Antisense oligonucleotide for inhibiting expression of hepatitis B virus

Abstract

The invention provides antisense oligonucleotide for inhibiting expression of hepatitis B virus, and also relates to a pharmaceutical composition of the antisense oligonucleotide. The antisense oligonucleotide or / and the pharmaceutical composition of the antisense oligonucleotide can be used for preparing drugs for treating and / or preventing hepatitis B.

Description

Technical Field

[0001] The present invention belongs to the field of small nucleic acid drugs, and the purpose of the present invention is to provide a novel antisense oligonucleotide, its conjugate and its use. The antisense oligonucleotide and its conjugate of the present invention can be used to prepare drugs for treating and / or preventing hepatitis B disease. Background Art

[0002] Hepatitis B virus (also known as hepatitis B or hepatitis B or HBV) is a serious infectious disease threatening the world. The outer envelope proteins of HBV are collectively referred to as hepatitis B surface antigen (HBsAg). HBsAg consists of three related polypeptides, which are called S, M and L, encoded by overlapping open reading frames (ORFs). The smallest envelope protein is S with 226 amino acids, called S-ORF. M and L are generated from the upstream translation start site, adding 55 and 108 amino acids to S, respectively. HBV S, M and L glycoproteins are present in the viral envelope of the complete, infectious HBV virion called Dane particles, and all three are produced and secreted in large quantities to form non-infectious subviral spherical and filamentous particles (all called decoy particles) found in the blood of chronic HBV patients. The abundant HBsAg on the surface of decoy particles is thought to suppress humoral immunity and spontaneous clearance in patients with chronic HBV infection (CHB).

[0003] The current standard of care for chronic HBV infection is treatment with oral nucleoside (nucleotide) analogs (such as entecavir or tenofovir), which provide inhibition of HBV replication by inhibiting HBV DNA synthesis, but do not directly act on viral antigens, such as HBsAg, which only shows low levels of HBsAg clearance even with long-term treatment with nucleoside (nucleotide) analogs. In this regard, patients with chronic hepatitis B show very weak HBV T cell responses and lack anti-HB antibodies, which is believed to be one of the reasons why these patients cannot clear the virus. Therefore, if the gene expression of the virus can be silenced at the genetic level, the generation and replication of HBV can be blocked, thereby fundamentally reducing viral replication and infection of liver cells, it will undoubtedly be the most ideal treatment for hepatitis B.

[0004] Antisense technology is an effective means to reduce the expression of specific gene products. It has been shown to be applicable to the treatment, diagnosis and research of various diseases, and it is also uniquely suitable for regulating HBV expression. Antisense therapy differs from nucleoside therapy in that it can directly target transcripts of HBV antigens and thus reduce serum HBeAg and HBsAg levels. Since multiple overlapping transcripts are produced during HBV infection, a single antisense oligomer may reduce HBV DNA in addition to HBeAg and HBsAg. Therefore, antisense technology is uniquely suitable for regulating HBV as an effective means to reduce the expression of certain gene products.

[0005] SUMMARY AND DETAILED DESCRIPTION

[0006] The present invention aims to provide a novel antisense oligonucleotide (ASO), a conjugate thereof and its use. The antisense oligonucleotide and its conjugate of the present invention can be used to prepare a drug for treating and / or preventing hepatitis B disease. The antisense oligonucleotide and its conjugate of the present invention have higher gene expression inhibition activity and / or lower toxicity to HBV.

[0007] In one aspect, the present invention relates to a modified antisense oligonucleotide having a structure shown in formula (I):

[0008] 5'-XYZ-3'

[0009] (I)

[0010] Wherein, X is composed of 1-14 linked nucleotides; Y is composed of 5 to 15 linked deoxynucleotides; Z is composed of 1-14 linked nucleotides; and the antisense oligonucleotide comprises one of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 25, and the antisense oligonucleotide is 12 to 20 nucleotides in length, and the sequence information of SEQ ID NO: 1 to SEQ ID NO: 25 is shown in Table 1.

[0011] In some embodiments of the antisense oligonucleotides of the present invention, the oligonucleotides are used to inhibit the expression of hepatitis B virus.

[0012] In some embodiments described herein, X described herein consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 linked nucleotides.

[0013] In some embodiments described herein, Z described herein consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 linked nucleotides.

[0014] In some embodiments described herein, Y described herein consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 linked deoxynucleotides.

[0015] In some embodiments described herein, the antisense oligonucleotide described herein consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 linked nucleotides.

[0016] In some embodiments of the antisense oligonucleotides of the invention, all nucleosides in X and Z contain 2'-O-methoxyethyl sugar (2'-MOE ribose).

[0017] In some embodiments of the antisense oligonucleotide of the present invention, all internucleoside bonds in the antisense oligonucleotide are phosphorothioate bonds.

[0018] In some implementations of the antisense oligonucleotide of the present invention, all cytosines in the antisense oligonucleotide are independently optionally 5-methyl-modified cytosines.

[0019] In some embodiments of the antisense oligonucleotide of the present invention, all cytosines in the antisense oligonucleotide are 5-methyl-modified cytosines.

[0020] In some embodiments of the antisense oligonucleotide of the present invention, the antisense oligonucleotide comprises one of the nucleotide sequences shown in SEQ ID NO:26 to SEQ ID NO:372. The sequence information of SEQ ID NO:26 to SEQ ID NO:372 is shown in Table 2.

[0021] In some implementations of the antisense oligonucleotides of the present invention, the antisense oligonucleotides optionally include a delivery vehicle portion.

[0022] In some embodiments of the antisense oligonucleotides of the present invention, the delivery vehicle portion comprises an asialoglycoprotein receptor (ASGP-R) targeting portion or a cholesterol conjugate portion.

[0023] In some embodiments of the antisense oligonucleotides of the present invention, the ASGP-R targeting moiety comprises GalNAc or a derivative thereof.

[0024] In some embodiments of the antisense oligonucleotides of the present invention, the ASGP-R targeting moiety comprises GalNAc or a derivative thereof connected by a bivalent or trivalent branched linker.

