Use of a substance that reduces the amount or activity of ploD2 protein in the treatment of sarcomatoid renal cell carcinoma
By knocking out or inhibiting PLOD2 gene expression and reducing PLOD2 protein content, sarcomatoid renal cell carcinoma is induced to differentiate into epithelioid renal cell carcinoma, solving the problem of refractory sarcomatoid renal cell carcinoma and achieving tumor growth inhibition and improved sensitivity to traditional treatments.
Patent Information
- Application Number
- CN202510029315.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-08
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2045-01-08
AI Technical Summary
Sarcomatoid renal cell carcinoma (sRCC) is a rare, highly malignant, and refractory type of renal cell carcinoma. Current treatment options are limited, patients have short survival times, and there is a lack of effective molecular markers and imaging diagnostic tools. Traditional treatments have little effect on it, and new treatment strategies are urgently needed.
By knocking out or inhibiting PLOD2 gene expression, reducing PLOD2 protein content or activity, and using substances such as the CRISPR/Cas9 system or PLOD2 antibodies, sarcomatoid renal cell carcinoma can be induced to differentiate into well-differentiated epithelioid renal cell carcinoma. Combined with traditional renal cell carcinoma therapies such as axitinib and doxorubicin, treatment sensitivity can be improved.
Inducing poorly differentiated, highly malignant sarcomatoid renal cell carcinoma to differentiate into well-differentiated, poorly malignant epithelioid renal cell carcinoma directly inhibits tumor growth and metastasis, improves the sensitivity of traditional treatments, provides a new treatment strategy, and significantly improves patient survival.
Smart Images

Figure BDA0005233690700000091 
Figure BDA0005233690700000101 
Figure BDA0005233690700000102
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedicine, and particularly relates to application of a substance reducing PLOD2 protein content or activity in treatment of sarcomatoid renal cell carcinoma. BACKGROUND
[0002] Sarcomatoid renal cell carcinoma (sRCC) is a rare, poorly differentiated, highly malignant and extremely refractory subtype of renal cell carcinoma. Its incidence accounts for about 4-5% of all renal cell carcinomas. Due to low incidence and limited research, there is no specific molecular marker to date, and the pathogenesis is poorly understood. Due to the lack of effective imaging diagnostic tools, current clinical diagnosis almost completely relies on postoperative histomorphological pathological detection, and the effective rate of preoperative biopsy is only about 7.5%.
[0003] sRCC is extremely malignant, progresses rapidly and is prone to metastasis. There is no clear and effective treatment method at present. The traditional renal cancer treatment methods (surgery, systemic drugs) have very limited effect on sRCC, and the survival time of most patients is less than 1 year. The survival time of more than 1 year is usually only seen in early sRCC patients. However, even in early localized sRCC, about 80% of patients will relapse within 2 years after surgery. For decades, the survival rate of sRCC patients has hardly improved, and new treatment strategies are urgently needed. In contrast, non-sarcomatoid (or epithelioid) renal cell carcinoma (non-sRCC / epithelioid RCC) patients have significantly better efficacy, and about 90% of early patients can be cured without recurrence in five years after surgery.
[0004] sRCC tissue is usually composed of sarcomatoid and non-sarcomatoid (epithelioid) malignant cell components. According to the 2016 WHO guidelines, renal cell carcinoma containing any amount of sarcomatoid features can be diagnosed as sRCC. The current mainstream "common progenitor cell theory" considers that the sarcomatoid tumor cells in sRCC originate from pre-existing well-differentiated epithelioid cells, which gradually transform into sRCC cells through sarcomatoid dedifferentiation. Sarcomatoid dedifferentiation can occur in most subtypes of renal cell carcinoma, but sarcomatoid clear cell renal cell carcinoma (sccRCC) is the most common subtype due to the high proportion of clear cell renal cell carcinoma (ccRCC) in RCC, which accounts for up to 75%.
