid molecule encoding the mutant provided in the first or second aspect.

[0123] In a fourth aspect, the present invention provides an expression cassette, a recombinant vector or a transgenic cell line comprising the nucleic acid molecule described in the third aspect above.

[0124] In some embodiments of the present invention, the recombinant vector is a vector obtained by cloning the nucleic acid molecule described in the third aspect above into an expression vector, and the above expression vector may be pET-22b or other prokaryotic expression vectors.

[0125] In the embodiments of this aspect, the mutants in each recombinant vector are expressed by the pET-22b promoter, and six His tags are fused at the C-terminus. The His tags can be used for Ni column affinity purification during purification.

[0126] In a fifth aspect, the present invention provides a recombinant bacterium comprising the nucleic acid molecule of the third aspect above.

[0127] In some embodiments of the present invention, the recombinant bacteria are obtained by transferring the above-mentioned nucleic acid molecules into host cells, and the host cells may be Escherichia coli, such as Escherichia coli BL21.

[0128] In a sixth aspect, the present invention provides use of the nucleic acid molecule in the third aspect, the expression cassette, recombinant vector or transgenic cell line in the fourth aspect, or the recombinant bacteria in the fifth aspect in preparing MMLV reverse transcriptase.

[0129] In a seventh aspect, the present invention provides a method for preparing a mutant of the first aspect or the second aspect, comprising the steps of culturing the recombinant bacteria of the fifth aspect, and then performing an induction treatment to obtain a mutant.

[0130] In some embodiments of the present invention, specifically:

[0131] The recombinant bacteria were cultured to OD 600 The concentration of IPTG was between 0.6 and 0.8, and then the inducer IPTG was added to induce the culture at a final concentration of 0.5 mM. The induced bacterial cells were collected, and the bacterial cells were ultrasonically disrupted and purified to obtain the mutants.

[0132] In some embodiments of the present invention, purification can be crude purification, specifically achieved using a His MultiTrap HP purification plate; alternatively, purification can be performed using polishing, including affinity chromatography, anion exchange chromatography, and cation exchange chromatography.

[0133] In an eighth aspect, the present invention provides a kit comprising the mutant of the first aspect or the second aspect.

[0134] In the above, the kit further comprises at least one of the following: one or more nucleotides, one or more DNA polymerases, one or more primers, and one or more terminators.

[0135] In some embodiments of the present invention, the kit further comprises one or more buffers.

[0136] In a ninth aspect, the present invention provides a method for reverse transcribing a nucleic acid molecule, comprising the steps of:

[0137] mixing at least one nucleic acid template with at least one reverse transcriptase to obtain a mixture, wherein the reverse transcriptase is a mutant as described in the first or second aspect above;

[0138] The mixture is subjected to a reverse transcription reaction to obtain a reverse transcribed nucleic acid molecule that is fully or partially complementary to at least one template.

[0139] In a tenth aspect, the present invention provides a method for nucleic acid amplification, comprising the following steps:

[0140] Mixing at least one nucleic acid template with at least one reverse transcriptase to perform a first mixing reaction to obtain a reaction product, wherein the reverse transcriptase is the mutant described in the first or second aspect above;

[0141] The reaction product is subjected to a second mixing reaction with at least one DNA polymerase to obtain an amplified nucleic acid molecule.

[0142] In an eleventh aspect, the present invention provides a method for constructing a sequencing library based on template switching, comprising the following steps:

[0143] 1) extracting RNA from a biological sample to be tested, and reverse transcribing the RNA to obtain cDNA using the method of the ninth aspect;

[0144] 2) constructing a sequencing library based on the cDNA.

[0145] In the above, the biological sample to be tested is animal tissue, plant tissue, bacteria or cells.

[0146] In the above, the biological sample to be tested is selected from at least one of soil, feces, blood, and serum.

[0147] In the above, the sequencing library is a high-throughput sequencing library.

[0148] The present invention relates to a reverse transcriptase with improved performance, including improved template switching performance, improved non-template base addition performance or improved heat resistance, which can be applied to RT-PCR technology, cDNA single-strand synthesis, RNA sequencing, 5'RACE technology, etc.

[0149] The MMLV reverse transcriptase mutant of the present invention has significantly improved template switching performance, non-templated base addition performance, or thermal stability compared to the wild type, and significantly increases cDNA yield in template switching-based library preparation. It is particularly suitable for RNA sequencing using template switching-based library preparation methods, such as Smart-Seq and spatial transcriptome sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0150] FIG1 is a flow chart of the template switching performance screening of MMLV reverse transcriptase and its mutants.

[0151] Figure 2 shows an example of capillary electrophoresis for screening the template switching performance of MMLV reverse transcriptase and its mutants.

[0152] FIG3 shows the results of the thermal stability test of MMLV reverse transcriptase.

[0153] FIG4 is a schematic diagram of one of the template switching-based library construction methods (Smart-Seq).

[0154] FIG5 is a correlation analysis of the effects of MMLV reverse transcriptase and its mutants in the template switching-based library construction method and various properties.

[0155] FIG6 is a schematic diagram of a method for verifying the template switching performance of MMLV reverse transcriptase and its mutants.

[0156] FIG7 is a verification of the template switching performance of the purified MMLV reverse transcriptase and its mutants.

[0157] FIG8 shows the visualization results of the STOmics test of commercial MMLV reverse transcriptase and purified MMLV reverse transcriptase mutants.

[0158] FIG9 shows the comparative data of the Median Gene Type and Median MID of the commercial MMLV reverse transcriptase and the modified and screened MMLV reverse transcriptase mutant Clone 79.