[0025] In some embodiments of the antisense oligonucleotide of the present invention, the ASGP-R targeting moiety is L-96 or DAW40007-4, wherein the structures of L-96 and DAW40007-4 are respectively:

[0026]

[0027] In some embodiments of the antisense oligonucleotide of the present invention, the 3' end or the 5' end of the antisense oligonucleotide is linked to the ASGP-R targeting moiety via a phosphate group, a phosphorothioate group or a phosphate group.

[0028] In another aspect, the present invention relates to a composition comprising the antisense oligonucleotide or a salt thereof according to the present invention, and at least one of a pharmaceutically acceptable excipient and a diluent.

[0029] In yet another aspect, the present invention relates to use of the antisense oligonucleotide of the present invention or a composition thereof in the preparation of a medicament for treating an HBV-related disease, disorder or condition in a subject.

[0030] In some embodiments of the antisense oligonucleotides of the invention, the disease, disorder or condition is jaundice, liver fibrosis, hepatitis, cirrhosis, serum hepatitis, liver failure, liver cancer, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, HBV viremia or transplantation associated with liver disease.

[0031] In yet another aspect, the present invention relates to the use of the antisense oligonucleotide or a composition thereof according to the present invention in the preparation of a medicament for reducing the level of HBsAG in a subject infected with HBV.

[0032] Table 1: Basic sequence antisense oligonucleotides

[0033] Sequence (5'-3') SEQ ID NO GGUGAAGCGAAGUGC 1 GCAGAGGTGAAGCGAAGTGC 2 CAGAGGTGAAGCGAAGTGC 3 GCAGAGGTGAAGCGAAGTG 4 GCAGAGGTGAAGCGAA 5 CAGAGGTGAAGCGAA 6 AGAGGTGAAGCGAA 7 GAGGTGAAGCGAAGT 8 AGGTGAAGCGAAGT 9 CAGAGGTGAAGCGAAGT 10 AGAGGTGAAGCGAAGT 11 GAGGTGAAGCGAAGTGC 12 AGAGGTGAAGCGAAGTGC 13 GAGGTGAAGCGAAG 14 GGTGAAGCGAAGTG 15 GTGAAGCGAAGTGC 16 AGGTGAAGCGAAGTG 17 AGAGGTGAAGCGAAG 18 AGGTGAAGCGAAGTGC 19 GAGGTGAAGCGAAGTG 20 CAGAGGTGAAGCGAAG 21 AGAGGTGAAGCGAAGTG 22 GCAGAGGTGAAGCGAAG 23 CAGAGGTGAAGCGAAGTG 24 GCAGAGGTGAAGCGAAGT 25

[0034] In Table 1, capital letters A, U, T, G, and C represent natural base nucleotides, respectively.

[0035] Definitions and general terms

[0036] In the present invention, the terms "comprise" or "include" are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0037] In the present invention, the term "inhibiting the expression of hepatitis B virus genes" includes any level of inhibition of hepatitis B virus (abbreviated as HBV) genes, for example, at least partial inhibition of hepatitis B virus gene expression, such as inhibition of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99%. Wherein, the expression of hepatitis B virus genes can be evaluated based on the level of any variable related to the expression of hepatitis B virus genes, for example, the mRNA level of hepatitis B virus or the level of hepatitis B virus protein. Inhibition can be evaluated by a reduction in the absolute or relative level of one or more of these variables compared to a control level. A control level can be any type of control level utilized in the art, e.g., a baseline level before administration, or a level measured from a similar subject, cell or sample that has never been treated or treated with a control (e.g., a control with only a buffer or a control without an active agent).

[0038] In the present invention, "pharmaceutical composition" may refer to a composition used for the treatment of a disease, or may be used for in vitro cell culture experiments. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dosage form, and may be prepared by any of the methods well known in the pharmaceutical art. All methods include the step of combining the active ingredient with an excipient that constitutes one or more accessory ingredients. Typically, the composition is prepared by uniformly and fully combining the active ASO with a liquid excipient, a finely divided solid excipient, or both.

[0039] "Internucleoside bond" means a group that can covalently link two entities (such as nucleotides) together. Specific examples include phosphate groups and phosphorothioate groups.

[0040] The term "carrier moiety" refers to a molecular vehicle intended to carry or transport an oligomer of the invention to its desired location, such as a desired anatomical location.

[0041] In some embodiments, the carrier component comprises an asialoglycoprotein receptor (ASGP-R) targeting moiety with an affinity equal to or greater than galactose. The ASPG-R targeting moiety can be selected from galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine (GalNAc), N-propionylgalactosamine, N-n-butyrylgalactosamine and N-isobutyrylgalactosamine. In some embodiments, the asialoglycoprotein receptor of the targeting conjugate part is monovalent. In other embodiments, the carrier component comprises a galactose cluster, such as a divalent, trivalent or tetravalent asialoglycoprotein receptor (i.e., containing 1, 2, 3 or 4 terminal sugar moieties that can bind to the asialoglycoprotein receptor) of the targeting conjugate part. In some embodiments, the carrier component comprises GalNAc (N-acetylgalactosamine), such as monovalent, divalent, trivalent or tetravalent GalNAc. GalNAc conjugates can be used to target compounds to the liver. The preferred carrier component is N-acetylgalactosamine trimer. In some embodiments, the carrier moiety is or comprises a sugar moiety. The glycoconjugate moiety includes, but is not limited to, galactose, lactose, N-acetylgalactosamine, mannose, and mannose-6-phosphate. Glycoconjugates can be used to enhance delivery or activity in a range of tissues such as liver and / or muscle.

[0042] In the present invention, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients comprising the formulation and / or the mammal to be treated therewith.

[0043] In the present invention, the term "pharmaceutically acceptable excipient" may include any solvent, solid excipient, diluent or other liquid excipient, etc., suitable for the specific target dosage form. Except for the scope of any conventional excipient being incompatible with the ASO of the present invention, such as any adverse biological effect produced or interacting with any other component of the pharmaceutically acceptable composition in a harmful manner, their use is also contemplated by the present invention.