[0005] Sarcomatoid dedifferentiation is the direct cause of sRCC occurrence and the fundamental reason for the significantly lower prognosis of sRCC patients than non-sarcomatoid RCC. The higher the content of sarcomatoid component, the greater the risk of death of the patient. According to statistics, the risk of death of the patient will increase by about 6% for every 10% increase in the content of sarcomatoid component.
[0006] Cellular plasticity enables cells to switch between different states, acquire new phenotypic and functional characteristics, and thus facilitates tumorigenesis, progression, metastasis and treatment resistance. Cells achieve their plasticity through de-differentiation (within the same lineage), trans-differentiation (lineage switching) and epithelial-mesenchymal transition (EMT). Targeting tumor plasticity, such as inducing differentiation in poorly differentiated tumors, has been considered as an important strategy for cancer treatment, and has achieved remarkable success in the clinical treatment of hematological cancers. Acute promyelocytic leukemia (APL) uses retinoic acid to induce differentiation, which differentiates APL cells into terminally differentiated granulocytes, and is a typical success case of this strategy. In the clinic, the combination of retinoic acid and arsenic agents can cure more than 90% of APL patients, and even critically ill patients can achieve long-term survival through all-trans retinoic acid treatment. In contrast, differentiation induction in solid tumors is much more complex and challenging than leukemia, and there are few successful cases. SUMMARY
[0007] The technical problem to be solved by the present application is how to treat sarcomatoid renal cell carcinoma.
[0008] To solve the above technical problems, the present application first provides any of the following applications:
[0009] 1. The use of a substance that knocks out or inhibits the expression of PLOD2 gene in the preparation of a product for treating sarcomatoid renal cell carcinoma;
[0010] 2. The use of a substance that knocks out or inhibits the expression of PLOD2 gene in the treatment of sarcomatoid renal cell carcinoma;
[0011] 3. The use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for treating sarcomatoid renal cell carcinoma;
[0012] 4. The use of a substance that reduces the content or activity of PLOD2 protein in the treatment of sarcomatoid renal cell carcinoma;
[0013] 5. The use of a substance that knocks out or inhibits the expression of PLOD2 gene in the preparation of a product for treating poorly differentiated renal cell carcinoma;
[0014] 6. The use of a substance that knocks out or inhibits the expression of PLOD2 gene in the treatment of poorly differentiated renal cell carcinoma;
[0015] 7. The use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for treating poorly differentiated renal cell carcinoma;
[0016] 8. The use of a substance that reduces the content or activity of PLOD2 protein in the treatment of poorly differentiated renal cell carcinoma;
[0017] 9. Use of a substance that knocks out or inhibits the expression of PLOD2 gene in improving the sensitivity of a renal cell carcinoma treatment drug.
[0018] 10. Use of a substance that knocks out or inhibits the expression of PLOD2 gene in the preparation of a product for improving the sensitivity of a renal cell carcinoma treatment drug.
[0019] 11. Use of a substance that reduces the content or activity of PLOD2 protein in improving the sensitivity of a renal cell carcinoma treatment drug.
[0020] 12. Use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for improving the sensitivity of a renal cell carcinoma treatment drug.
[0021] In the above uses, the treatment of sarcomatoid renal cell carcinoma can be embodied in any one of X1) to X5):
[0022] X1) inhibiting the tumor growth of sarcomatoid renal cell carcinoma;
[0023] X2) inducing the transformation of sarcomatoid renal cell carcinoma tissue into epithelioid renal cell carcinoma tissue;
[0024] X3) inducing the transformation of sarcomatoid renal cell carcinoma cells into epithelioid renal cell carcinoma cells;
[0025] X4) reducing the cancer stemness of sarcomatoid renal cell carcinoma;
[0026] X5) inducing the mesenchymal-epithelial transition (MET) of renal cell carcinoma cells.
[0027] In the above uses, the renal cell carcinoma treatment drug can be axitinib, doxorubicin, gemcitabine, IFN-α, everolimus or an anti-angiogenic drug.
