Application of circular RNA Hsa_circ_0006332 in diagnosis and treatment of esophageal squamous cell carcinoma
By utilizing the circular RNA Hsa_circ_0006332 as a molecular target for esophageal squamous cell carcinoma, kits and drugs for diagnosis and treatment have been developed, solving the problem of limited treatment options for esophageal squamous cell carcinoma, achieving effective inhibition and diagnosis of the cancer, and improving patient survival rates.
Patent Information
- Application Number
- CN202510081003.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-20
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-01-20
AI Technical Summary
Drug therapy for esophageal squamous cell carcinoma is limited and has poor efficacy, lacking effective molecular targets and diagnostic indicators.
Using the circular RNA Hsa_circ_0006332 as a molecular target for esophageal squamous cell carcinoma, kits and drugs for diagnosis and treatment, including specific primers and siRNA, were developed by detecting its expression level and inhibiting its expression.
It significantly inhibits the proliferation, invasion, and migration of esophageal squamous cell carcinoma, improves patient survival, provides new treatment options, reduces treatment costs, and has the potential to serve as a diagnostic indicator.
Smart Images

Figure CN119859688B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of circular RNA Hsa_circ_0006332 in the diagnosis and treatment of esophageal squamous cell carcinoma. Background Technology
[0002] Esophageal cancer is one of the most common malignant tumors of the digestive tract, occurring in the esophageal mucosal epithelium and causing high incidence and mortality. According to global cancer statistics in 2020, esophageal cancer is one of the top ten most common cancers worldwide, ranking 8th in incidence and 6th in mortality among malignant tumors. While advancements in esophageal cancer diagnosis and treatment have led to new progress and breakthroughs, such as from open-chest surgery to minimally invasive techniques and immunotherapy combined with radiotherapy and chemotherapy, the reliability and veracity of these therapeutic benefits still require further investigation. The 5-year survival rate remains below 15%. Therefore, it is necessary to delve deeper into the biological mechanisms and influencing factors of esophageal cancer development, invasion, metastasis, and apoptosis. Based on this, it is crucial to identify substances that can regulate these processes and design targeted anti-esophageal cancer drugs, providing more options for targeted therapy and ultimately improving the survival time and outcomes of esophageal cancer patients.
[0003] Circular RNA (circRNA) is a class of non-coding RNAs with a unique continuous covalently closed circular structure, lacking both a 5' cap and a 3' polyA tail. Due to its structural uniqueness, it is not easily degraded by RNA exonucleases and RNases. This allows circRNAs to concentrate in the cytoplasm and exert their biological functions, making them more stable and significant as disease biomarkers than linear RNAs. With the development of high-throughput RNA sequencing technology and epigenetics, the structure, function, and tissue specificity of circRNAs have been gradually discovered. Increasing experimental evidence shows a close link between circRNAs and tumor progression, and their application in early tumor diagnosis, prognostic prediction of different tumor subtypes, and specific targeted therapy has attracted widespread attention from researchers. For example, using artificially modified or engineered circular RNAs with coding and tumor-specific functions as anticancer drugs can achieve sufficient therapeutic effects with small doses in the human body, filling the gap in targeted therapy for patients requiring high-protein level treatment and non-specific mRNA therapy. However, current research on the role and impact of circRNA in the development and progression of esophageal squamous cell carcinoma is not yet thorough enough. This is of great significance for further understanding the mechanisms of esophageal squamous cell carcinoma development and progression, exploring new molecular targets for the treatment of esophageal squamous cell carcinoma, promoting "circular RNA therapy" to enter the IND (Investigational New Drug) stage, and bringing new treatment options to cancer patients worldwide. Summary of the Invention
[0004] The purpose of this invention is to propose the application of circular RNA Hsa_circ_0006332 in the diagnosis and treatment of esophageal squamous cell carcinoma, mainly to solve the problems of single drug treatment and poor treatment effect in esophageal squamous cell carcinoma.
[0005] This invention, through differential expression analysis of circRNA in cancerous tissue and adjacent normal tissue samples from esophageal squamous cell carcinoma patients, determined that Hsa_circ_0063865 has the potential to serve as a molecular target for the treatment of esophageal squamous cell carcinoma. The expression of this molecular target in esophageal squamous cell carcinoma cancer tissue samples was significantly higher than that in adjacent normal tissue samples, and the difference was statistically significant. Therefore, it can serve as a molecular marker for the early diagnosis and treatment of esophageal squamous cell carcinoma.
