A recombinant yeast and its application in fermentative production of beta-elemene
By constructing recombinant yeast strains, expressing specific enzyme systems, and optimizing genome integration, the problem of low β-elemene production efficiency in traditional methods has been solved, and efficient β-elemene fermentation production has been achieved.
Patent Information
- Application Number
- CN202510361035.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2045-03-26
AI Technical Summary
Existing technologies are insufficient for the efficient production of β-elemene. Traditional extraction and separation methods have low yields and high costs, while chemical synthesis methods are environmentally unfriendly and have low yields.
Recombinant yeast strains were constructed, and genome integration and expression regulation were optimized by expressing farnesyl diphosphate synthase ERG20, lettuce-derived sesquiterpene synthase LsLTC2, and rose-derived bifunctional farnesyl diphosphate synthase RrFPS in yeast, and expressing IDI1, ERG13, ERG8, ERG10, ERG12, MVD1, and tHMGR in peroxisomes.
It significantly improved the fermentation yield of β-elemene, provided an efficient method for β-elemene production, and laid the foundation for industrial production.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microbial technology, in particular, to a recombinant yeast and its application in the fermentation production of β-elemene. BACKGROUND
[0002] β-elemene is one of the effective components of traditional Chinese medicine Wenyujin, which has anti-inflammatory, antibacterial, antitumor and other pharmacological activities. At present, β-elemene injection is widely used in the clinical treatment of lung cancer, liver cancer, esophageal cancer, nasopharyngeal carcinoma and other malignant tumors, which has the characteristics of small toxic and side effects, less impact on normal cells and peripheral white blood cells, and helps the chemotherapy and radiotherapy drugs to enter the cancer tissue to play a role.
[0003] With the increasing market demand for β-elemene, it is impossible to obtain β-elemene from natural plants Wenyujin by using traditional extraction and separation methods to meet market demand, and the products obtained by extraction and separation have problems such as low yield and low purity, and the cost of secondary separation is high. The synthesis of β-elemene by chemical synthesis method needs to use toxic chemical reagents such as dichloromethane, sodium cyanide and toluene, which is not conducive to environmental protection; and the reaction conditions of chemical synthesis are difficult to achieve, and the yield of the product is also very low.
[0004] With the development of biotechnology, synthetic biology has attracted more and more attention. By recombining the biosynthesis pathway of natural compounds in microbial chassis cells, natural products and intermediates can be quickly and massively obtained, which provides a new method for the development and application of plant natural active products. Microorganisms have the advantages of fast growth, short fermentation period and low fermentation cost, and their genetic background is clearer than that of plants, which is beneficial to genetic modification. Therefore, it is necessary to study how to construct a recombinant strain for efficient fermentation production of β-elemene. SUMMARY
[0005] One of the purposes of the present application is to provide a new recombinant yeast and its application in the fermentation production of β-elemene.
[0006] The present application provides a recombinant yeast, which expresses farnesyl diphosphate synthase ERG20, lettuce-derived sesquiterpene synthase LsLTC2 and rose-derived bifunctional farnesyl diphosphate synthase RrFPS compared with the starting yeast strain, and expresses IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in the peroxisome.
[0007] The present application particularly studies and finds that by expressing farnesyl diphosphate synthase ERG20, specific exogenous sesquiterpene synthase LsLTC2 and bifunctional farnesyl diphosphate synthase RrFPS in yeast and expressing enzymes encoded by key genes of the endogenous MVA pathway in peroxisomes, the fermentation yield of β-elemene can be significantly improved.
[0008] Preferably, the expression of target proteins is improved by integrating multiple copies of target genes on the yeast genome. For example, 8 copies of ERG20 and LsLTC2 genes (2 copies are integrated into the rDNA site of the yeast chromosome, and 6 copies are integrated into the delta site) and 6 copies of RrFPS genes are integrated on the yeast genome.
[0009] Preferably, the recombinant yeast strain of the present application further comprises one or more of the following changes in the cell matrix compared with the starting yeast strain:
[0010] (1) the expression amount of squalene synthase ERG9 is down-regulated;
[0011] (2) ERG10 and ERG13 are overexpressed;
[0012] (3) XFPK and PTA are expressed;
[0013] (4) IDI1 is overexpressed;
[0014] (5) POXB and ACS are expressed.