[0044] As used herein, "chemically modified" or "modification" means a structure that has a chemical difference when compared to a naturally occurring counterpart, including all changes by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.

[0045] The compounds of the present invention may be asymmetric, for example, having one or more stereoisomers. Unless otherwise indicated, all stereoisomers are included, such as enantiomers and diastereomers. The compounds of the present invention containing asymmetric carbon atoms can be isolated in optically pure forms or racemic forms. Optically pure forms can be resolved from racemic mixtures or synthesized by using chiral starting materials or chiral reagents.

[0046] Optically active (R)- and (S)-isomers, as well as D and L isomers, can be prepared by chiral synthesis or chiral reagents or other conventional techniques. If one enantiomer of a compound of the invention is desired, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the pure desired enantiomer. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), diastereomeric salts are formed with an appropriate optically active acid or base, followed by diastereomeric resolution by conventional methods known in the art, and then the pure enantiomer is recovered. In addition, separation of enantiomers and diastereomers is usually accomplished by using chromatography, which employs a chiral stationary phase and is optionally combined with chemical derivatization (e.g., carbamate formation from an amine).

[0047] The present invention also includes isotopically labeled compounds of the present invention that are identical to those described herein, but in which one or more atoms are replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that may be incorporated into compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as 2 H. 3 H. 11 C, 13C, 14 C. 13 N. 15 N. 15O. 17 O. 18 O. 31 P. 32 P. 35 S. 18 F. 123 I. 125 I and 36 Cl et al.

[0048] Unless otherwise indicated, when a position is specifically designated as deuterium (D), the position is understood to have deuterium (i.e., at least 10% deuterium incorporation) at least 1000 times greater than the natural abundance of deuterium (which is 0.015%). The natural abundance of the compound in the example may be at least 1000 times greater than deuterium, at least 2000 times greater than deuterium, at least 3000 times greater than deuterium, at least 4000 times greater than deuterium, at least 5000 times greater than deuterium, at least 6000 times greater than deuterium or more. The present invention also includes various deuterated forms of the formula (I) compound. Each available hydrogen atom connected to a carbon atom may be independently replaced by a deuterium atom. Those skilled in the art can synthesize deuterated forms of the formula (I) compound with reference to the relevant literature. In preparing the deuterated form of the compound of formula (I), commercially available deuterated starting materials may be used, or they may be synthesized using conventional techniques using deuterated reagents, including but not limited to deuterated borane, trideuterated borane in tetrahydrofuran, deuterated lithium aluminum hydride, deuterated iodoethane and deuterated iodomethane.

[0049] The conjugated groups of the present invention can enhance the delivery of therapeutic agents to specific target locations (e.g., specific organs or tissues) in objects such as humans or animals. In some embodiments of the present invention, the conjugated groups can enhance the targeted delivery of expression inhibitory oligonucleotides. In some embodiments of the present invention, the conjugated groups can enhance the delivery of expression inhibitory oligonucleotides to the liver.

[0050] The conjugated groups of the present invention can be directly or indirectly connected to a compound, such as a therapeutic agent, for example, an expression inhibitory oligonucleotide, for example, the 3' or 5' end of the expression inhibitory oligonucleotide. In some embodiments of the present invention, the expression inhibitory oligonucleotide comprises one or more modified nucleotides. In some embodiments of the present invention, the expression inhibitory oligonucleotide is an ASO. In some embodiments, the conjugated groups disclosed in the present invention are connected to the expression inhibitory oligonucleotide reagent at the 3' end via a phosphate, a thiophosphate or a phosphonate group.

[0051] The definitions and conventions of stereochemistry used in this invention are generally based on the following references: SP Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist in different stereoisomers. All stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, constitute a part of the present invention. Many organic compounds exist in optically active forms, that is, they have the ability to rotate the plane of plane polarized light. When describing optically active compounds, the prefixes D, L or R, S are used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to name the sign of rotation of plane polarized light of a compound. (-) or l means that the compound is levorotatory, and the prefix (+) or d means that the compound is dextrorotatory. The chemical structures of these stereoisomers are identical, but their stereostructures are different. Specific stereoisomers can be enantiomers, and a mixture of isomers is often called an enantiomeric mixture. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiomers that lacks optical activity.

[0052] The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that can be interconverted via a low energy barrier. For example, proton tautomers (i.e., prototropic tautomers) include interconversions via proton migration, such as keto-enol and imine-enamine isomerizations.

[0053] The term "composition" refers to a mixture of a drug and other chemical components containing one or more ASOs of the present invention or their physiologically pharmaceutically acceptable salts or precursors, as well as other components such as physiologically pharmaceutically acceptable carriers and excipients. The purpose of the composition is to facilitate administration to an organism, facilitate the absorption of the active ingredients, and thus exert biological activity.

[0054] The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier approved by the U.S. Food and Drug Administration for use in humans or domestic animals.

[0055] Unless otherwise specified, the "compound", "ligand", "nucleic acid conjugate" and "nucleic acid" of the present invention may independently exist in the form of a salt, a mixed salt or a non-salt (e.g., a free acid or a free base). When it exists in the form of a salt or a mixed salt, it may be a pharmaceutically acceptable salt.

[0056] The term "acceptable salt" includes acceptable acid addition salts and pharmaceutically acceptable base addition salts. "Acceptable acid addition salt" refers to salts formed with inorganic or organic acids that can retain the biological effectiveness of free bases without other side effects. Inorganic acid salts include, but are not limited to, hydrochlorides, hydrobromides, sulfates, nitrates, phosphates, etc.; organic acid salts include, but are not limited to, formates, acetates, 2,2-dichloroacetates, trifluoroacetates, propionates, caproates, caprylates, decanoates, undecylenates, glycolates, gluconates, lactates, sebacates, adipates, glutarates, malonates, oxalates, maleates, succinates, fumarates, tartrates, citrates, palmitates, stearates, oleates, cinnamates, laurates, malates, glutamates, pyroglutamates, aspartates, benzoates, methanesulfonates, benzenesulfonates, p-toluenesulfonates, alginate, ascorbates, salicylates, 4-aminosalicylates, naphthalene disulfonates, etc. These salts can be prepared by methods known in the art.