[0006] Therefore, the uses of Hsa_circ_0006332 as a target include, but are not limited to, the preparation, screening, and treatment of drugs for esophageal squamous cell carcinoma.
[0007] A first aspect of the present invention relates to the use of a reagent capable of detecting Hsa_circ_0006332 or its expression level in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, wherein the nucleotide sequence of Hsa_circ_0006332 is SEQ ID NO.1.
[0008] Optionally, the reagent includes specific primers capable of recognizing the circular RNA Hsa_circ_0006332.
[0009] Optionally, the specific primers include circ-0006332-F and circ-0006332-R, with nucleotide sequences SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0010] A second aspect of the present invention relates to a kit for diagnosing esophageal squamous cell carcinoma, comprising reagents capable of detecting Hsa_circ_0006332 or its expression level, wherein the sequence of Hsa_circ_0006332 is SEQ ID NO.1.
[0011] A third aspect of the present invention relates to the use of a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 or a component capable of binding to and inactivating the expression product of Hsa_circ_0006332 in the preparation of a medicament for treating esophageal squamous cell carcinoma, wherein the sequence of Hsa_circ_0006332 is SEQ ID NO.1.
[0012] Optionally, the components capable of inhibiting or blocking Hsa_circ_0006332 expression include siRNAs that interfere with Hsa_circ_0006332 expression.
[0013] Optionally, the siRNA includes si-Hsa_circ_0006332-F and si-Hsa_circ_0006332-R, with nucleotide sequences SEQ ID NO.4 and SEQ ID NO.5, respectively.
[0014] A third aspect of the present invention relates to a medicament for treating esophageal squamous cell carcinoma, comprising a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 or a component capable of binding to and inactivating the Hsa_circ_0006332 expression product.
[0015] Optionally, it may also include pharmaceutically acceptable excipients or carriers.
[0016] A fourth aspect of the present invention relates to the use of a reagent capable of detecting Hsa_circ_0006332 or its expression level in screening potential drug components for the treatment of esophageal squamous cell carcinoma, wherein the sequence of Hsa_circ_0006332 is SEQ ID NO.1.
[0017] Regarding its application in screening potential drug components for the treatment of esophageal squamous cell carcinoma, specifically, it includes the application of Hsa_circ_0006332 as the central target in the development of early diagnosis of esophageal squamous cell carcinoma. The early diagnosis method includes minimally invasive liquid biopsy to identify Hsa circ 0006332 expression.
[0018] The drug that inhibits or blocks the expression of Hsa_circ_0006332 can be a gene therapy drug or a chemical drug.
[0019] Beneficial effects
[0020] This application reveals the differential expression of Hsa_circ_0006332 in esophageal squamous cell carcinoma and cancerous tissues. The function of Hsa_circ_0006332 in esophageal squamous cell carcinoma cells was verified by preparing Hsa_circ_0006332-specific siRNA. This application significantly inhibits the proliferation, invasion, and migration of esophageal squamous cell carcinoma and promotes apoptosis by knocking down Hsa_circ_0006332, making it a crucial molecular target for the treatment of esophageal squamous cell carcinoma. This provides a novel and effective treatment method for cancer patients, reducing treatment costs and improving survival rates, demonstrating promising drug development potential. Furthermore, the expression level of Hsa_circ_0006332 in cancerous tissues of esophageal squamous cell carcinoma patients is significantly higher than that in adjacent normal tissues, with a statistically significant difference. Therefore, the expression level of Hsa_circ_0006332 may also have the potential to serve as a diagnostic indicator for esophageal squamous cell carcinoma. Attached Figure Description
[0021] Figure 1 A schematic diagram of the bioformation and structure of Hsa_circ_0006332;
[0022] Figure 2 The differential expression levels of Hsa_circ_0006332 in esophageal squamous cell carcinoma tissue and adjacent normal tissue;
[0023] Figure 3 The effect of siRNA knockdown on Hsa_circ_0006332;
[0024] Figure 4 Figure showing the intracellular and extracellular stability of Hsa_circ_0006332 cells;
[0025] Figure 5Figure 1 shows the experimental results of CCK8 and EDU in regulating cell proliferation by Hsa_circ_0006332 siRNA.
[0026] Figure 6 The figure shows the results of Hsa_circ_0006332 siRNA regulating cell invasion and migration. Detailed Implementation
[0027] The present invention will be described in detail below with reference to specific operational embodiments. It should be understood that the embodiments are only for explaining the present invention and not for limiting the present invention. However, any transformations or substitutions described in the present invention are within the protection scope of the present invention.