[0159] Best Mode for Carrying Out the Invention

[0160] The present invention analyzes the structure of MMLV reverse transcriptase to identify sites potentially associated with template switching performance, non-templated base addition, and thermal stability. Using genetic engineering techniques, plasmids containing sequences encoding MMLV reverse transcriptase mutants are constructed for these identified sites. These plasmids are then transformed into E. coli to express the MMLV reverse transcriptases, and the proteins are then purified by protein chromatography to obtain the mutant MMLV reverse transcriptases. Specifically, plasmids containing sequences encoding different MMLV reverse transcriptase mutants are constructed by site-directed mutagenesis PCR, as detailed in Example 1. These constructed plasmids containing sequences encoding different MMLV reverse transcriptase mutants are then transferred to E. coli for culture and induced expression. Finally, the MMLV reverse transcriptases are purified and extracted by protein chromatography to obtain MMLV reverse transcriptases containing the different mutations, as detailed in Example 2.

[0161] The embodiments of the present invention will be described in detail below with reference to the examples. However, it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention. The reagents or instruments used, if the manufacturer is not indicated, are conventional products available on the market. The experimental methods used are conventional methods unless otherwise specified.

[0162] V / V in the following examples represents a volume ratio.

[0163] In the following examples, SSII is a commercial enzyme SuperScript II (Invitrogen, 1806471).

[0164] Example 1. Construction of expression plasmids for MMLV reverse transcriptase and its mutants

[0165] 1. Wild-type MMLV reverse transcriptase and expression plasmid expressing the enzyme

[0166] The expression plasmid pET-22b-MMLV containing the gene encoding wild-type MMLV reverse transcriptase was purchased from GenScript Technology Co., Ltd., which is a plasmid obtained by cloning the gene encoding wild-type MMLV reverse transcriptase into the pET-22b vector.

[0167] pET-22b-MMLV expresses a fusion protein of wild-type MMLV reverse transcriptase with six His-terminal fusion residues. The His-tag is used for protein purification.

[0168] The gene sequence of the wild-type MMLV reverse transcriptase is SEQ ID NO.1, and the amino acid sequence encoded by the wild-type MMLV reverse transcriptase is SEQ ID NO.2.

[0169] 2. Preparation of plasmids expressing MMLV reverse transcriptase mutants

[0170] Plasmids expressing MMLV reverse transcriptase mutants were constructed by site-directed mutagenesis. Forward and reverse primer pairs were designed based on the mutation sites identified through rational design and screening. PCR was performed using pfu DNA polymerase. The PCR reaction consisted of 1x Pfu buffer (containing MgSO4), 0.2 mM dNTPs, 0.5 μM forward primer, 0.5 μM reverse primer, 0.05 U / μL Pfu DNA polymerase, and 1 ng / μL template plasmid pET-22b-MMLV. The PCR protocol included initial denaturation at 95°C for 3 min, followed by 18 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 68°C for 8 min. Finally, extension was performed at 68°C for 10 min. Following the reaction, DpnI was added to a final concentration of 0.4 U / μL and digested at 37°C for 1 h. 5 μL of the digested product was then transformed into competent E. coli DH5α cells. The next day, a single clone was picked from the plate for culture and the plasmid was extracted. The mutant was then analyzed by sequencing to see if it was correct.

[0171] The plasmid expressing the MMLV reverse transcriptase mutant is a plasmid obtained by replacing the gene encoding the wild-type MMLV reverse transcriptase in the pET-22b-MMLV vector with the gene encoding the MMLV reverse transcriptase mutant.

[0172] Each MMLV reverse transcriptase mutant is obtained by mutating the wild-type MMLV reverse transcriptase shown in SEQ ID NO. 2 according to the mutation site and mutation method shown in the second column of Table 1 below, while keeping other amino acid residues unchanged.

[0173] The encoding genes of the various MMLV reverse transcriptase mutants were obtained by mutating the codons corresponding to the mutation sites shown in column 2 of Table 1 below in the encoding gene of the wild-type MMLV reverse transcriptase shown in SEQ ID NO. 1 according to the corresponding mutation methods, while keeping other nucleotides unchanged.

[0174] The information of the mutants is shown in Table 1.

[0175] Table 1 MMLV reverse transcriptase mutant information

[0176]

[0177]

[0178]

[0179]

[0180] In the above table, WT is the wild-type MMLV reverse transcriptase shown in SEQ ID NO. 2; the second column is the wild-type MMLV reverse transcriptase shown in SEQ ID NO. 2 mutated according to the mutation sites and methods shown.

[0181] Example 2. Expression and purification of MMLV reverse transcriptase and its mutants

[0182] The wild-type MMLV reverse transcriptase and the mutants shown in Table 1 were all expressed via the pET-22b promoter and were fused with six His tags at the C-terminus. The His tags could be used for Ni column affinity purification during purification.

[0183] The expression and purification of wild-type MMLV reverse transcriptase and the mutants shown in Table 1 include two methods: small-scale expression and crude purification, and large-scale expression and fine purification. The former is used for screening MMLV reverse transcriptase mutants, and the latter is used for determining and analyzing other properties of MMLV reverse transcriptase.