[0057] "Pharmaceutically acceptable base addition salt" refers to a salt formed with an inorganic base or an organic base that can maintain the biological effectiveness of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts, and magnesium salts, preferably sodium salts. The salt derived from organic base includes but is not limited to the following salt: primary amines, secondary amines and tertiary amines, substituted amines, including natural substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine. These salts can be prepared by methods known in the art.

[0058] In addition, it should be noted that, unless explicitly stated otherwise, the description methods used throughout the present invention, "each... and... are independently", "... and... are each independently", and "... and... are respectively independently" are interchangeable and should be understood in a broad sense, which may mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0059] In the present invention, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or situation can but does not necessarily occur, and the description includes cases where the event or situation occurs and cases where it does not occur.

[0060] For example, the phrase “all cytosines in the antisense oligonucleotide are each independently optionally 5-methyl-modified cytosines” of the present invention means that all cytosines in the antisense oligonucleotide of the present invention may be unmodified, or the 5-position of 1, 2, 3, 4, 5 or 6 cytosines may be modified with a methyl group.

[0061] The term "solid support" or "solid support" specifically refers to any particle, bead or surface on which oligonucleotide synthesis can occur. For example, inorganic solid supports and organic solid supports can be selected for use in embodiments of the present invention. Inorganic solid supports are preferably selected from silica gel and controlled-pore glass beads (Controlled-pore glass, CPG for short). Organic solid supports are resins, preferably macroporous resins, more preferably highly cross-linked polystyrene, Tentagel (graft copolymers composed of low cross-linked polystyrene matrix, polyethylene glycol (PEG or POE) grafted thereon), polyvinyl acetate (PVA), Poros (Poros)-polystyrene / divinylbenzene copolymers, aminopolyethylene glycol and cellulose etc. Preferred embodiments of the present invention utilize solid supports based on CPG. Many other purchasable solid supports all belong to the present invention.

[0062] Compositions, administration and disease treatment methods of antisense oligonucleotides and antisense oligonucleotide conjugates of the present invention

[0063] The oligonucleotides of the present invention and the oligonucleotide conjugates of the present invention can be used in pharmaceutical preparations and compositions. Suitably, such compositions contain a pharmaceutically acceptable diluent, carrier, salt or adjuvant.

[0064] The pharmaceutical compositions of the present invention may include a pharmaceutically acceptable carrier, which may contain various components that provide various functions, including adjusting drug concentration, adjusting solubility, chemical stabilization, adjusting viscosity, enhancing absorption, adjusting pH, and the like.

[0065] Pharmaceutical carriers may include suitable liquid solvents or excipients and optional auxiliary additives or additives. Liquid solvents and excipients are conventional and commercially available. Illustrative pharmaceutical carriers are distilled water, physiological saline, dextrose aqueous solution, etc. For water-soluble preparations, the pharmaceutical composition preferably includes a buffer such as a phosphate buffer or other organic acid salts, preferably in the range of pH 6.5 to 8. For preparations containing slightly soluble antisense compounds, microemulsions can be used, for example, by using a nonionic surfactant such as polysorbate-80 in an amount of 0.04-0.05% (w / v) to increase solubility. Other components may include antioxidants (such as ascorbic acid), hydrophilic polymers, such as monosaccharides, disaccharides and other sugars (including cellulose or its derivatives, dextrins), chelating agents, such as EDTA and similar components well known to pharmaceutical science and technology personnel, for example, Remington's Pharmaceutical Science, latest edition (Mack Publishing Company, Easton, Pa.).

[0066] The oligonucleotides of the present invention include pharmaceutically acceptable salts thereof, including alkaline earth metal (e.g., sodium or magnesium), ammonium or NX 4+ (where X is C1-C4 alkyl). Other pharmaceutically acceptable salts include organic carboxylates such as formates, acetates, lactates, tartrates, malates, isethionates, lactobionates and succinates; organic sulfonates such as methanesulfonates, ethanesulfonates, toluenesulfonates and benzenesulfonates; and inorganic acid salts such as hydrochlorides, sulfates, phosphates and sulfamates. Pharmaceutically acceptable salts of compounds having hydroxy groups include anions of such compounds, together with suitable cations such as Na + NH 4+ wait.

[0067] The drug can be administered to a subject by any suitable route known in the art, including but not limited to oral or parenteral routes, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration and topical administration (including buccal administration and sublingual administration), preferably intravenous injection.

[0068] Pharmaceutical compositions disclosed in the present invention include preparations suitable for parenteral administration. Preparations can be conveniently present in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be combined with auxiliary materials to prepare a single dose form is generally the amount of antisense oligonucleotides that produce a therapeutic effect. Generally speaking, in units of one percent, the amount is about 1% to about 99% active ingredient, preferably about 5% to about 70%, and most preferably about 10% to about 30%.

[0069] The therapeutically effective amount of one or more drugs present in the composition of the invention and used in the method of the invention applied to a mammal (e.g., a human) can be determined by a person of ordinary skill in the art taking into account individual differences in age, weight, and condition of the mammal. The drug of the invention is administered to a subject (e.g., a mammal, such as a human) in an effective amount that produces a desired result (e.g., slowing or alleviating cancer or neurodegenerative disease) in the treated subject. The therapeutically effective amount can be determined empirically by a person of ordinary skill in the art.

[0070] The patient can also receive the drug once or more per week (e.g., 2, 3, 4, 5, 6 or 7 times or more per week) at a dose of about 0.1 to 3,000 mg per dose, with a weekly dose of 0.1 to 2,500 (e.g., 2,000, 1,500, 1,000, 500, 100, 10, 1, 0.5 or 0.1) mg. The patient can also receive a composition drug of 0.1 to 3,000 mg per dose once every two weeks or three weeks. Single or multiple administrations of the composition of the present invention comprising an effective amount can be implemented, and the dosage level and pattern are selected by the treating physician. The dosage and administration regimen can be determined and adjusted based on the severity of the disease or condition in the patient, wherein the severity can be monitored throughout the treatment process according to the methods commonly implemented by clinicians or those methods described in the present invention.