[0028] The sequences involved in the embodiments of this application include;
[0029] 1. Hsa_circ_0006332|chr22:42331129_42333998_+
[0030] SEQ ID NO.1:
[0031]
[0032] 2. SEQ ID NO.2 and SEQ ID NO.3
[0033] Hsa_circ_0006332 specific primers
[0034] The nucleotide sequence of circ-0006332-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.2), and the nucleotide sequence of circ-0006332-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO.3).
[0035] 3. The nucleotide sequence of si-Hsa_circ_0006332-F is CGACCCUGAUGCUUGGUGUG
[0036] The nucleotide sequence of si-Hsa_circ_0006332-R is ACACCAAGCAUCAGGGUCGCA
[0037] 4. The nucleotide sequence of MYBL2-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.6)
[0038] The nucleotide sequence of MYBL2-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO.7).
[0039] Example 1: RT-qPCR technology was used to demonstrate that the expression level of Hsa_circ_0006332 in esophageal squamous cell carcinoma tissue was significantly higher than that in adjacent normal tissue;
[0040] 1. RNA extraction from esophageal squamous cell carcinoma tissue samples
[0041] 1) With the approval of the Medical Ethics Committee of Southeast University and the informed consent of the patients / family, 13 patients diagnosed with esophageal squamous cell carcinoma at the First People's Hospital of Huai'an City, Jiangsu Province were selected, and a total of 13 cancer tissues and corresponding adjacent tissues were collected.
[0042] 2) Select 0.1cm 3 After the tissue was cut into small pieces with scissors, it was placed in a 1.5mL EP tube, and 1mL Trizol and 3 grinding steel balls were added. The mixture was ground at 70Hz for 10min (the grinding box was pre-cooled). Subsequent operations were carried out according to the standard Trizol reagent extraction procedure.
[0043] 3) Take 1 μL of RNA sample and test its concentration and purity using a UV spectrophotometer. The A260 / A280 ratio of the obtained RNA samples is between 1.8 and 2.0.
[0044] 2. RNA is reverse transcribed into cDNA
[0045] Reverse transcription was performed using MMLV reverse transcriptase. The reverse transcription reaction system and conditions are as follows:
[0046] RNA 1μg Random primer 1μL Enzyme-free water Add to 15μL
[0047] React at 70℃ for 10 minutes, then in an ice bath for 2 minutes.
[0048]
[0049]
[0050] React at 37℃ for 60 min, at 90℃ for 10 min, and then maintain at 4℃.
[0051] 3. cDNA real-time PCR:
[0052] Based on the structure and connector sequence of Hsa_circ_0006332 (see results) Figure 1 The specific primers for circ-0006332-F were designed as follows: the nucleotide sequence of circ-0006332-F is CTTGAGCGAGTCCAAAGACTG (SEQ ID NO.2); the nucleotide sequence of circ-0006332-R is AGTTGGTCAGAAGACTTCCCT (SEQ ID NO.3).
[0053] Reaction system:
[0054] cDNA 1μL SYBR Green Mix 5μL Plus Solution 1μL Upstream and downstream primers 0.6 μL each Enzyme-free water Add to 10 μL
[0055] Reaction conditions: Preheat at 94℃ for 5 min, 94℃ for 30 s, 60℃ for 30 s, for 40 cycles. Collect fluorescence at 60℃ in each cycle, and collect fluorescence while increasing the temperature from 60℃ to 95℃. Calculate the melting curve.
[0056] 4. Data Processing and Analysis
[0057] The expression level of Hsa_circ_0006332 in the test sample was calculated by combining its Ct value with the Ct value of the internal reference β-actin to obtain ΔCt. The larger the ΔCt value, the lower the actual expression level. Statistical analysis was performed using the t-test, with P < 0.05 considered statistically significant.
[0058] 5. Experimental Results and Analysis
[0059] In this cohort of esophageal squamous cell carcinoma patients, the expression level of Hsa_circ_0006332 in cancerous tissue was significantly higher than that in adjacent tissue, and the difference was statistically significant (see results). Figure 2The results suggest that Hsa_circ_0006332, as an oncogene, may be an important molecular target for the treatment or diagnosis of esophageal squamous cell carcinoma.
[0060] Example 2: Construction of Hsa_circ_0063865-specific siRNA to verify its effect on biological phenotype.