[0015] Further down-regulating the expression amount of ERG9, or overexpressing ERG10 and ERG13, or expressing XFPK and PTA, or overexpressing IDI1, or expressing POXB and ACS in the cell matrix can further improve the fermentation yield of β-elemene.
[0016] More preferably, 3 copies of ERG20 and LsLTC2 genes, 1 copy of ERG10, ERG13, XFPK, PTA, POXB and ACS genes and 2 copies of IDI1 genes are further integrated on the yeast genome, so as to obtain a better fermentation yield of β-elemene.
[0017] In the recombinant yeast strain of the present application, the GenBank accession number of the farnesyl diphosphate synthase ERG20 is NP_012368.1; the GenBank accession number of the coding gene of the lettuce-derived sesquiterpene synthase LsLTC2 is AF489964.1; the GenBank accession number of the coding gene of the bifunctional farnesyl diphosphate synthase RrFPS derived from rose is KP768082.1;
[0018] The GenBank accession number of IDI1 is NP_015208.1; the GenBank accession number of ERG13 is NP_013580.1; the GenBank accession number of ERG8 is NP_013947.1; the GenBank accession number of ERG10 is NP_015297.1; the GenBank accession number of ERG12 is NP_013935.1; the GenBank accession number of MVD1 is NP_014441.1; the GenBank accession number of tHMGR is JX648390.1;
[0019] The GenBank accession number of squalene synthase ERG9 is NP_012060.1; the GenBank accession number of XFPK is CBL90649.1; the GenBank accession number of PTA is QBJ74152.1; the GenBank accession number of POXB is NP_418139.1; the GenBank accession number of the coding gene of ACS is AT5G36880.
[0020] The present application also provides a method for constructing a recombinant yeast for producing β-elemene, comprising making the starting yeast strain express farnesyl diphosphate synthase ERG20, lettuce-derived sesquiterpene synthase LsLTC2 and rose-derived bifunctional farnesyl diphosphate synthase RrFPS, and express IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR in peroxisomes.
[0021] The method of the present application further comprises the step of making the starting yeast strain contain one or more of the following changes in the cell matrix:
[0022] (1) down-regulating the expression amount of squalene synthase ERG9;
[0023] (2) over-expressing ERG10 and ERG13;
[0024] (3) expressing XFPK and PTA;
[0025] (4) over-expressing IDI1;
[0026] (5) expressing POXB and ACS.
[0027] The method of the present application specifically comprises:
[0028] (1) fusing the coding genes of farnesyl diphosphate synthase ERG20 and lettuce-derived sesquiterpene synthase LsLTC2 to construct a fusion gene ERG20~LcLTC2;
[0029] (2) 2 copies of the fusion gene ERG20~LcLTC2 are integrated into the rDNA site of the starting yeast strain to obtain a yeast strain YB-1;
[0030] (3) the C-terminus of the key genes IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR of the MVA pathway of the endogenous S. cerevisiae is inserted into the ePTS1 positioning signal peptide gene, and integrated into the TY3 site of the chromosome of the yeast strain YB-1 to obtain a yeast strain YB-2;
[0031] (4) 6 copies of the fusion gene ERG20~LcLTC2 are integrated into the delta site of the chromosome of the yeast strain YB-2 to obtain a yeast strain YB-3;
[0032] (5) 6 copies of the coding gene of the bifunctional farnesyl diphosphate synthase RrFPS from rose are integrated into the gal80 site of the chromosome of the yeast strain YB-3 to obtain a yeast strain YB-4.
[0033] Preferably, the method of the present application further comprises: (6) inserting a ubiquitination tag UbiF at the N-terminus of the coding gene of squalene synthase ERG9 of the yeast strain YB-4, while replacing the ERG9 promoter with the HXT1 promoter, to obtain a yeast strain YB-5, and the sequence of the ubiquitination tag UbiF is shown as SEQ ID No. 88.