[0071] In another aspect of the present invention, the present invention proposes a method for inhibiting the expression or activity of hepatitis B virus genes. According to an embodiment of the present invention, the method comprises: contacting the aforementioned antisense oligonucleotide or the aforementioned pharmaceutical composition with a cell. As mentioned above, the aforementioned antisense oligonucleotide can degrade the mRNA of hepatitis B virus and inhibit the expression and replication of HBV. Therefore, the method of the present invention can be used to inhibit the expression or activity of hepatitis B virus genes. For example, the expression or activity of hepatitis B virus genes can be inhibited in animals; or the expression or activity of hepatitis B virus genes can be inhibited for non-disease treatment purposes, such as inhibiting the expression or activity of hepatitis B virus genes in vitro for subsequent research.

[0072] In another aspect of the present invention, the present invention provides a method for preventing and / or treating hepatitis B virus-induced diseases. According to an embodiment of the present invention, the method comprises: administering a pharmaceutically acceptable amount of the aforementioned antisense oligonucleotide or the aforementioned pharmaceutical composition to a subject. According to an embodiment of the present invention, the method can effectively prevent and / or treat related diseases caused by hepatitis B virus.

[0073] General synthesis method of the vector, antisense oligonucleotide and antisense oligonucleotide conjugate of the present invention

[0074] Generally, the vector, antisense oligonucleotide, and antisense oligonucleotide conjugate of the present invention can be prepared by the method described in the present invention. The following reaction schemes and examples are used to further illustrate the content of the present invention.

[0075] In the examples described below, unless otherwise indicated, all temperatures are in degrees Celsius (°C). Silica gel columns were used as chromatographic columns. Silica gel (200-300 mesh) was purchased from Qingdao Ocean Chemical Plant, and NH2CPG was purchased from Hebei Dinaxingke. Nuclear magnetic resonance spectra were obtained with CDC13, DMSO-d6, CD3OD or acetone-d6 as solvents (in ppm), and TMS (0 ppm) or chloroform (7.25 ppm) as reference standards. When multiple peaks appear, the following abbreviations will be used: s (singlet), d (doublet), t (triplet), m (multiplet), br (broadened), dd (doublet of doublets), dt (doublet of triplets), br.s (broadened singlet), q (quadruplet). Coupling constant J, unit is Hertz (Hz).

[0076] Low-resolution mass spectrometry (MS) data were determined by an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature was maintained at 30 °C). A G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was applied to the LC-MS spectrometer.

[0077] High-resolution mass spectrometry (MS) data were determined by an Agilent 6130 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature was maintained at 30 °C). A G1329A autosampler and a G1315D DAD detector were used for analysis, and an ESI source was applied to the HR-MS spectrometer.

[0078] The following abbreviations are used throughout this invention:

[0079] DCM Dichloromethane DMTrCl 4,4'-Bismethoxytrityl chloride TFA Trifluoroacetic acid TFA Trifluoroacetic acid

[0080] Py Pyridine i-Pr Isopropyl

[0081] PE Petroleum ether EA Ethyl acetate

[0082] TBAF Tetrabutylammonium fluoride in tetrahydrofuran HOBT 1-Hydroxybenzotriazole

[0083] ACN Acetonitrile DMAP 4-Dimethylaminopyridine

[0084] Ac2O Acetic anhydride MsCl Methanesulfonyl chloride

[0085] Boc tert-Butyloxycarbonyl TMSOTf Trimethylsilyl trifluoromethanesulfonate MeOH Methanol THF Tetrahydrofuran

[0086] DMSO dimethyl sulfoxide mL milliliter

[0087] DMF N,N-Dimethylformamide min minutes

[0088] DCM dichloromethane M,N,mol / L mole / liter DIPEA N,N-Diisopropylethylamine h hours

[0089] TiPDSCl2 1,3-Dichloro-1,1,3,3-tetraisopropyldisiloxane RT, rt Room temperature

[0090] HBTU Benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate DETAILED DESCRIPTION

[0091] The scheme of the present invention will be explained below in conjunction with the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. In particular, the synthesis of small nucleic acids such as ASOs and the synthesis of small nucleic acid conjugates can be synthesized according to the embodiments of the present invention or the conventional adjustments in the art. If the specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0092] Preparation Example

[0093] In the following preparation examples, the inventors describe in detail the preparation process of the compounds of the present invention by taking some of the compounds of the present invention as examples, wherein: For CPG.

[0094] Synthesis of compound DAW40007-3

[0095]

[0096] Step 1: Synthesis of compound 2-2

[0097] Compound 2-1 (2.50 g, 28.05 mmol) and triethylamine (7.8 mL, 56.1 mmol) were dissolved in DCM (120 mL), and benzyl chloroformate (9.57 g, 56.1 mmol) was added dropwise at 0°C. After the addition, the reaction mixture was heated to room temperature and stirred for 20 h, and saturated ammonium chloride solution (50 mL) was added for dilution, the liquids were separated, the aqueous phase was discarded, the organic phase was concentrated, and the residue was purified by silica gel column chromatography (MeOH / DCM (V / V) = 1 / 30) to obtain white solid compound 2-2 (2.96 g, 47.2%).

[0098] MS (ESI, pos.ion) m / z: 224.2 [M+H] + ;

[0099] 1 H NMR(400MHz, CDCl3)δ7.37(d,J=4.2Hz,5H),5.11(s,2H),5.00(s,1H),4.19–4.14(m,1H),3.70–3.64(m, 2H), 3.24 (t, J=6.4Hz, 2H), 3.15 (q, J=4.6Hz, 1H), 1.90 (dq, J=14.2, 5.0, 4.3Hz, 2H), 1.77–1.71 (m, 1H).