[0184] 1. Small-scale expression and crude purity

[0185] The small-scale expression and crude purification methods of wild-type MMLV reverse transcriptase and its mutants are as follows: the pET-22b-MMLV plasmid expressing wild-type MMLV reverse transcriptase and the plasmid expressing each MMLV reverse transcriptase mutant were transformed into BL21 competent cells, and then a single colony was picked in 15 mL of LB medium containing Amp resistance (100 μg / mL) and cultured at 37°C with shaking at 200 rpm / min until the OD 600At a concentration between 0.6 and 0.8, IPTG was added to a final concentration of 0.5 mM. Protein expression was induced by incubation at 16°C at 200 rpm / min for 18 hours. The induced cells were harvested by centrifugation at 8000 rpm / min for 5 minutes. The harvested cells were resuspended in 500 μL of MMLV Reverse Transcriptase Ni Column A (50 mM Tris, 500 mM NaCl, 5% (v / v) glycerol, 10 mM imidazole, balance water, pH 7.5). Non-contact batch sonication was performed in an ice-water bath at 70% intensity for 30 minutes. The cells were then centrifuged at 13000 rpm at 4°C for 10 minutes, and the supernatant was collected. The supernatant was added to the wells of a equilibrated His MultiTrap HP purification plate (purchased from GE), allowed to stand for 15 minutes, and then the solution was removed using a vacuum pressure device; 2 mL of MMLV reverse transcriptase Ni column A solution was added for rinsing, and then the solution was removed using a vacuum pressure device; a 96-well plate was placed under the His MultiTrap HP purification plate and fixed, and then 100 μL of MMLV reverse transcriptase Ni column B solution (50 mM Tris, 500 mM NaCl, 5% (v / v) glycerol, 500 mM imidazole, the balance being water, pH 7.5) was added, and the eluted protein was collected by centrifugation at 500 g for 2 minutes; 100 μL of glycerol was added to the sample wells of the 96-well plate, mixed thoroughly, transferred to a 1.5 mL centrifuge tube, and stored at -20°C to obtain crude wild-type MMLV reverse transcriptase and its various mutants.

[0186] 2. Extensive expression and refinement

[0187] The methods for large-scale expression and purification of MMLV reverse transcriptase and its mutants are as follows:

[0188] BL21 competent cells were transformed with the pET-22b-MMLV plasmid expressing wild-type MMLV reverse transcriptase and plasmids expressing various MMLV reverse transcriptase mutants. Single colonies were then picked and inoculated into 15 mL of LB medium containing Amp resistance (100 μg / mL) and cultured overnight at 37°C at 200 rpm / min. The next day, the cells were transferred to fresh 1500 mL of LB medium containing Amp resistance (100 μg / mL) at a ratio of 1:100 and cultured at 37°C at 200 rpm / min until the OD reached 0. 600 Between 0.6 and 0.8, the inducer IPTG was added at a final concentration of 0.5 mM, and the cells were cultured at 16°C and 200 rpm / min for 18 h to induce protein expression. Finally, the induced bacteria were collected by centrifugation at 8000 rpm / min for 10 min.

[0189] Fine purification of MMLV reverse transcriptase and its mutants includes affinity chromatography, anion exchange chromatography, and cation exchange chromatography, specifically:

[0190] Weigh the induced cells collected above and resuspend them in 10 mL of MMLV Reverse Transcriptase Ni Column A buffer per 1 g of cells. Disrupt the cells by sonication in an ice-water bath. Ultrasonication conditions were: 10 mm horn diameter, 40% intensity, 2 seconds of sonication, 3 seconds of rest, and 30 minutes of sonication. Then, centrifuge at 13,000 rpm and 4°C for 30 minutes, and collect the supernatant.

[0191] The sample prepared in the previous step was affinity purified as follows:

[0192] Following the AKTA protocol, flush the working pump and system with filtered, degassed MillQ water. Connect a 5 mL prepacked HisTrap FF column at a flow rate of 0.5 mL / min. Rinse with HO for 5 CV, then equilibrate the column with 5 CV of MMLV Reverse Transcriptase Ni Column Solution A. Load the supernatant collected in the previous step onto the column at 5 mL / min. After loading, flush the column with 20 CV of MMLV Reverse Transcriptase Ni Column Solution A. Elute the column using a linear gradient of 0-100% (10 CV) using MMLV Reverse Transcriptase Ni Column Solution B, and collect the target protein (referred to as the affinity-purified sample).

[0193] The affinity-purified sample was diluted with MMLV reverse transcriptase salt-reducing diluent (50 mM Tris, 5% (v / v) glycerol, balance water, pH 7.5) at a ratio of 1:3.33, and then subjected to anion exchange chromatography. The specific steps are as follows:

[0194] According to the AKTA operating procedures, the working pump and system were flushed with filtered degassed MillQ water. A 5 mL prepacked HiTrap Q FF column was connected at a flow rate of 0.5 mL / min and flushed with H2O for 5 CV. The column was then equilibrated with 5 CV of MMLV reverse transcriptase ion A solution (50 mM Tris, 150 mM NaCl, 5% (v / v) glycerol, the balance being water, pH 7.5). The diluted sample was then loaded onto the column at 5 mL / min, and the flow-through was collected.

[0195] The flow-through of the anion exchange chromatography was diluted with MMLV reverse transcriptase salt reduction diluent at a ratio of 1:3, and then subjected to cation exchange chromatography. The specific steps are as follows:

[0196] Following the AKTA protocol, the working pump and system were rinsed with filtered, degassed MillQ water. A 5 mL prepacked HiTrap SP FF column was attached at a flow rate of 0.5 mL / min. The column was rinsed with HO for 5 CV and then equilibrated with 5 CV of MMLV Reverse Transcriptase Ion B Solution (50 mM Tris, 50 mM NaCl, 5% (v / v) glycerol, the balance being water, pH 7.5). The diluted sample was then loaded onto the column at 5 mL / min. After loading, the column was rinsed with 5 CV of MMLV Reverse Transcriptase Ion B Solution. The column was then eluted with MMLV Reverse Transcriptase Ion C Solution (50 mM Tris, 1 M NaCl, 5% (v / v) glycerol, the balance being water, pH 7.5) over a linear gradient of 0-100% (10 CV). The target protein was collected and purified.