[0034] More preferably, the method of the present application further comprises one or more of the following steps:
[0035] (7) 3 copies of the fusion gene ERG20~LcLTC2 are integrated into the X2 site of the yeast strain YB-5 to obtain a yeast strain YB-6;
[0036] (8) ERG10 and ERG13 genes are integrated into the X3 site of the yeast strain YB-6 to obtain a yeast strain YB-7;
[0037] (9) XFPK and PTA genes are integrated into the LPP1 site of the yeast strain YB-7 to obtain a yeast strain YB-8;
[0038] (10) 2 copies of the IDI1 gene are integrated into the DPP1 site of the yeast strain YB-8 to obtain a yeast strain YB-9;
[0039] (11) POXB and ACS genes are integrated into the ROX1 site of the yeast strain YB-9 to obtain a yeast strain YB-10.
[0040] The present invention also provides the application of the above-described recombinant yeast or the recombinant yeast constructed by the above method in the fermentation production of β-elemene or in the genetic breeding of microorganisms for the production of β-elemene.
[0041] The present invention also provides a method for producing β-elemene by fermentation, which includes the step of culturing the above-mentioned recombinant yeast or the recombinant yeast constructed by the above method.
[0042] The beneficial effects of this invention are at least as follows:
[0043] This invention provides a novel recombinant yeast strain for the fermentation production of β-elemene, which can efficiently produce β-elemene, providing a more effective method for the industrial production of β-elemene. Detailed Implementation
[0044] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art. Unless otherwise specified, the genes mentioned in the examples refer to the complete coding frames of the genes. All of these can be obtained from NCBI, and the promoter and terminator sequences mentioned can also be downloaded from NCBI. The specific sequence start position can be determined from the primers in the primer table.
[0046] Unless otherwise specified, the fermentation conditions in this invention are pH=5, the culture medium composition is glucose: 50g / L, tryptone: 10g / L, yeast extract: 20g / L, uracil: 0.2g / L, the culture temperature is 30℃, and n-dodecane is added at 10% of the culture medium volume 12h after inoculation. After 7 days of shake-flask fermentation, the upper organic phase is taken to detect the product.
[0047] The sample and detection processing method for yeast cells producing β-elemene and its branched metabolites in this invention are as follows:
[0048] Extraction and analysis of β-elemene products:
[0049] After fermentation, the bacterial culture was transferred to a clean 50 mL centrifuge tube and centrifuged at 12000 rpm. -1Centrifuge for 10 min, extract the upper organic phase, filter through a 0.22 μm filter membrane, and then detect the β-elemene product (dilute with n-hexane if necessary). The chromatographic conditions for β-elemene were: Agilent HP-5 capillary column (0.25 mm × 30 m, 0.25 μm), helium as carrier gas, and a flow rate of 1.5 mL / min. -1 Injector temperature 280℃, splitless injection, injection volume 1μL, programmed temperature ramp (initial temperature 80℃, hold for 1 min; then ramp at 20℃·min). -1 Heat to 180℃ at a rate of 20℃·min and hold for 3 minutes; -1 The temperature was rapidly increased to 280°C and held for 6 min. The mass spectrometry conditions were: electron impact ion source (EI), electron energy 70 eV, ion source temperature 230°C, quadrupole temperature 150°C, accelerating voltage 5 kV, multiple reaction monitoring (MRM) mode (m / z 161.1~93.1), solvent delay 3 min, and mass spectrometry scanning range of m / z 40~450.
[0050] Extraction and analysis of squalene and ergosterol products:
[0051] After thoroughly mixing the fermented bacterial solution in the shake flask, take 1 mL and stir at 12000 r·min. -1 Centrifuge for 1 min, discard the supernatant, add 0.5 g glass beads and 300 μL ethyl acetate, vortex to mix, and grind at 70 Hz for 960 s (pause every 120 s). After grinding, add 700 μL ethyl acetate and sonicate for 30 min at 12000 rpm. -1 Centrifuge for 15 min, filter through a 0.22 μm filter membrane, take 50 μL of supernatant and evaporate to dryness, add 50 μL of derivatization reagent, incubate in a metal bath at 80 °C for 30 min, and detect the content of squalene and ergosterol by GC-MS.