[0028] In the above uses, the substance that reduces the content or activity of PLOD2 protein can be any substance that can specifically reduce the content or activity of PLOD2 protein, such as a PLOD2 antibody, a PLOD2 protein inhibitor, etc. In an embodiment of the present application, the substance that reduces the content or activity of PLOD2 protein is minoxidil.
[0029] The substance for knocking out the PLOD2 gene or inhibiting the expression of the PLOD2 gene can be a substance for editing the PLOD2 gene, such as a substance specifically recognizing the PLOD2 gene in a common gene editing system. In an embodiment of the present application, the gene editing system is a CRISPR / Cas9 system, and the substance specifically recognizing the PLOD2 gene is an sgRNA targeting the PLOD2 gene. In an embodiment of the present application, the target sequence of the sgRNA is 5'-ATATTTCAATTATACTGTGA-3' (SEQ ID No. 3); 5'-GTAGCAACAAAAGAAAGTGA-3' (SEQ ID No. 4); 5'-GTTGTGGCTGAGAAGATGAG-3' (SEQ ID No. 5).
[0030] The substance for knocking out the PLOD2 gene or inhibiting the expression of the PLOD2 gene can also change the expression amount of the PLOD2 gene by affecting the upstream or downstream signal of the PLOD2 gene, such as regulating the activity of a transcription factor, and can also reduce the expression amount of the PLOD2 gene by RNA interference (RNAi) and the like.
[0031] The present application also provides a product containing Y1):
[0032] Y1) the substance for knocking out the PLOD2 gene or inhibiting the expression of the PLOD2 gene or the substance for reducing the content or activity of the PLOD2 protein.
[0033] The product can also contain Y2) a renal cell carcinoma treatment drug.
[0034] The product can be (or the active ingredient thereof can be) Y1) described above. The product can also be (or the active ingredient thereof can be) Y1) and Y2) described above.
[0035] When the product does not contain Y2), it can be used as a sensitizer for a renal cell carcinoma treatment drug (such as axitinib, doxorubicin, gemcitabine, IFN-α, everolimus or an anti-angiogenic drug), and can also be a drug for treating renal cell carcinoma. When the product contains Y1) and Y2), it can be a drug for treating renal cell carcinoma.
[0036] The present application also provides a renal cell carcinoma treatment drug sensitizer containing (or the active ingredient thereof can be) the substance for knocking out the PLOD2 gene or inhibiting the expression of the PLOD2 gene or the substance for reducing the content or activity of the PLOD2 protein.
[0037] In the present application, the renal cell carcinoma can be, but is not limited to, renal clear cell carcinoma, chromophobe renal cell carcinoma, and papillary renal cell carcinoma.
[0038] The present application finds that by inhibiting the expression / activity of PLOD2 in sarcomatoid renal cell carcinoma, the sarcomatoid renal cell carcinoma with low differentiation, high malignancy and high treatment resistance can be induced to differentiate into epithelioid renal cell carcinoma with high differentiation, low malignancy and high treatment sensitivity, thereby achieving the treatment purpose. The present application can be used for the treatment of sarcomatoid renal cell carcinoma alone, directly inhibiting tumor growth and metastasis, and can also be used in combination with traditional renal cancer treatment (axitinib, doxorubicin, gemcitabine, IFN-alpha, everolimus or anti-angiogenic drugs, etc.) to improve the sensitivity to traditional renal cancer treatment. There is no clear and effective treatment for sarcomatoid renal cell carcinoma at present, and the survival period of most patients is less than 1 year. The present application provides a new treatment strategy and intervention target for sarcomatoid renal cell carcinoma patients, and has important clinical application prospect.
[0039] The present application will be further described in detail below in combination with specific embodiments. The embodiments given below are only for illustrating the present application, and are not intended to limit the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the present application in any way. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 . Schematic diagram of multi-omics screening of potential driving factors of sarcomatoid dedifferentiation in ccRCC, based on the three major characteristics of sarcomatoid dedifferentiation ccRCC patients.