[0197] Each purified target protein was dialyzed against MMLV reverse transcriptase storage solution (20 mM Tris, 100 mM NaCl, 1 mM DTT, 0.01% (V / V) NP-40, 0.1 mM EDTA, 50% Glycerol, the balance being water, pH 7.5), diluted to 1 mg / mL, and stored at -20°C to obtain pure wild-type MMLV reverse transcriptase and its mutants.

[0198] Example 3: Template switching performance assay to screen target MMLV reverse transcriptase mutants

[0199] Figure 1 shows the method for screening MMLV reverse transcriptase mutants for template switching performance. First, reverse transcriptase is used to reverse transcribe a 200-nt RNA synthesized in vitro using a primer modified with FAM at the 5' end. CCC is then added to the 3' end, generating a C-tailed cDNA. The CCC at the 3' end of the cDNA complements the rGrG+G residue on the template switching oligo (TSO). Under the template switching properties of the reverse transcriptase, the reaction switches from RNA to TSO as a template for further extension, generating a 230-bp template-switched product. Because the primer is FAM-modified at the 5' end, product size and yield can be determined by capillary electrophoresis. The template switching efficiency of the wild-type MMLV reverse transcriptase and its mutants can be calculated.

[0200] Specifically, 25 ng / μL wild-type MMLV reverse transcriptase or the mutants shown in Table 1 were reacted at 42°C for 1 hour in the following system, and then incubated at 85°C for 15 minutes for inactivation.

[0201] System: 1x First Strand Buffer (BGI), 1 mM dNTPs, 5 mM DTT, 2 U / μL RNase Inhibitor (BGI), 10 μM TSO primer, 25 ng / μL in vitro transcribed 200 nt Orf206b RNA, 0.5 μM FAM-Orf206b primer, 25 ng / μL wild-type MMLV reverse transcriptase or each mutant listed in Table 1, and the balance is water.

[0202] The primer information used is as follows:

[0203] TSO (SEQ ID No. 3): 5'AAGCAGTGGTATCAACGCAGAGTACATrGrG+G 3', rG represents riboguanosine; +G represents LNA-modified guanosine;

[0204] FAM-Orf206b (SEQ ID No. 4): 5'GTGCTTACTTCTTCTTTTGACCTACA 3'.

[0205] The 200nt Orf206b RNA sequence information is as follows:

[0206]

[0207] Figure 2 shows the capillary electrophoresis analysis of the reaction products. The lower figure is an enlarged view of the upper part of the figure. ① represents the full-length cDNA of reverse transcription; ② represents the product of the full-length cDNA of reverse transcription that undergoes template switching but is not fully polymerized; ③ represents the product of the full-length cDNA of reverse transcriptase that undergoes template switching and is fully polymerized.

[0208] The template switching efficiency of MMLV reverse transcriptase and its mutants was calculated using the following formula, thereby further obtaining the strength of the template switching performance of the MMLV reverse transcriptase mutants compared with the wild-type reverse transcriptase. The results are shown in Table 2.

[0209] Template conversion efficiency = (②+③) / (①+②+③)

[0210] The higher the template switching efficiency, the higher the template switching activity (performance) of the reverse transcriptase.

[0211] In the following Table 2, relative activity = template conversion efficiency of the mutant / template conversion efficiency of the wild-type MMLV reverse transcriptase.

[0212] Table 2 Template switching activity of MMLV reverse transcriptase mutants compared with wild-type reverse transcriptase

[0213]

[0214]

[0215] From Table 2, MMLV reverse transcriptase mutants with template switching performance improved 1-42 times that of the wild-type MMLV reverse transcriptase were screened as target MMLV reverse transcriptase mutants.

[0216] Example 4: Testing the non-templated base addition performance of MMLV reverse transcriptase and its mutants

[0217] The non-templated base addition performance of wild-type MMLV reverse transcriptase and the mutants listed in Table 1 was tested using RNA / DNA hybrids with a FAM-modified 5' end. The reverse transcriptase was capable of adding non-templated bases to the 3' end of the DNA strand. The FAM-modified 5' end of the primer allowed for the determination of product size and yield by capillary electrophoresis. The non-templated base addition efficiency of the MMLV reverse transcriptase and its mutants was then calculated.

[0218] Specifically, 25 ng / μL wild-type MMLV reverse transcriptase or its mutants shown in Table 1 were reacted at 42°C for 1 hour in the following system, and then inactivated at 85°C for 15 minutes:

[0219] System: 1x First Strand Buffer, 10 mM DTT, 1 mM dNTPs, 5 ng / μL RNA70F, 0.5 μM FAM-DNA70R, 2 U / μL RNase Inhibitor, 25 ng / μL wild-type MMLV reverse transcriptase or its mutants listed in Table 1, and the balance is water.

[0220] The primer information used is as follows:

[0221] RNA70F (SEQ ID No.6):

[0222] 5'AAUGAUACGGCGACCACCGAGAUCUACACUAGAUCGCUCGUCGGCAGCGUCAGAUGUGUAUAAGAGACAG 3'

[0223] FAM-DNA70R (SEQ ID No. 7):

[0224] 5'FAM-TGTCTCTTATACACATCTGACGCTGCCGACGAGCGATCTAGTGTAGATCTCGGTGGTCGCCGT ATCATT 3'

[0225] The reaction products were analyzed by capillary electrophoresis, and the non-templated base addition efficiency of the wild-type MMLV reverse transcriptase and its mutants was calculated based on the ratio of the sum of peak heights (or peak areas) greater than 70 bp to the sum of the peak areas of all bands (reflecting the non-templated base addition activity; the higher the ratio, the higher the activity). This allowed the comparison of the non-templated base addition performance of the MMLV reverse transcriptase mutants with that of the wild-type reverse transcriptase to be determined. The results are shown in Table 3.