[0052] Chromatographic conditions for squalene and ergosterol were as follows: Agilent HP-5 capillary column (0.25 mm × 30 m, 0.25 μm), helium as carrier gas, flow rate 1.5 mL / min, injection port temperature 300 °C, splitless injection, injection volume 1 μL, programmed temperature ramp (initial temperature 80 °C, hold for 1 min; ramp to 280 °C at 20 °C / min, hold for 15 min; ramp to 300 °C at 20 °C / min, hold for 5 min); mass spectrometry conditions were: electron impact ionization (EI), electron energy 70 eV, ion source temperature 230 °C, quadrupole temperature 150 °C, accelerating voltage 8 kV, MRM mode scan (squalene m / z 136.9~95.1, ergosterol m / z 336.8~69.1), solvent delay 5 min, mass spectrometry scan range 40~450.
[0053] Example 1 β - Genes required for elemol synthesis and acquisition of yeast's own gene elements in modular regulation
[0054] RNA was extracted from fresh lettuce using methods known in the art, and cDNA was obtained by reverse transcription. Primers for the LsLTC2 gene (GenBank accession number AF489964.1) were designed according to conventional methods in the art to amplify the above fragment; primers for the ERG20 gene fragment (GenBank accession number NP_012368.1) were designed using the genome of Saccharomyces cerevisiae CEN.PK2-1D as a template to amplify the above gene fragment in yeast.
[0055] Example 2 β - Acquisition of genes required for elemol synthesis and the formation of expression clusters from yeast's own gene elements in modular regulation.
[0056] Specifically, the expression cluster refers to the promoter + gene fragment sequence + terminator. The construction of the expression cluster is further divided into two steps: First, the gene fragment is amplified with the homologous arm of the vector, and then the pEASY-Blunt-Pgal2-tHMGR-Tfbaxt1 vector (described in Zhang Xiaoli, Chao Erkun, Sun Mengchu, et al. Comparative study on the metabolic flux of MVA in Saccharomyces cerevisiae by tHMGR from three different plant sources [J]. Chinese Journal of Traditional Chinese Medicine, 2022, 47(10):2614-2622.) is amplified in reverse. The gene fragment is then seamlessly ligated into the vector to construct the plasmid (containing the expression cluster). The primers used are shown in Table 1.
[0057] The gene amplified in Example 1 was seamlessly linked to the promoter and terminator to construct the expression clusters of the corresponding genes, specifically: Pgal1-ERG20~LsLTC2-Tcyc1; Pgal10-ERG20~LsLTC2-Tadh1; Pgal2-ERG20~LsLtc2-Tfbaxt1.
[0058] In each expression cluster, ERG20 and elemene synthase LsLTC2 were fused with the short peptide chain GGGGS (SEQ ID No. 133, nucleic acid sequence GGCGGCGGCGGCAGC (SEQ ID No. 1)) as the linker peptide, and the ERG20 terminator TAA was removed during fusion.
[0059] Table 1 (SEQ ID No.2-10)
[0060]
[0061] Example 3: Synthetic Pathway for β-elemene in Yeast
[0062] The Pgal1-ERG20~LsLTC2-Tcyc1 gene expression cluster obtained in Example 2 was integrated into the rDNA site of the yeast chromosome via homologous recombination.
[0063] Specifically, using the vector carrying the expression cluster obtained in Example 2 above as a template, the Pgal1-ERG20~LsLTC2-Tcyc1 gene expression cluster carrying homologous arms was amplified using the primers in Table 2. Then, two copies of farnesyl diphosphate synthase ERG20 and sesquiterpene synthase genes were integrated into the rDNA site of the Saccharomyces cerevisiae CEN.PK2-1D gene group in the form of homologous recombination. Positive clones were detected by PCR, and the ability of positive clone strains to produce β-elemene was detected. The obtained yeast strain was named YB-1.