[0041] Figure 2 . Comparison of the expression of PLOD family members in normal tissues and tumor tissues, and showing their relationship with the prognosis in TCGA ccRCC cohort. OS: overall survival.
[0042] Figure 3 . Sarcomatoid renal cell carcinoma cell transcriptome sequencing shows the expression of other 6 candidate factors before and after PLOD2 knockout.
[0043] Figure 4 . Western blot detection results of PLOD2 expression in each cell line.
[0044] Figure 5 . Expression of PLOD2 in clinical sample data in TCGA and CPTAC databases. PLOD2 protein represents the content of PLOD2 protein.
[0045] Figure 6 . Verification results of clinical sample immunohistochemistry. H-score of PLOD2 represents the PLOD2 content score.
[0046] Figure 7PLOD2 expression in sarcomatoid and non-sarcomatoid components. H-score of PLOD2 indicates PLOD2 content score.
[0047] Figure 8 PLOD2 expression in sarcomatoid and non-sarcomatoid components in patient 1. The upper panel is HE staining result, and the lower panel is immunohistochemical staining to detect PLOD2 expression.
[0048] Figure 9 PLOD2 expression in sarcomatoid and non-sarcomatoid components in patient 2. The upper panel is HE staining result, and the lower panel is immunohistochemical staining to detect PLOD2 expression.
[0049] Figure 10 PLOD2 expression in sarcomatoid and non-sarcomatoid components in patient 3. The upper panel is HE staining result, and the lower panel is immunohistochemical staining to detect PLOD2 expression.
[0050] Figure 11 PLOD2 expression in sarcomatoid, non-sarcomatoid and transition regions in 3 sRCC patients. H-score of PLOD2 indicates PLOD2 content score.
[0051] Figure 12 PLOD2 knockout leads to sRCC cell differentiation into epithelioid.
[0052] Figure 13 TCGA analysis shows PLOD2 expression in sarcomatoid and non-sarcomatoid chromophobe renal cell carcinoma.
[0053] Figure 14PLOD2 drives sarcomatoid dedifferentiation of ccRCC. (A) Western blot and RT-qPCR show the effect of PLOD2 overexpression on the expression of stemness markers (DCLK1, CD44, ALDH1A1, and beta-catenin) and epithelial markers (CD10, CA9, and MUC1) in 769-P eccRCC cells. (B) Flow cytometry to assess the proportion of SP cells in control and PLOD2-overexpressing 769-P eccRCC cells, with and without verapamil treatment, using Hoechst 33342 staining. Gated cells in the plot represent SP cells. (C) Flow cytometry to measure ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in control and PLOD2-overexpressing 769-P eccRCC cells. (D) Western blot and RT-qPCR show the effect of PLOD2 overexpression on the expression of EMT markers in 769-P eccRCC cells. Control in A-D is the epithelial-like ccRCC cell line 769-P. (E) Western blot and RT-qPCR to analyze the effect of PLOD2 knockout on cancer cell stemness and epithelial differentiation markers in 786-0 sccRCC cells. (F) Flow cytometry to assess the proportion of SP cells in control and PLOD2-depleted 786-0 sccRCC cells, with and without verapamil treatment, using Hoechst 33342 staining. (G) Flow cytometry to measure ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in control and PLOD2-depleted 786-0 sccRCC cells. (H) Immunofluorescence staining to analyze stemness markers (DCLK1 and ALDH1A1) and epithelial differentiation markers (CA9 and AQP1) in control and PLOD2-depleted 786-0 sccRCC cells. (I) Western blot and RT-qPCR to assess the expression of EMT markers in control and PLOD2-depleted 786-0 sccRCC cells. (J) Immunofluorescence staining to analyze EMT markers in control and PLOD2-depleted 786-0 sccRCC cells. (K) Heatmap of RNA-seq data showing the effect of PLOD2 depletion on cancer cell stemness, epithelial differentiation, and EMT markers in 786-0 sccRCC cells. Control in E-K is the sarcomatoid renal cell carcinoma cell 786-0. Data are presented as mean ± s.d. Statistical analysis by unpaired two-tailed Student’s t-test [(A), (C), (D), (E), (G), and (I)].