[0226] In the following Table 3, relative activity = non-templated base addition efficiency of the mutant / non-templated base addition efficiency of the wild-type MMLV reverse transcriptase.

[0227] Table 3 Non-templated base addition activity of MMLV reverse transcriptase mutants compared to wild-type reverse transcriptase

[0228]

[0229]

[0230]

[0231] These results demonstrate that the non-templated base addition activity of the selected target MMLV reverse transcriptase mutants ranges from high to low, compared to the non-templated base addition activity of wild-type MMLV reverse transcriptase. Furthermore, some target MMLV reverse transcriptase mutants exhibited non-templated base addition activity that was 1-1.85 times higher than that of wild-type reverse transcriptase.

[0232] Example 5: Detection of polymerization activity of MMLV reverse transcriptase and its mutants

[0233] The activity of wild-type MMLV reverse transcriptase and its mutants was detected using Oligo(dT) 16 As primer, Poly(rA) 50 Using the RNA as a template, reverse transcriptase elongates the RNA to produce a hybrid strand of extended RNA and cDNA. Fluorescent molecules are incorporated into the reaction product, and the reverse transcriptase activity is calculated by measuring the RNA / cDNA ratio.

[0234] The specific reaction system is: 1x First Strand Buffer, 10mM DTT, 0.5mM dTTP, 1.5mM Oligo(dT) 16 ,25ng / μL Poly(rA) 50 , 2U / μL RNase Inhibitor, 0.1ng / μL wild-type MMLV reverse transcriptase or its mutants, and the balance is water.

[0235] The reaction system was incubated at 37°C for 10 min. After terminating the reaction by adding 25 mM EDTA, 2 μL of the reaction product was quantified using the Qubit dsDNA HS Assay Kit. The polymerization activity of the MMLV reverse transcriptase mutant relative to the wild-type MMLV reverse transcriptase was calculated. The results are shown in Table 4.

[0236] In Table 4, relative activity = dsDNA concentration of mutants / dsDNA concentration of wild-type MMLV reverse transcriptase, and the dsDNA concentrations shown in the table have subtracted the background (dsDNA concentration of the no-enzyme control group).

[0237] Table 4 Polymerization activity of MMLV reverse transcriptase mutants compared with wild-type reverse transcriptase

[0238]

[0239]

[0240]

[0241] As shown in Table 4, the polymerization activities of the screened target MMLV reverse transcriptase mutants are higher or lower than that of the wild-type MMLV reverse transcriptase.

[0242] Example 6: Thermal stability test of MMLV reverse transcriptase and its mutants

[0243] The thermal stability of wild-type MMLV reverse transcriptase and its various target mutants was determined using the Protein Thermal Shift TM The dye kit is used for detection. Its principle is to use dyes that bind to exposed hydrophobic residues to monitor the thermal stability of proteins through real-time PCR instruments. For specific usage, please refer to Protein Thermal Shift TM The dye kit instructions were followed.

[0244] The results of the thermal stability test of MMLV reverse transcriptase and its mutants are shown in Figure 3. As shown in Figure 3, the thermal stability of most MMLV mutants is improved compared with the wild type.

[0245] Example 7: Application of MMLV reverse transcriptase and its mutants in template switching-based library construction

[0246] MMLV reverse transcriptase mutants were evaluated and screened using template-switching library construction methods such as Smart-Seq (Figure 4), specifically using Oligo-dT 30The VN primer reverse transcribes the mRNA with a poly A tail to synthesize cDNA; due to the 5' end Cap structure of the mRNA and the terminal transferase performance of the MMLV reverse transcriptase, when it extends to the end of the mRNA, a non-template CCC base will be added to the 3' end of the cDNA chain; the CCC at the 3' end of the cDNA will complement the rGrG+G on the template switching primer (Template Switching Oligo, TSO). Under the template switching performance of the reverse transcriptase, the reaction is converted from the original mRNA as a template to TSO as a template for extension, completing the synthesis of the cDNA chain. 30 VN and TSO have some identical sequences, and ISPCR primers can be used to enrich cDNA by PCR and amplify cDNA to ng level. The first strand synthesis reaction of cDNA consists of 1x First Strand Buffer, 1mM dNTPs, 5mM DTT, 1M Betaine, 6mM MgCl2, 1μM TSO primer, 1μM Oligo-dT 30 The reaction was performed at 42°C for 1 hour with VN primers, 1 U / μL RNase Inhibitor, 1 ng / μL HEK293T RNA (from HEK293T cells), and 10 ng / μL wild-type MMLV reverse transcriptase or mutants to generate single-strand cDNA products. PCR enrichment was then performed by adding 5 μL of the single-strand cDNA product, 0.25 μL of 10 μM ISPCR primers, and 12.5 μL of KAPA HiFi HotStart Ready Mix to a 25 μL reaction mixture. The PCR program consisted of a 5-minute initial denaturation at 95°C, followed by 15 cycles of denaturation at 98°C for 20 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 3 minutes; finally, a 5-minute extension at 72°C. The enriched cDNA was quantified using the Qubit dsDNA HS Assay Kit. The effectiveness of the reverse transcriptase mutants in template-switching library construction was assessed by dsDNA quantity. The results are shown in Table 5.

[0247] In Table 5, relative activity = dsDNA concentration of mutants / dsDNA concentration of wild-type MMLV reverse transcriptase, and the dsDNA concentrations shown in the table have subtracted the background (dsDNA concentration of the no-enzyme control group).