[0100] Step 2: Synthesis of Compound 2-4

[0101] Compound 2-3 (1.5 g, 4.56 mmol) and compound 2-2 (1.22 g, 5.47 mmol) were dissolved in 1,2-dichloroethane (30 mL), and 3A molecular sieves (2.0 g) were added and stirred at room temperature for 10 min. TMSOTf (0.51 g, 2.28 mmol) was added and the reaction mixture was stirred at room temperature for 18 h. The reaction solution was poured into a saturated sodium bicarbonate solution (100 mL), then extracted with DCM (100 mL), washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 2 / 1 to 0 / 1) to obtain a light brown oil compound 2-4 (1.8 g, 71.51%). MS (ESI, pos.ion) m / z: 553.3 [M+H] + .

[0102] Step 3: Synthesis of Compound 2-5

[0103] Compound 2-4 (0.57 g, 1.03 mmol) and palladium carbon (0.11 g, 0.1 mmol, 10%) were added to THF (10 mL), and then TFA (0.12 g, 1.03 mmol) was added, followed by hydrogen replacement three times, and then stirred at room temperature for 19 h in a hydrogen atmosphere. After the reaction was completed, diatomaceous earth was filtered, and the solvent was evaporated under reduced pressure to obtain a light brown oily compound 2-5 (0.55 g, 100.32%). MS (ESI, pos.ion) m / z: 419.3 [M-TFA+H] + .

[0104] Step 4: Synthesis of Compound 2-7

[0105] Compound 2-6 (0.46 g, 2.29 mmol, purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd.) and compound 2-5 (1.16 g, 2.18 mmol) were dissolved in DCM (30 mL), and HOBT (0.46 g, 3.44 mmol), HBTU (1.30 g, 3.44 mmol) and DIPEA (2.66 mL, 16.03 mmol) were added in sequence, and the reaction mixture was reacted at room temperature for 16 h. After the reaction, water (20 mL) and DCM (50 mL × 2) were added in sequence, and the organic phase was washed with saturated sodium bicarbonate solution (30 mL) and saturated brine (20 mL) in sequence, and the solvent was evaporated under reduced pressure. The residue was separated and purified by silica gel column chromatography (MeOH / EA (v / v) = 1 / 20) to obtain a white solid 2-7 (1.0 g, yield 72.7%).

[0106] MS (ESI, pos.ion) m / z: 602.3 [M+H] + ;

[0107] 1 H NMR (400MHz, CD3OD) δ5.39–5.33(m,1H),5.07(dd,J=11.2,3.4Hz,1H),4.58(d,J= 8.4Hz,1H),4.21–4.09(m,3H),4.04(t,J=6.7Hz,1H),3.89(dt,J=10.4,5.1Hz,1H ),3.60–3.50(m,1H),3.30–3.13(m,2H),2.16(s,3H),2.04(s,3H),1.97(s,3H),1 .94(s,3H),1.67–1.56(m,4H),1.48(s,9H),1.41–1.37(m,2H),1.02–0.98(m,2H).

[0108] Step 5: Synthesis of Compound 2-8

[0109] Compound 2-7 (0.72 g, 1.17 mmol) was dissolved in DCM (8 mL), and then TFA (0.87 mL, 11.7 mmol) was added. The reaction mixture was stirred at 25 °C for 16 h, and the solvent was concentrated to give brown oily compound 2-8 (0.74 g, 103.1%).

[0110] MS (ESI, pos.ion) m / z: 502.2 [M+H] + ;

[0111] 1 H NMR (400MHz, CD3OD) δ5.36 (d, J=3.3Hz, 1H), 5.08 (dd, J=11.3, 3.3Hz, 1H), 4.5 8(d,J=8.4Hz,1H),4.16–4.10(m,3H),4.08–4.02(m,1H),3.92–3.85(m,1H),3 .58–3.50(m,1H),3.26–3.20(m,2H),2.16(s,3H),2.04(d,J=5.2Hz,6H),1.98 (s,3H),1.97(s,3H),1.61–1.56(m,4H),1.54–1.52(m,2H),1.42–1.38(m,2H).

[0112] Step 6: Synthesis of Compound 2-10

[0113] Compound 2-9 (0.19 g, 0.30 mmol) and compound 2-8 (0.50 g, 0.99 mmol) were dissolved in DCM (30 mL), and then HOBT (0.17 g, 1.26 mmol), HBTU (0.48 g, 1.26 mmol) and DIPEA (0.5 mL, 3.0 mmol) were added in sequence, and the reaction mixture was stirred at 30 ° C for 3 h. After the reaction was completed, water (20 mL) was added to quench the reaction, and then extracted with DCM (100 mL × 2), and the organic phases were combined, and the organic phases were washed with saturated sodium bicarbonate solution (40 mL) and saturated sodium chloride solution (40 mL) in sequence, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was separated and purified by silica gel column chromatography (DCM / MeOH (v / v) = 10 / 1) to obtain white solid compound 2-10 (0.23 g, yield 37%). MS(ESI,pos.ion)m / z:1046.3[M / 2+H] + ;

[0114] 1H NMR (400MHz, CD3OD) δ7.78(t,J=5.8Hz,2H),7.38–7.36(m,3H),5.36(d,J=3.4Hz,3H),5.13(s,2H),5.08(dd,J=11.2, 3.4Hz,3H),4.58(d,J=8.4Hz,3H),4.21–4.08(m,9H),4.04(t,J=6.7Hz,3H),3.93–3.82(m,3H),3.73–3.66(m,12H),3. 60–3.52(m,3H),3.29–3.18(m,6H),2.52(t,J=6.0Hz,6H),2.38(t,J=7.4Hz,2H),2.20(t,J=7.7Hz,2H),2.16(s,9H), 2.04(s,9H),1.97(s,9H),1.95(s,9H),1.62–1.56(m,12H),1.50–1.42(m,6H),1.35–1.27(m,16H),1.04–0.97(m,6H).

[0115] Step 7: Synthesis of Compound 2-11

[0116] Compound 2-10 (0.20 g, 0.094 mmol) was dissolved in methanol (10 mL), and then Pd / C (10 mg, 10%) was added, and hydrogen was replaced three times. The reaction mixture was stirred at room temperature for 11 h in a hydrogen atmosphere. After the reaction was completed, the reaction mixture was filtered through diatomaceous earth, and the obtained filtrate was evaporated under reduced pressure to dry the solvent to obtain a white solid compound 2-11 (0.19 g, 100%).