[0064] Table 2 (SEQ ID No.11-20)
[0065]
[0066] Example 4: Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-2
[0067] Using *Saccharomyces cerevisiae* YB-1 as the starting strain, key genes of the endogenous MVA pathway were amplified by PCR: IDI1 (GenBank accession number NP_015208.1), ERG13 (GenBank accession number NP_013580.1), ERG8 (GenBank accession number NP_013947.1), ERG10 (GenBank accession number NP_015297.1), ERG12 (GenBank accession number NP_013935.1), MVD1 (GenBank accession number NP_014441.1), and tHMGR (GenBank accession number JX648390.1). These genes were then ligated into the GAL1 promoter and CYC1 promoter of the vector pESC-his, respectively. Plasmids were constructed between terminators (BamHⅠ—SacⅡ positions), and then ePTS1 localization signal peptide gene fragments (TTGGGAAGAGGTAGAAGATCCAAATTGTAG, SEQ ID No. 21) were inserted into the C-terminus of each gene. The construction method is the same as in Example 2. Following the method in Example 3, the gene clusters carrying homologous arms were obtained by amplifying the plasmids with the primers in Table 3. Expression cassettes Pgal1-IDI1-Tcyc1, Pgal2-ERG13-Tfbaxt1, Pgal1-ERG8-Tcyc1, Pgal10-ERG10-Tadh1, Pgal2-ERG12-Tfbaxt1, Ptef1-MVD1-Tpgk1, and Ppgk1-tHMGR-Tadh1 were constructed. These cassettes (containing 7 gene fragments) were then integrated into the TY3 site of Saccharomyces cerevisiae YB-1 through homologous recombination to obtain strain YB-2, which had a β-elemene yield of 55.74 mg / L.
[0068] Table 3 (SEQ ID No.22-55)
[0069]
[0070] Example 5: Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-3
[0071] Following the method in Example 3, the plasmids containing the expression clusters Pgal1-ERG20~LsLtc2-Tcyc1, Pgal10-ERG20~LsLtc2-Tadh1, and Pgal2-ERG20~LsLtc2-Tfbaxt1, constructed in Example 2, were amplified using the primers in Table 4. Gene clusters carrying homologous arms were obtained, and these fragments were integrated into the delta site of Saccharomyces cerevisiae YB-2 in two copies each through homologous recombination to obtain strain YB-3, which had a β-elemene yield of 91.88 mg / L.
[0072] Table 4 (SEQ ID No.56-73)
[0073]
[0074] Example 6: Obtaining β-elemene-producing Saccharomyces cerevisiae strain YB-4
[0075] Using *Saccharomyces cerevisiae* YB-1 as the starting strain, the gene encoding phosphate synthase ERG20 was amplified by PCR. Literature review identified ERG20 isozymes from different plant sources. Specifically, bifunctional farnesyl diphosphate synthases capable of catalyzing the conversion of IPP and DMAPP to FPP were cloned from seven plants: *Arabidopsis thaliana*, *Rosa*, *Artemisia annua*, *Centella asiatica*, hops, alfalfa, and ginseng. These are AtFPS (GenBank accession number At4g17190), RrFPS (GenBank accession number KP768082.1), AaFPS (GenBank accession number AF112881.1), CaFPS (GenBank accession number AY787627.1), HiFPS (GenBank accession number AB053487.1), MsFPS (GenBank accession number gU361537.1), and PgFPS (GenBank accession number gU361537.1). Accession number DQ087959.1) was used to ligate the GAL1 promoter and CYC1 terminator of the vector pESC-his to construct plasmids. These plasmids were then transformed into strain YB-1 to obtain strains. YB -1 -At, YB -1 -Rr、 YB- 1 -Aa, YB- 1 -Ca, YB- 1 -Hi, YB- 1 -Ms and YB- 1 -Pg The yields of these products were verified by fermentation, and the results are shown in Table 5.
[0076] Table 5 7 types FPS Import YBIn strain -1, positive bacteria ferment to produce β-elemene, squalene, ergosterol, and OD. 600 Value Result
[0077]
[0078] The optimal isoenzyme selected was RrFPS, and the corresponding gene clusters Pgal1-RrFPS-Tcyc1 and Pgal10-RrFPS-Tadh1 were constructed in the pESC-his vector (construction method is referred to Example 2). Further, following the method of Example 3, the gene clusters carrying homologous arms were amplified using the primers in Table 6, and integrated into the gal80 site on the yeast chromosome of YB-3 in the form of 3 copies, respectively, to obtain strain YB-4. After shake-flask fermentation, the yield reached 246.2 mg / L.