[0248] The primer sequences used are:

[0249] TSO primer (SEQ ID No. 3): 5'AAGCAGTGGTATCAACGCAGAGTACATrGrG+G 3', rG is ribonucleotide G, +G is locked nucleotide G

[0250] Oligo-dT 30 VN primer (SEQ ID No.8):

[0251] 5'AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN 3',

[0252] Wherein V is a or g or c, and N is a or g or c or t;

[0253] ISPCR primer (SEQ ID No. 9): 5'AAGCAGTGGTATCAACGCAGAGT 3'

[0254] Table 5 dsDNA quantification results of Smart-Seq reactions using MMLV reverse transcriptase mutants

[0255]

[0256]

[0257]

[0258] Compared with wild-type MMLV reverse transcriptase, all mutants increased dsDNA yields by 1-150 times in Smart-Seq library construction.

[0259] A correlation analysis was performed between dsDNA yield during Smart-seq library construction and template switching (TS), non-templated base addition (NTA), polymerization activity (Pol), and thermostability (Tm) of the MMLV reverse transcriptase measured using the methods described in Examples 3-6. Data from 87 mutants were used in this analysis, including all mutants mentioned herein and mutants not mentioned herein that showed improved or unchanged Smart-Seq yield compared to the wild-type. The results are shown in Figure 5 , which shows a negative correlation between polymerization activity and thermostability, consistent with the commonly accepted observation that increased thermostability in enzyme engineering is generally accompanied by a loss of activity. This demonstrates the relative accuracy and reliability of these results.

[0260] Overall, Smart-Seq dsDNA yield is positively correlated with template switching (TS), non-templated base addition (NTA), and thermal stability (Tm), with template switching showing the highest correlation with Smart-Seq. While the polymerase activity of MMLV reverse transcriptase is essential for the reverse transcription process, it is not a key factor influencing the yield of template-switch-based library preparation methods.

[0261] Therefore, template switching performance was selected as the criterion for screening target MMLV reverse transcriptase mutants, with auxiliary reference to non-templated base addition performance and thermal stability.

[0262] Example 8: Verification of Template Switching Performance of Pure MMLV Reverse Transcriptase and Its Mutants

[0263] The template switching performance of purified MMLV reverse transcriptase and its mutants is demonstrated in Figure 6. Using a 5'-end Cy3-terminated sequence as a primer and a donor template as a template, a polymerization reaction is carried out under the action of reverse transcriptase, generating a primary product. The 5' sequence of the donor template overlaps with the 3' sequence of the acceptor template. Due to the template switching ability of the reverse transcriptase, the 5' sequence of the donor template can be switched to the acceptor template to continue the polymerization reaction, producing a secondary product longer than the primary product. The amount of the secondary product can be used to determine the template switching performance of the reverse transcriptase. Specifically, the reaction system consists of 1x First Strand Buffer, 0.5mM dNTPs, 0.5μM Cy3-labeled primer, 0.5μM donor template, 2.5μM acceptor template, and 10ng / μL MMLV reverse transcriptase or its mutant. After incubation at 42°C for 1 hour, the reaction is terminated by adding 25mM EDTA. 10μL of the reaction product is then subjected to urea polyacrylamide gel electrophoresis (Urea-PAGE) and photographed using a Cy3 fluorescence imaging device. The primer sequences used for the template switching performance test are:

[0264] Cy3-labeled primer (SEQ ID No.10):

[0265] 5'Cy3-ATGATAAATGTCGTTAGTTTC 3'

[0266] Donor template (SEQ ID No.11):

[0267] 5'CTGACGTCCTGCCACCGGAGAAAACTAACGACATTTATCAT 3'

[0268] Acceptor template (SEQ ID No.12):

[0269] 5'CATTAGCCAGAGCAAATATGCTGACGTCCTGCCACCGGA 3'

[0270] Figure 7 shows the template switching assay results for some of the purified MMLV reverse transcriptase mutants. WT represents the wild-type reverse transcriptase. As shown in Figure 7, secondary product (SP) bands were detected for several MMLV reverse transcriptase mutants, while no secondary product (SP) bands were observed for the wild-type MMLV reverse transcriptase. This indicates that the selected target MMLV reverse transcriptase mutants exhibit improved template switching performance compared to the wild-type.

[0271] Example 9: Application test of purified MMLV reverse transcriptase and its mutants in STOmics

[0272] STOmics testing was performed using commercial MMLV reverse transcriptase (Golden RT, purchased from BGI) and the modified and screened MMLV reverse transcriptase mutant Clone 79. The STOmics process includes tissue mounting, baking, formaldehyde fixation, ssDNA imaging, tissue permeabilization, in situ reverse transcription, PCR amplification, library preparation, on-machine sequencing, and analysis. The samples used in this test were mouse brain tissue sections from the Guangdong Medical Laboratory Animal Center. Following tissue mounting, baking, formaldehyde fixation, ssDNA imaging, tissue permeabilization, in situ reverse transcription, and PCR amplification using the Stero-seq Transcriptome Reagent Kit (Cat. No. 101ST114, BGI), the PCR products were then used to generate DNBs (DNA nanoballs). Finally, sequencing was performed using MGI's DNBSEQ-Tx sequencer, and the off-machine data was analyzed and visualized.