[0054] Figure 15 Gene Ontology (GO) analysis of genes altered by PLOD2 depletion revealed significant enrichment in processes related to sRCC biology.
[0055] Figure 16 Potential association of PLOD2 with sarcomatoid dedifferentiation in chromophobe RCC. (A) TCGA analysis showing PLOD2 expression in sarcomatoid and non-sarcomatoid chromophobe RCC. (B) Correlation between PLOD2 expression and mesenchymal features (defined with mesenchymal markers Vimentin, Snail1 and ZEB1) in chromophobe RCC samples from TCGA. Data were analyzed by Pearson correlation test.
[0056] Figure 17 PLOD2 loss induces sccRCC differentiation and improves therapeutic response. (A) Representative images showing the effect of PLOD2 loss on epithelioid differentiation of 786-O-derived sccRCC nude mice xenografts by IHC, HE and Masson staining. (B) and (C) IHC staining analysis of epithelial differentiation, cancer cell stemness and EMT markers expression in control and PLOD2 loss sccRCC xenografts. (D) and (E) Correlation between PLOD2 expression and AQP1 and stemness markers in TCGA, CPTAC and GSE73731 ccRCC patients. (F) TCGA analysis showing the relationship between cancer cell dedifferentiation and tumor stage and overall survival in ccRCC patients. (G) Tumor growth curve of control and PLOD2 loss sccRCC xenografts. (H) IHC analysis showing Ki-67 expression in control and PLOD2 loss sccRCC nude mice xenografts. (I) Correlation between PLOD2 and Ki-67 in TCGA, CPTAC and GSE73731 ccRCC patients. (J) CCK8 analysis of the effect of PLOD2 loss on the sensitivity of 786-O sccRCC cells to doxorubicin, gemcitabine and IFN-a. (K) Evaluation of the effect of PLOD2 loss on sccRCC growth and sensitivity to axitinib treatment, comparing tumor growth curves and weight (n=5). Data in the graphs are expressed as mean ± standard deviation. Statistical analysis included Pearson correlation test [(D), (E) and (I)], Chi-square test (F, left), log-rank test (F, right), two-way ANOVA and Tukey’s test (K), or unpaired two-tailed Student’s t-test [(G) and (H)].
[0057] Figure 18Pharmacological targeting inhibitors of PLOD2, minoxidil, can induce sccRCC differentiation and enhance their sensitivity to treatment. (A-B) Western blot and RT-qPCR analysis of the effects of minoxidil treatment on cancer cell stemness, epithelial differentiation, and EMT in 786-0 sccRCC cells. (C) IHC analysis of the expression of epithelial differentiation markers CA9 and AQP1, cancer cell stemness markers ALDH1A1 and DCLK1, and EMT markers in minoxidil- and control-treated 786-0-derived sccRCC xenografts. (D) HE and IHC evaluation of the effects of minoxidil on tissue morphology of 786-0-derived sccRCC xenografts. In areas with more residual PLOD2, the tissue morphology is more sarcomatoid; while in areas with less residual PLOD2, the morphology is more epithelioid. (E) CCK8 assay to evaluate the effects of minoxidil combination therapy on sccRCC sensitivity to doxorubicin, gemcitabine, and IFN-a. The abscissa is the concentration of doxorubicin, gemcitabine, and IFN-a. (F) CompuSyn calculates the synergy index (CI), CI value <1 indicates synergy, CI value <0.1 indicates very strong synergy. (G) IHC analysis of the effects of minoxidil treatment on Ki-67 index of sccRCC xenografts. (H) Tumor growth curve and tumor weight measurement to evaluate the effects of minoxidil (6 mg / kg) on sccRCC xenograft growth and sensitivity to axitinib (5 mg / kg) treatment (n=4). Data in the figure are expressed as mean ± standard deviation. Statistical analysis includes unpaired two-tailed Student's t test [(A), (B), and (G)], or two-tailed one-way ANOVA and Tukey's test (H). DETAILED DESCRIPTION
[0058] The experimental methods in the following examples, if not otherwise specified, are routine methods, which are performed according to the techniques or conditions described in the literature in the art or according to the instructions of the products. The materials, reagents, instruments, etc. used in the following examples, if not otherwise specified, can be obtained from commercial channels. The quantitative tests in the following examples are all set up with at least three repeated experiments, and the results are taken as the average value.