[0079] Table 6 (SEQ ID No.74-87)
[0080]
[0081] Example 7: Obtaining β-elemene-producing yeast strain YB-5
[0082] Based on the yeast's own metabolism, the more β-elemene precursor FPP accumulates, the greater the flow to this pathway. Therefore, this invention reduces FPP consumption by downregulating the expression of the competitive pathway ERG9 (ERG9 converts FPP into squalene for sterol synthesis). Specifically, the ubiquitination tag UbiF (SEQ ID No. 88) is inserted at the N-terminus of the ERG9 gene (GenBank accession number NP_012060.1) in strain YB-4, and the ERG9 promoter is replaced with the HXT1 promoter (described in Tangh, Wu Y, Deng J, et al. Promoter Architecture and Promoter Engineering insaccharomycescerevisiae. metabolites. 2020;10(8):320. Published 2020 Aug 6.). This tag UbiF can recruit ubiquitinase to reduce the expression of the ERG9 gene, resulting in yeast strain YB-5. After shake-flask fermentation, the yield reached 442.59 mg / L.
[0083] Example 8: Obtaining β-elemene-producing yeast strain YB-6
[0084] The sesquiterpene synthase gene LsLTC2 described in Example 1 was enhanced on strain YB-5. Specifically, the corresponding gene clusters Pgal10-E20~LsLTC2-Tadh1 and Pgal1-E20~LsLTC2-Tcyc1 were constructed in the pESC-his vector (construction method is the same as in Example 2). Following the method in Example 3, the gene clusters carrying homologous arms were amplified using the primers in Table 7. The two Pgal1-E20~LsLTC2-Tcyc1 and one Pgal10-E20~LsLTC2-Tadh1 gene clusters carrying homologous arms were integrated into the genome of strain YB-5 through homologous recombination. This resulted in the integration of three copies of the farnesyl diphosphate synthase ERG20 and sesquiterpene synthase genes at the X2 site of the YB-5 genome, yielding strain YB-6. The final yield of β-elemene during shake-flask fermentation reached 825.46 mg / L.
[0085] Table 7 (SEQ ID No.89-100)
[0086]
[0087] Example 9: Obtaining β-elemene-producing yeast strain YB-7
[0088] The ERG10 (GenBank accession number NP_015297.1) and ERG13 (GenBank accession number NP_013580.1) genes were integrated into the X3 site of the YB-6 strain. The specific method is as follows: The ERG10 and ERG13 genes were constructed separately in the pESC-his empty vector. Specifically, the ERG10 gene was constructed after the gal1 promoter, and the ERG13 gene was constructed after the gal10 promoter. Then, using the vector containing the ERG10 and ERG13 genes as a template, amplification was performed using the primers listed in Table 8 to obtain a large fragment containing both the ERG10 and ERG13 genes. This large fragment was then integrated into the X3 site of the *Saccharomyces cerevisiae* YB-6 genome via homologous recombination. The resulting yeast strain YB-7, after shake-flask fermentation, achieved a yield of 900.3 mg / L.
[0089] Table 8 (SEQ ID No.101-108)
[0090]
[0091] Example 10: Obtaining β-elemene-producing yeast strain YB-8
[0092] The non-oxidative phosphorylation genes XFPK (GenBank accession number CBL90649.1) and PTA (GenBank accession number QBJ74152.1) were integrated into the LPP1 site of the YB-7 strain. The specific method is as follows: The XFPK and PTA genes were constructed in the pESC-his empty vector. Specifically, one XFPK gene was constructed after the gal1 promoter, and the other PTA gene was constructed after the gal10 promoter. Amplification was performed using the primers listed in Table 9 to obtain a large fragment containing both XFPK and PTA genes. This large fragment was then integrated into the LPP1 site of the Saccharomyces cerevisiae YB-7 genome via homologous recombination, ultimately yielding yeast strain YB-8. After shake-flask fermentation, the yield reached 1039.5 mg / L.