[0273] The visualization results for the commercial MMLV reverse transcriptase and the modified and screened MMLV reverse transcriptase mutant Clone 79 are shown in Figure 8. As shown in Figure 8, the modified and screened MMLV reverse transcriptase mutant Clone 79 achieved superior gene capture compared to the commercial MMLV reverse transcriptase. A comparison of the gene types (Median Gene Type) and the number of UMIs (Median MID) captured by the probes for the commercial MMLV reverse transcriptase and the modified and screened MMLV reverse transcriptase mutant Clone 79 is shown in Figure 9. The modified and screened MMLV reverse transcriptase mutant Clone 79 achieved 20% and 27% higher Median Genes and Median UMIs, respectively, compared to the commercial MMLV reverse transcriptase.

[0274] Industrial Applications

[0275] The present invention screened for multiple MMLV reverse transcriptase mutants with improved template switching performance using a template switching detection method ( FIG1 ). In template switching-based library construction, mutants were screened for significantly higher product yields than wild-type MMLV reverse transcriptase. Furthermore, further evaluation of the polymerization activity, non-templated base addition, and thermal stability of the selected MMLV reverse transcriptase mutants with improved template switching performance revealed that some MMLV reverse transcriptase mutants also exhibited improved thermal stability and non-templated base addition performance.

[0276] In summary, the present invention screened out MMLV reverse transcriptase mutants with improved template switching performance compared to the wild type, which also have improved non-templated base addition performance or thermal stability; the screened mutants are suitable for RNA sequencing using template switching-based library preparation methods such as Smart-Seq, nanopore sequencing, and 5'RACE, and can also be used in RT-qPCR, etc.

[0277] In summary, the present invention screened out reverse transcriptase mutants with improved template switching performance, which can be used in template switching-based library preparation and RNA sequencing.

Claims

1. A MMLV reverse transcriptase mutant, comprising: a mutant having amino acid residues mutated at one or more of the following positions: 62, 65, 70, 81, 105, 109, 124, 152, 175, 176, 186, 269, 284, 334, and 425, compared to the wild-type MMLV reverse transcriptase amino acid sequence shown in SEQ ID NO. 2; and the mutant having reverse transcriptase activity.

2. The mutant according to claim 1, characterized in that The mutation modes of the various sites are as follows: K at position 62 mutated to R; The P at position 65 is mutated to N, T, K, or L; The A at position 70 mutated to S; L at position 81 mutated to A; The G at position 105 mutated to R; The Y at position 109 mutated to R; The D at position 124 mutated to a K; The K at position 152 mutated to R; The P at position 175 mutated to S; E at position 176 mutated to R; The T at position 186 mutated to an A; L at position 269 mutated to R; The R at position 284 mutated to a T; F at position 334 mutated to N; The K at position 425 mutated to R.

3. The mutant according to claim 1 or 2, characterized in that The mutant is a mutant in which the amino acid residues at one or more of the following positions are mutated compared to the mutant according to claim 1 or 2: 39, 66, 67, 68, 69, 80, 99, 116, 200, 286, 289, 302, 306, 313, 333, 435, 450, 454, 524, 562, 583 and 653.

4. The mutant according to claim 3, characterized in that The mutation of each site is as follows: The M at position 39 mutated to D or R; The M at position 66 mutated to V, K, Y, or L; The S at position 67 mutated to a T; The Q at position 68 was mutated to N or K; E at position 69 mutated to K or R; The R at position 80 mutated to a T; The mutation of L at position 99 was to A; The R at position 116 mutated to a D; The D at position 200 mutated to N; E at position 286 mutated to R; The M at position 289 mutated to an L; E at position 302 mutated to K; T at position 306 mutated to R; The W at position 313 mutated to F; L at position 333 mutated to A or K; L at position 435 mutated to G; The R at position 450 mutated to H; The N at position 454 mutated to a K; The D at position 524 mutated to G or A; E at position 562 mutated to Q; The D at position 583 mutated to N; The D at position 653 was mutated to N.

5. The mutant according to any one of claims 1 to 4, characterized in that Compared with the wild-type MMLV reverse transcriptase, the MMLV reverse transcriptase mutant has improved template switching activity, improved non-templated base addition performance and / or improved thermal stability.

6. The mutant according to claim 5, characterized in that Compared with the wild-type MMLV reverse transcriptase, the template switching activity of the MMLV reverse transcriptase mutant is increased to 1-42 times that of the wild-type MMLV reverse transcriptase.

7. The mutant according to claim 5, characterized in that Compared with the wild-type MMLV reverse transcriptase, the non-templated base addition performance of the MMLV reverse transcriptase mutant is improved to 1-1.85 times that of the wild-type MMLV reverse transcriptase.

8. The mutant according to claim 6, characterized in that The MMLV reverse transcriptase mutant has any of the following mutations: M39D, K62R, P65T, P65K, M66V, E69R, A70S, L81A, L99A, G105R, D124K, K152R, P175S, E176R, L269R, T306R, W313F, L333A, L333K, F334N, L435G, N454K, D524G, D524A, or D583N; or, M66L and S67T, M66V and S67T, E302K and E286R, D524G and R450H, D524G and E562Q, or, E562Q and D583N; or, E286R, E302K and D524A; or, M39D, E69K, E302K, W313F, N454K, D524G and D653N; or, M39R, E69K, E302K, W313F, N454K, D524G and D653N; or, K62R, E69K, E302K, W313F, N454K, D524G and D653N; or, E69K, R80T, E302K, W313F, N454K, D524G and D653N; or, E69K, L99A, E302K, W313F, N454K, D524G and D653N; or, E69K, G105R, E302K, W313F, N454K, D524G and D653N; or, E69K, Y109R, E302K, W313F, N454K, D524G and D653N; or, E69K, D124K, E302K, W313F, N454K, D524G and D653N; or, E69K, K152R, E302K, W313F, N454K, D524G and D653N; or, E69K, D200N, E302K, W313F, N454K, D524G and D653N; or, E69K, E286K, E302K, W313F, N454K, D524G and D653N; or, E69K, E286R, E302K, W313F, N454K, D524G and D653N; or, P65K, E69K, E302K, W313F, N454K, D524G and D653N; or, P65N, E69K, E302K, W313F, N454K, D524G and D653N; or, P65T, E69K, E302K, W313F, N454K, D524G and D653N; or, M66L, S67T, E69K, E302K, W313F, N454K, D524G and D653N; or, M66V, E69K, E302K, W313F, N454K, D524G and D653N; or, E69K, A70S, E302K, W313F, N454K, D524G and D653N; or, E69K, E302K, T306K, W313F, N454K, D524G and D653N; or, E69K, E302K, T306R, W313F, N454K, D524G and D653N; or, M66Y, E69K, E302K, W313F, N454K, D524G, and D653N; or, E69K, P175S, E302K, W313F, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, N454K, D524G and D653N; or, E69K, E302K, W313F, L333K, N454K, D524G and D653N; or, E69K, E302K, W313F, L333A, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, L333K, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, L333A, N454K, D524G, and D653N; Or, E69K, E302K, W313F, N454K, D524G and D653N.