[0059] Statistical analysis: Statistical analysis was performed using R (version 4.2.2) or GraphPad Prism (version 8.4.0), unless otherwise specified. In general, comparisons between two groups were made using two-sided Student’s t-test or Wilcoxon rank-sum test, and comparisons among multiple groups were made using one-way ANOVA test with Tukey’s post-hoc test. Chi-square test was used to compare categorical variables. Kaplan-Meier curves were plotted and differences were assessed by log-rank test using the “survival” and “survminer” R packages. Correlation analysis was performed by Pearson correlation coefficient. Data were presented as mean ± standard deviation (SD). A p-value less than 0.05 was considered statistically significant, and the symbols were indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
[0060] Immunohistochemistry (IHC) and multiplex fluorescent IHC:
[0061] Tumor tissues were fixed with 4% paraformaldehyde and then paraffin-embedded. Tissue sections were cut into 4 pm-thin slices for IHC analysis. First, the sections were deparaffinated in xylene for 30 min, followed by dehydration through a graded alcohol series for 5 min each. Antigen retrieval was accomplished by EDTA or citric acid treatment (ZSGB-BIO, China). Then, the sections were blocked with goat serum for 30 min at room temperature. Next, the sections were incubated with the following primary antibodies overnight at 4 °C: anti-PLOD2 antibody (1:200, Proteintech), anti-CA9 antibody (1:100, Proteintech), anti-AQP1 antibody (1:3000, Proteintech), anti-ALDH1A1 antibody (1:100, Proteintech), anti-DCLK1 antibody (1:300, Cell Signaling Technology), anti-E-cadherin antibody (1:100, Cell Signaling Technology), anti-ZO-1 antibody (1:100, Proteintech), anti-vimentin antibody (1:100, Cell Signaling Technology), anti-Snail antibody (1:100, Proteintech), or anti-Ki67 antibody (1:150, ZSGB-BIO). The signal was then amplified using enzyme-labeled goat anti-mouse or anti-rabbit IgG polymers (ZSGB-BIO, China). IHC staining was developed by DAB substrate (ZSGB-BIO, China) and observed under a light microscope (Olympus Corporation, Tokyo, Japan). IHC staining scores were determined using SlideViewer 2.8 software (3DHISTECH, Hungary).
[0062] For multiplex fluorescent IHC, patient samples were processed using 4-color manual IHC kit (Akoya, USA) following the manufacturer’s instructions. The primary antibodies used for primary staining were anti-human PLOD2 antibody (1:150, Proteintech) and anti-human DCLK1 antibody (1:100, Cell Signaling Technology). Nuclei were stained with DAPI (Solarbio, Beijing, China). Images were acquired by PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary) and exported using SlideViewer 2.8.
[0063] H&E staining and Masson’s trichrome staining:
[0064] In the H&E staining procedure, the sections were incubated in hematoxylin for 2 minutes, followed by a 3-minute counterstaining of the sections with eosin. Masson’s trichrome staining (Solarbio, Beijing, China) was performed according to the manufacturer’s instructions. Images were acquired by a biological microscope (Leica, Germany) and PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary).