[0093] Table 9 (SEQ ID No.109-116)
[0094]
[0095] Example 11 Obtaining β-elemene-producing yeast strain YB-9
[0096] Two copies of the IDI1 gene (GenBank accession number NP_015208.1) were integrated into the DPP1 site of the YB-8 strain. The specific method is as follows: Two IDI1 genes were constructed in the pESC-his empty vector, one IDI1 gene was constructed after the gal1 promoter, and the other IDI1 gene was constructed after the gal10 promoter. Then, using the vector containing the two IDI1 genes as a template, amplification was performed using the primers listed in Table 10 to obtain a large fragment containing both IDI1 genes. This large fragment was then integrated into the DPP1 site of the Saccharomyces cerevisiae YB-8 genome via homologous recombination. The resulting yeast strain YB-9 was obtained, and after shake-flask fermentation, the yield reached 1145.59 mg / L.
[0097] Table 10 (SEQ ID No.117-124)
[0098]
[0099] Example 12 Obtaining β-elemene-producing yeast strain YB-10
[0100] The POXB (GenBank accession number NP_418139.1) and ACS (GenBank accession number AT5G36880) genes were integrated into the ROX1 site of the YB-9 strain. The specific method is as follows: The POXB and ACS genes were constructed separately in the pESC-his empty vector. Specifically, the POXB gene was constructed after the gal1 promoter, and the ACS gene was constructed after the gal10 promoter. Then, using the vector containing the POXB and ACS genes as a template, amplification was performed using the primers listed in Table 11 to obtain a large fragment containing both the POXB and ACS genes. This large fragment was then integrated into the ROX1 site of the YB-9 genome of *Saccharomyces cerevisiae* via homologous recombination. The resulting yeast strain YB-10 was obtained, and after shake-flask fermentation, the yield reached 1336.45 mg / L.
[0101] Table 11 (SEQ ID No.125-132)
[0102]
[0103] Example 13
[0104] Fermentation tank optimization:
[0105] 1. Online monitoring and dynamic control: The system monitors key parameters (such as pH, dissolved oxygen concentration, temperature, etc.) in the fermentation process in real time through an online monitoring system and makes dynamic adjustments based on the data.
[0106] 2. Optimized Feeding Strategy: Nutrients are precisely added according to the growth stage and metabolic needs of the microorganisms. For example, during fermentation, the feeding rate is adjusted to keep the ethanol content below 0.5 g / L to avoid ethanol accumulation that inhibits microbial growth.
[0107] 3. Fermentation parameter adjustment: Optimize the aeration rate and stirring speed of the fermenter to meet the needs of different fermentation stages. For example, during fermentation, the dissolved oxygen level can be controlled above 30% by adjusting the stirring speed and aeration rate.
[0108] 4. In a 3 L fermenter, by optimizing fermentation conditions (pH 5.0-6.5, dissolved oxygen 30%-50%, temperature 28-30℃), 300 mL of bacterial culture was inoculated into Delft medium (a commercially available product containing 2.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L mgSO4·7H2O, 20 g / L glucose, trace elements, and vitamins, etc.). The initial OD... 600The culture medium was inoculated at a concentration of 0.4 g / L. After 12 hours of fermentation, 600 g / L of galactose stock solution was added to bring the galactose concentration in the tank to 20 g / L. After 24 hours, ethanol was added continuously, maintaining the ethanol concentration at 3-5 g / L, and 10% n-dodecane was added for two-phase fermentation. After 7 days of fermentation, the β-elemene yield of strain YB-10 reached 20.545 g / L.