[0061] 1) Construction of a cell model with low expression of Hsa_circ_0006332: Based on the structure and adaptor sequence of Hsa_circ_0006332 (see results) Figure 1 The specific siRNAs were designed as follows: si-Hsa_circ_0006332-F with the nucleotide sequence CGACCCUGAUGCUUGGUGUG (SEQ ID NO.4) and si-Hsa_circ_0006332-R with the nucleotide sequence ACACCAAGCAUCAGGGUCGCA (SEQ ID NO.5). (The last part, "20 × 10," appears to be an unrelated fragment and is omitted from the translation.) 4 109 cells were seeded into 6-well plates and cultured at 37°C in a 5% CO2 incubator for 24 h. Si-6332, Si-NC, and the transfection reagent were diluted 1:20 with 1640 medium and gently mixed before reacting for 5 min. Si-6332 and Si-NC were then gently mixed 1:1 with the transfection reagent and reacted for 15 min. The transfection complex was added to an appropriate amount of antibiotic-free 1640 complete medium and gently mixed. 500 μL of 1640 containing the transfection complex was added to each well of the 6-well plate, and the cells were cultured at 37°C in a 5% CO2 incubator for 6 h. The medium was then replaced with 1640 complete medium containing 10% FBS and cultured for another 18 h. qRT-PCR was used to detect hsa_circ_0006332 expression to evaluate the interference effect of siRNA. Figure 3 As shown.
[0062] 2) Linear RNA ablation / RNase R experiment: RNA was extracted from the above Si-6332 and Si-NC cells, and the following reaction system was prepared in a sterile microcentrifuge tube:
[0063]
[0064] Linear RNA was digested at 37°C for 30 min, followed by inactivation at 70°C for 10 min. Subsequently, the structure and adapter sequence of the parent gene MYBL2 of Hsa_circ_0006332 were determined (see results). Figure 1Specific primers were designed: the nucleotide sequence of MYBL2-F is CTTGAGCGAGTCCAAAGACTG (SE Q ID NO. 6); the nucleotide sequence of MYBL2-R is AGTTGGTCAGAAGACTTCCCT (SE Q ID NO. 7). qRT-PCR was performed using primers MYBL2, GAPDH, and Hsa_circ_0006332 to detect RNA expression levels and identify circRNAs.
[0065] 3) Actinomycin D detection: using 20×10 4 10⁹ cells were seeded into 6-well plates and treated with actinomycin D. Three experimental groups were established at 0h, 6h, and 12h. Cells were collected and total RNA was extracted at each time point. RNA expression levels were detected using qRT-PCR to evaluate the stability of hsa_circ_0006332. Results are shown below. Figure 4 As shown.
[0066] 4) CCK8 assay for cell proliferation capacity: using 1×10⁻⁶ cells / mL. 4 Cells were seeded into 96-well plates and cultured at 37°C in a 5% CO2 incubator for 24 h. 10 μL of different concentrations of drug were added to each well for stimulation, and incubation was continued for 30 min. 10 μL of CCK-8 solution was added to each well, and incubation was continued at 37°C in a 5% CO2 incubator for 2 h. The absorbance at 450 nm was measured using a microplate reader. The OD value of each test well was subtracted from the background OD value (blank group), and the OD values of each replicate well were taken as the mean ± SD to reflect the number of viable cells in each well.
[0067] 5) Cell proliferation capacity EDU assay: using 1×10 4 Cells were seeded into 96-well plates and incubated with EdU for 2 hours when the cells reached 50% confluence. Subsequent steps were performed according to BeyoClick Biotechnology Co., Ltd. TM Follow the instructions for the EdU cell proliferation assay kit; finally, wash twice with PBS, 5 min each time; discard the washing PBS, add 50 μL of fresh PBS to each well, observe and photograph under a microscope; randomly select 5 fields of view from each well to photograph, and count the number of red cells (proliferating cells) and blue cells (total cells).
[0068] 6) Cell migration ability assay: Cell migration ability was assayed using 8 μm pore size Transwell chambers. Cells in the exponential growth phase were harvested, and single-cell suspensions were prepared by trypsin digestion. Each chamber was seeded with 5 × 10⁶ cells. 4Cells were cultured in a microplate chamber. Serum-free medium was added to the upper chamber to a final volume of 200 μL, and complete medium containing 20% FBS was added to the lower chamber. After 24 hours of standard culture, the chambers were removed. Any remaining liquid was aspirated using a pipette tip, and any cells that had not penetrated the membrane were gently wiped away with a cotton swab. The chambers were then soaked in methanol for 10 minutes. After the membranes had air-dried, they were stained with 0.1% crystal violet for 15 minutes at room temperature. The cells were then rinsed with PBS, air-dried, and returned to a 24-well plate. Microscopic observation was performed, with five randomly selected fields of view from each chamber photographed to count the number of cells that had penetrated the membrane.