[0117] MS(ESI,pos.ion)m / z:1001.1[M / 2+H] + .

[0118] Step 8: Synthesis of compound DAW40007-1

[0119] Compound 2-11 (0.28 g, 0.14 mmol) was dissolved in DCM (20 mL), and HOBT (0.038 g, 0.28 mmol), HBTU (0.080 g, 0.21 mmol), DIPEA (0.054 g, 0.42 mmol) and compound 13 (0.068 g, 0.16 mmol) were added in sequence. The reaction mixture was stirred at room temperature for 13 h. After the reaction was completed, water (10 mL) was added to quench the reaction, and the mixture was extracted with DCM (20 mL). The organic phase was washed with saturated sodium bicarbonate solution (10 mL) and the mixture was heated to 40 ℃. The solvent was evaporated, and the obtained residue was dissolved in acetonitrile (10 mL), and separated by reverse phase preparative column (acetonitrile / water solution (v / v) = 43% to 60%, 50 min). Salt was added to the solution containing the product after preparative separation to saturate the solution, and the organic phase was separated. The aqueous phase was extracted with acetonitrile (100 mL×2), and the organic phases were combined. The combined organic phases were dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. Acetonitrile (30 mL) was added to the residue, and it was dried over sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a light yellow solid compound DAW40007-1 (0.080 g, yield 24%).

[0120] MS(ESI,neg.ion)m / z:2400.18[MH] - ;

[0121] 1H NMR (400MHz, DMSO-d6) δ8.31 (s, 3H), 7.81 (d, J = 9.2Hz, 3H), 7.57 (t, J = 6.0 Hz,3H),7.35–7.26(m,4H),7.20(td,J=8.9,3.0Hz,5H),6.95(s,1H),6.88( ddd,J=8.8,5.8,2.2Hz,4H),5.22(d,J=3.4Hz,3H),4.97(dd,J=11.2,3.5H z,4H),4.49(d,J=8.5Hz,3H),4.40(d,J=4.8Hz,1H),4.15(s,1H),4.07–4.0 0(m,9H),3.88(dt,J=11.2,8.8Hz,3H),3.74(s,9H),3.59–3.48(m,12H),3 .17(dd,J=8.8,5.0Hz,1H),3.10–2.95(m,8H),2.35(t,J=6.3Hz,6H),2.10( s,9H),2.08(s,3H),2.04(d,J=4.7Hz,2H),2.00(s,9H),1.89(s,9H),1.78( s,9H),1.40(d,J=12.2Hz,17H),1.31–1.16(m,18H),0.79(q,J=3.2Hz,6H).

[0122] Step 9: Synthesis of compound DAW40007-2

[0123] Compound DAW40007-1 (0.080 g, 0.033 mmol) was dissolved in DCM (10 mL), and DIPEA (0.029 mL, 0.17 mmol), succinic anhydride (0.008 g, 0.083 mmol) and DMAP (0.014 g, 0.12 mmol) were added. The mixture was stirred at 40 °C for 5 h, and succinic anhydride (10 mg) was added. After the reaction was continued for 16 h, DCM (10 mL), succinic anhydride (10 mg) and DIPEA (0.05 mL) were added. The mixture was stirred for another 9 h, and then succinic anhydride (10 mg) was added. After the reaction was continued for another 10 h, DCM (20 mL) was added for dilution, and the mixture was washed with saturated sodium bicarbonate solution (10 mL). The aqueous phase was discarded, and the organic phase was dried over anhydrous sodium sulfate. The solvent was concentrated under reduced pressure to obtain a white solid compound DAW40007-2 (0.08 g, 96.07%). MS(ESI,neg.ion)m / z:2500.12[MH] - .

[0124] Step 10: Synthesis of compound DAW40007-3

[0125] Compound DAW40007-2 (0.08 g, 0.032 mmol), HBTU (0.015 g, 0.04 mmol) and DIPEA (0.011 mL, 0.064 mmol) were dissolved in ACN (5 mL) and stirred at room temperature for 5 min. The mixture was then transferred to a solid phase synthesizer containing 0.35 g H2N-CPG (purchased from Hebei Dinaxingke) and shaken for 22.5 h. The filter cake was filtered, rinsed with DCM / MeOH (V / V=9 / 1, 10 mL) and DCM (10 mL), and dried under reduced pressure to obtain a white solid DAW40007-3 (0.357 g) with a measured loading of 14.95 μmol / g.

[0126] DAW40007-3 was linked to the ASO sequence and then deprotected to obtain an ASO conjugate in which the DAW40007-4 group was linked to the ASO sequence. Synthesis of compound L96-DMTr-CPG

[0127]

[0128] The compound L96-DMTr-CPG was prepared according to the method described in patent application WO2014025805A1, and was connected to the ASO sequence and then deprotected to obtain an ASO conjugate in which ASO and L96 were connected.

[0129] The synthesis method of the antisense oligonucleotide (ASO) of the present invention

[0130] The synthesis was completed according to the theoretical yield of 1 μmol. Weigh 1 μmol of solid support CPG (purchased from Hebei Dinaxingke). All DNA phosphoramidite monomers, 2'-modified RNA phosphoramidite monomers and auxiliary reagents are commercially available. All phosphoramidite monomers are provided in 0.1M anhydrous acetonitrile solution. For oligonucleotides with phosphate backbone thiolation modification, 0.1M DDTT solution is used as the thiolation reagent. 5-Ethylthio-1H-tetrazole acetonitrile solution (0.25M) is used as an activator (purchased from Suzhou Kelema), and 3% trichloroacetic acid in dichloromethane is used as a deprotection reagent, which are placed in the designated reagent position corresponding to the DNA / RNA automatic synthesizer. Set the synthesis program and enter the specified oligonucleotide base sequence. After checking that everything is correct, start the cyclic oligonucleotide synthesis. The coupling time for each step is 6 minutes, and the thiolation time is 6 minutes. After automatic circulation, an oligonucleotide containing solid support CPG is obtained.