9. The mutant according to claim 6, characterized in that The MMLV reverse transcriptase mutant has any of the following mutations: P65K, E69R, G105R, D124K, E176R, T306R, L333A, N454K, or D524G; or, D524G and E562Q, or E562Q and D583N; or, E286R, E302K and D524A; or, M39D, E69K, E302K, W313F, N454K, D524G and D653N; or, M39R, E69K, E302K, W313F, N454K, D524G and D653N; or, K62R, E69K, E302K, W313F, N454K, D524G and D653N; or, E69K, R80T, E302K, W313F, N454K, D524G and D653N; or, E69K, L99A, E302K, W313F, N454K, D524G and D653N; or, E69K, G105R, E302K, W313F, N454K, D524G and D653N; or, E69K, Y109R, E302K, W313F, N454K, D524G and D653N; or, E69K, D124K, E302K, W313F, N454K, D524G and D653N; or, E69K, K152R, E302K, W313F, N454K, D524G and D653N; or, E69K, D200N, E302K, W313F, N454K, D524G and D653N; or, E69K, E286K, E302K, W313F, N454K, D524G and D653N; or, E69K, E286R, E302K, W313F, N454K, D524G and D653N; or, P65K, E69K, E302K, W313F, N454K, D524G and D653N; or, P65N, E69K, E302K, W313F, N454K, D524G and D653N; or, P65T, E69K, E302K, W313F, N454K, D524G and D653N; or, M66L, S67T, E69K, E302K, W313F, N454K, D524G and D653N; or, M66V, E69K, E302K, W313F, N454K, D524G and D653N; or, E69K, A70S, E302K, W313F, N454K, D524G and D653N; or, E69K, E302K, T306K, W313F, N454K, D524G and D653N; or, E69K, E302K, T306R, W313F, N454K, D524G and D653N; or, M66Y, E69K, E302K, W313F, N454K, D524G, and D653N; or, E69K, P175S, E302K, W313F, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, N454K, D524G and D653N; or, E69K, E302K, W313F, L333K, N454K, D524G and D653N; or, E69K, E302K, W313F, L333A, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, L333K, N454K, D524G and D653N; or, E69K, E176R, E302K, W313F, L333A, N454K, D524G, and D653N; Or, E69K, E302K, W313F, N454K, D524G and D653N.

10. A nucleic acid molecule encoding the mutant according to any one of claims 1 to 9.

11. An expression cassette, recombinant vector or transgenic cell line containing the nucleic acid molecule of claim 10. A recombinant bacterium comprising the nucleic acid molecule according to claim 10 .

13. Use of the nucleic acid molecule according to claim 10, the expression cassette, recombinant vector or transgenic cell line according to claim 11, or the recombinant bacterium according to claim 12 in the preparation of MMLV reverse transcriptase.

14. A method for producing the mutant according to any one of claims 1 to 9, comprising the steps of: culturing the recombinant bacterium according to claim 12, and then performing an induction treatment to obtain the mutant according to any one of claims 1 to 9.

15. A kit comprising the mutant according to any one of claims 1 to 9.

16. The kit according to claim 15, characterized in that The kit further comprises at least one of the following: one or more nucleotides, one or more DNA polymerases, one or more primers, and one or more terminators.

17. A method for reverse transcribing a nucleic acid molecule, comprising the steps of: At least one nucleic acid template is mixed with at least one reverse transcriptase to obtain a mixture, wherein The reverse transcriptase is a mutant according to any one of claims 1 to 9; The mixture is subjected to a reverse transcription reaction to obtain a reverse transcribed nucleic acid molecule that is fully or partially complementary to at least one template.

18. A nucleic acid amplification method comprising the following steps: At least one nucleic acid template is mixed with at least one reverse transcriptase to perform a first mixing reaction to obtain a reaction product, wherein: The reverse transcriptase is a mutant according to any one of claims 1 to 9; The reaction product is subjected to a second mixing reaction with at least one DNA polymerase to obtain an amplified nucleic acid molecule.

19. A method for constructing a sequencing library based on template switching, comprising the following steps: 1) extracting RNA from a biological sample to be tested, and reverse transcribing it to obtain cDNA using the method of claim 17; 2) constructing a sequencing library based on the cDNA.

20. The method according to claim 19, wherein The biological sample to be tested is animal tissue, plant tissue, bacteria or cells.

21. The method according to claim 19, wherein The biological sample to be tested is selected from at least one of soil, feces, blood, and serum.

22. The method according to claim 19, wherein The sequencing library is a high-throughput sequencing library.

Images