[0069] 7) Cell invasion assay: Logarithmic growth phase cells were plated until 70% confluence was achieved. Matrigel (-20℃) was dissolved in a 4℃ freezer, and Transwell chambers were pre-cooled at 4℃. The Matrigel was diluted with serum-free medium at a ratio of 1:8, and 50 μL was quickly added to each chamber. The chambers were then incubated at 37℃ for 1 hour to solidify the Matrigel. The chambers were removed, and the unsolidified supernatant was aspirated. Cells were digested and collected, and a single-cell suspension was prepared using serum-free medium at a ratio of 5 × 10⁶ cells / mL. 5 / well, add cells into the chamber, add 600μL of complete culture medium containing 50% FBS to the lower chamber; after culturing for 24h, remove the chamber, wipe away unpenetrated cells and matrix gel with a cotton swab, fix with methanol, air dry, and stain with 0.1% crystal violet; observe under a microscope, take pictures of 5 fields of view of each chamber, and count the number of cells that have penetrated the membrane.
[0070] 8) Results showed that low expression of Hsa_circ_0006332 in EC109 cells inhibited cell proliferation. Figure 5 ), migration ability and cell invasion ( Figure 6 Furthermore, Hsa_circ_0006332 inhibitors can significantly inhibit tumor progression, and they can serve as new molecular targets for drug development and esophageal cancer treatment.
[0071] It should be noted that the above embodiments of this application verified the association between Hsa_circ_0006332 and esophageal squamous cell carcinoma. The diagnosis described in the above embodiments can be used to determine the possibility or risk of having esophageal squamous cell carcinoma by measuring the expression level of Hsa_circ_0006332 in tissue samples; it can also be used to determine the prognostic level of a patient with esophageal squamous cell carcinoma by measuring the expression level of Hsa_circ_0006332 in tissues; or it can be used to screen potential drugs for the treatment of esophageal squamous cell carcinoma.
[0072] The above embodiments demonstrate that inhibiting the expression of Hsa_circ_0006332 has an inhibitory effect on both the proliferation and migration abilities of esophageal squamous cell carcinoma. However, those skilled in the art should understand that in the actual drug preparation process, in addition to the component that interferes with the expression of Hsa_circ_0006332 provided in this embodiment, other pharmaceutically acceptable excipients may also be included. Furthermore, the component in the drug that interferes with the expression of Hsa_circ_0006332 is not limited to the siRNA proposed in this embodiment, and may be replaced with other techniques capable of knocking down or eliminating Hsa_circ_0006332, which should also achieve the same objective as in this embodiment.
[0073] However, it should be noted that this application does not imply that Hsa_circ_0006332 is used only as a standalone diagnostic indicator. In some embodiments, it can also be combined with known symptoms and other diagnostic markers in the prior art to diagnose esophageal squamous cell carcinoma, thereby improving the accuracy and specificity of the diagnosis.
[0074] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0075] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.
Claims
1. Use of a reagent capable of detecting Hsa_circ_0006332 or the expression amount thereof in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, wherein the nucleotide sequence of the Hsa_circ_0006332 is SEQ ID NO.
1. 2.The use of the reagent capable of detecting Hsa_circ_0006332 or the expression amount thereof according to claim 1 in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, characterized in that, The reagent comprises specific primers capable of recognizing the circular RNA Hsa_circ_0006332. 3.The use of the reagent capable of detecting Hsa_circ_0006332 or the expression amount thereof according to claim 2 in the preparation of a kit for diagnosing esophageal squamous cell carcinoma, characterized in that, The specific primers comprise circ-0006332-F and circ-0006332-R, and the nucleotide sequences are SEQ ID NO. 2 and SEQ ID NO. 3, respectively.
4. Use of a component capable of inhibiting or blocking the expression of Hsa_circ_0006332 in the preparation of a drug for treating esophageal squamous cell carcinoma, wherein the sequence of the Hsa_circ_0006332 is SEQ ID NO. 1; the component capable of inhibiting or blocking the expression of Hsa_circ_0006332 is an siRNA interfering with the expression of Hsa_circ_0006332; and the siRNA is si-Hsa_circ_0006332-F and si-Hsa_circ_0006332-R, and the nucleotide sequences are SEQ ID NO. 4 and SEQ ID NO. 5, respectively.
Citation Information
Patent Citations
Application of bladder cancer associated circular RNA (ribonucleic acid), siRNA (small interfering RNA) and application thereof
CN109136376A