[0131] The nucleotide containing CPG on the solid support obtained above was blown dry with dry argon, then transferred to a 2mL EP tube, and 28% ammonia solution (0.8mL) was added and heated at 55°C for 5 to 18 hours. Filter, wash the filter cake with water (0.5mL), combine the filtrate, and concentrate under reduced pressure to obtain a white or yellow colloidal solid. After reverse phase preparation and purification, the preparation solution was concentrated, passed through a gel column, and excess salt was removed to obtain an oligonucleotide. The concentration of the obtained oligonucleotide was determined by a micro-ultraviolet spectrophotometer (SPECTRO statNano). Mass spectrometry detection and analysis were completed on the Agilent 6530LC-MS Q-Tof system. After primary scanning, the molecular weight of the nucleic acid was calculated after deconvolution. The above method can be appropriately adjusted in combination with the synthesis method known in the art, and the oligonucleotide of the present invention can be synthesized. Some of the synthesized oligonucleotides are shown in Table 2.

[0132] The above oligonucleotide synthesis scheme lists the general experimental steps for preparing the oligonucleotides of the present invention. Those skilled in the art can make appropriate method modifications or raw material adjustments according to actual conditions to prepare the antisense oligonucleotides of the present invention. Unless otherwise specified, the oligonucleotides of the present invention can be prepared by the method described in the above synthesis scheme.

[0133] Table 2: Antisense oligonucleotides synthesized in part of the present invention

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142] Note: In Table 2, the capital letters A, U, T, G, and C followed by e represent nucleosides whose ribose is replaced by 2'-MOE (i.e., 2'-O-methoxyethyl), such as Ae represents adenine nucleoside (adenosine) modified by 2'-MOE ribose, Ue represents uridine nucleoside modified by 2'-MOE ribose, Te represents thymidine nucleoside (thymidine) modified by 2'-MOE ribose, and Ge represents The guanosine nucleoside (guanosine) of the present invention is represented by Ce, which represents 2'-MOE ribose-modified cytosine nucleoside (cytidine); the capital letters A, T, G, and C followed by d represent deoxynucleosides, such as Ad represents adenine deoxynucleoside, Td represents thymidine deoxynucleoside, Gd represents guanine deoxynucleoside, and Cd represents cytosine deoxynucleoside; mC represents 5-methyl-modified cytosine nucleoside; s represents ps modification (phosphorothioate group).

[0143] Example 4 Test of the cell inhibitory activity and cytotoxicity of the antisense oligonucleotides of the present invention against HBV

[0144] Cell viability screening

[0145] HepAD38 or hepG2.2.15 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), transfection was performed using a transfection reagent. The cell concentration was adjusted and 2×10 cells were seeded into each well of a 96-well plate. 4 or 2.25 × 10 4 Cells were transfected with different ASOs according to the instructions of RNAiMAX transfection reagent (Invitrogen), and then incubated for 72 hours at 37°C and 5% CO2, and HBsAg expression and cytotoxicity were detected using HBsAg Elisa kit and CCK8. The experimental results of the HBsAg inhibition rate and cytotoxicity of the ASO of the present invention are shown in Table A. The experiment shows that most of the ASO drugs of the present invention have a good inhibition rate on HBV and low cytotoxicity.

[0146] Table A: Experimental results of HBsAg inhibition rate and cytotoxicity of ASO of the present invention

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] Note: The ASO drug of the present invention was divided into seven batches for cell activity and cytotoxicity tests, and each batch was compared with a positive drug.

[0157] Although the present invention has been described in detail above by means of general description, specific implementation methods and tests, it is obvious to those skilled in the art that some modifications or improvements may be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A modified antisense oligonucleotide having a structure shown in formula (I): 5'-XYZ-3' (I) in, X is composed of 1-14 linked nucleotides; Y is composed of 5 to 15 linked deoxynucleotides; Z is composed of 1-14 linked nucleotides; and the antisense oligonucleotide comprises one of the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 25, and the antisense oligonucleotide is 12 to 20 nucleotides in length.

2. The antisense oligonucleotide according to claim 1, wherein All nucleosides in X and Z contain a 2'-O-methoxyethyl sugar.

3. The antisense oligonucleotide according to claim 1 or 2, wherein all the internucleoside bonds in the antisense oligonucleotide are phosphorothioate bonds.

4. The antisense oligonucleotide according to claim 1, wherein all cytosines in the antisense oligonucleotide are independently or optionally 5-methyl-modified cytosines, and preferably, all cytosines in the antisense oligonucleotide are 5-methyl-modified cytosines. The antisense oligonucleotide according to claim 1 , comprising one of the nucleotide sequences shown in SEQ ID NO: 26 to SEQ ID NO:

372.

6. The antisense oligonucleotide according to claim 1, optionally comprising a delivery vehicle portion, preferably, the delivery vehicle portion comprises an ASGP-R targeting portion or a cholesterol conjugate portion, preferably, the 3' end or 5' end of the antisense oligonucleotide is connected to the ASGP-R targeting portion via a phosphate group, a thiophosphate group or a phosphate group.

7. The antisense oligonucleotide according to claim 6, wherein the ASGP-R targeting moiety comprises GalNAc or a derivative thereof; preferably, the ASGP-R targeting moiety comprises GalNAc or a derivative thereof connected by a divalent or trivalent branched linker; more preferably, the ASGP-R targeting moiety is L-96 or DAW40007-4, wherein The structures of L-96 and DAW40007-4 are:

8. A composition comprising the antisense oligonucleotide or a salt thereof according to any one of claims 1 to 7, and at least one of a pharmaceutically acceptable excipient and a diluent.

9. Use of the antisense oligonucleotide of any one of claims 1-7 or the composition of claim 8 in the preparation of a medicament for treating an HBV-related disease, disorder or condition in a subject, wherein the disease, disorder or condition is jaundice, liver fibrosis, hepatitis, cirrhosis, serum hepatitis, liver failure, liver cancer, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, HBV viremia or transplantation associated with liver disease.

10. Use of the antisense oligonucleotide according to any one of claims 1 to 7 or the composition according to claim 8 in the preparation of a medicament for reducing the level of HBsAG in a subject infected with HBV.

Images