[0109] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A method for producing β-elemene by fermentation, characterized in that, This includes the steps of culturing recombinant yeast; The specific method for constructing the recombinant yeast is as follows: (1) The coding genes of farnesyl diphosphate synthase ERG20 and lettuce-derived sesquiterpene synthase LsLTC2 were fused to construct the fusion gene ERG20~LcLTC2; (2) Two copies of the fusion gene ERG20~LcLTC2 were integrated into the rDNA site of the starting Saccharomyces cerevisiae strain to obtain yeast strain YB-1; (3) Insert the C-terminus of the key genes IDI1, ERG13, ERG8, ERG10, ERG12, MVD1 and tHMGR of the endogenous MVA pathway of Saccharomyces cerevisiae into the ePTS1 localization signal peptide gene, and integrate them into the TY3 site of the chromosome of yeast strain YB-1 to obtain yeast strain YB-2. (4) The fusion gene ERG20~LcLTC2 with 6 copies was integrated into the delta site of the chromosome of yeast strain YB-2 to obtain yeast strain YB-3; (5) The gene encoding six copies of the bifunctional farnesyl diphosphate synthase RrFPS from rose was integrated into the gal80 site on the chromosome of yeast strain YB-3 to obtain yeast strain YB-4. (6) Insert the ubiquitination tag UbiF into the N-terminus of the coding gene for squalene synthase ERG9 in yeast strain YB-4, and replace the ERG9 promoter with the HXT1 promoter to obtain yeast strain YB-5. The sequence of the ubiquitination tag UbiF is shown in SEQ ID No.
88. (7) Three copies of the fusion gene ERG20~LcLTC2 were integrated into the X2 site of the yeast strain YB-5 to obtain the yeast strain YB-6; (8) Integrate the ERG10 and ERG13 genes at the X3 site of the yeast strain YB-6 to obtain the yeast strain YB-7; (9) XFPK and PTA genes were integrated into the LPP1 site of the yeast strain YB-7 to obtain yeast strain YB-8; (10) Two copies of the IDI1 gene were integrated into the DPP1 site of the yeast strain YB-8 to obtain the yeast strain YB-9; (11) POXB and ACS genes were integrated into the ROX1 site of the yeast strain YB-9 to obtain yeast strain YB-10; The starting strain of the recombinant yeast was Saccharomyces cerevisiae CEN.PK2-1D; The GenBank accession number for the farnesyl diphosphate synthase ERG20 is NP_012368.1; The GenBank accession number for the gene encoding the lettuce-derived sesquiterpene synthase LsLTC2 is AF489964.1; The GenBank accession number for the gene encoding the rose-derived bifunctional farnesyl diphosphate synthase RrFPS is KP768082.1; The GenBank login number for IDI1 is NP_015208.1; The GenBank accession number for ERG13 is NP_013580.1; The GenBank accession number for ERG8 is NP_013947.1; The GenBank accession number for ERG10 is NP_015297.1; The GenBank accession number for ERG12 is NP_013935.1; The GenBank accession number of the MVD1 is NP_014441.1; The GenBank accession number for the tHMGR is JX648390.1; The GenBank accession number for the squalene synthase ERG9 is NP_012060.1; The GenBank login number for the XFPK is CBL90649.1; The GenBank accession number of the PTA is QBJ74152.1; The GenBank login number for the POXB is NP_418139.1; The GenBank accession number for the gene encoding the ACS is AT5G36880; The method involves optimizing fermentation conditions by inoculating the bacterial culture into Delft medium and fermenting for 12 hours, then adding galactose stock solution to achieve a galactose concentration of 20 g / L in the tank; after 24 hours, ethanol is added continuously, maintaining an ethanol concentration of 3-5 g / L, and 10% n-dodecane is added for two-phase fermentation; β-elemene is obtained after 7 days of fermentation. The optimized fermentation conditions are: pH 5.0-6.5, dissolved oxygen 30%-50%, and temperature 28-30℃.
Citation Information
Patent Citations
Saccharomyces cerevisiae engineering strain for producing beta-elemene as well as construction method and application of saccharomyces cerevisiae engineering strain
CN116814672A
Construction method of hansenula polymorpha chassis cell for synthesizing sesquiterpenoids and application of hansenula polymorpha chassis cell
CN118006657A
Yarrowia lipolytica genetically engineered bacterium capable of producing β-elemene and construction method therefor, and method for preparing β-elemene
WO2023174453A2
(-)-germacene a synthetase and preparation method therefor
WO2024245428A1