[0065] Flow Cytometry:
[0066] Cells were resuspended in cold PBS containing 2% FBS at a density of 1 x 10Λ6 cells / mL. For the determination of ALDH1A1 expression, cells were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) for 15 min at room temperature. After fixation, cells were centrifuged at 3000 rpm for 5 min and the supernatant was discarded. Cells were permeabilized with 0.1% Triton X-100 (Beyotime Biotechnology, China) for 10 min at room temperature, followed by incubation with ALDH1A1 primary antibody (1:100, Proteintech, China) for 30 min at room temperature, and then incubated with a fluorescently labeled secondary antibody (1:100 dilution) for 30 min in the dark. To detect side population (SP) cells, cells were divided into two groups. One group was stained with Hoechst 33342 dye (KeyGEN BioTECH, China) at a concentration of 5 pg / ml for 90 min at 37°C with slight agitation. The other group of cells was pre-treated with 50 pM Verapamil (Glpbio, USA) for 20 min, and then stained with Hoechst dye for 90 min at 37°C. After washing twice with PBS containing 2% FBS, cells were stained with 7-aminoactinomycin D (7-AAD, BD Biosciences, USA) at a concentration of 2 pg / ml. The fluorescence at 450 and 670 nm was measured by flow cytometry (BD LSRFortessa, USA) to distinguish SP and non-side population (NSP) cells, and the data were analyzed by FlowJo software version 10.8.1 (BD Biosciences, USA).
[0067] Immunofluorescence Assay:
[0068] Immunofluorescence analysis used antibodies against DCLK1 (1 : 100, Cell Signaling Technology), ALDH1A1 (1 : 100, Proteintech), CA9 (1 : 100, Proteintech), AQP1 (1 : 100, Proteintech), ZO-1 (1 : 1000, Proteintech), Snail (1 : 250, Proteintech), and N-cadherin (1 : 500, Cell Signaling Technology). Experimental procedures were as follows: cells were seeded at a density of 2 x 10^4 per well in 24-well plates and adhered for 24 hours before being fixed in 4% paraformaldehyde solution (Solarbio, Beijing, China) for 10 minutes. After fixation, cells were permeabilized with 0.2% Triton X-100 for 10 minutes at room temperature. After blocking with goat serum for 30 minutes, primary antibodies were incubated overnight at 4°C. Subsequently, samples were incubated with fluorescent dye-labeled secondary antibodies (1 : 200 dilution) for 1 hour in the dark, and stained with DAPI (Solarbio, Beijing, China) for 5 minutes. Final images were taken by fluorescence microscopy (Olympus, Japan).
[0069] Human clear cell renal carcinoma cell lines 786-0, 769-P, OS-RC-2, Caki-1, and human embryonic kidney cell line HEK293T were obtained from the National Accredited Cell Bank (Beijing, China). The 786-0 cell line is currently the only ccRCC cell line that can form sarcoma-like ccRCC xenograft tumors. 786-0, 769-P, and OS-RC-2 cells were cultured in RPMI-1640 medium (SIGMA, Vienna, Austria). Caki-1 cells were cultured in McCoy’s 5A medium (KeyGEN BioTECH, Jiangsu, China), and HEK293T cells were cultured in DMEM medium (Gibco, California, USA). Normal human kidney epithelial cells HK-2 were maintained in DMEM / F-12 medium (Gibco, California, USA). All media were supplemented with 10% fetal bovine serum (FBS, Ausbian, Australia) and 1% penicillin-streptomycin mixture (Solarbio, Beijing, China). All cell lines were cultured at 37°C in a humidified environment with 5% CO2.
[0070] The clinical tissue samples of ccRCC patients with or without sarcomatoid features used in the following examples were obtained from Beijing Chao-Yang Hospital, Capital Medical University. All samples were reviewed by a specialized genitourinary pathologist to confirm the presence of sarcomatoid / epithelioid components. The study was approved by the Ethics Committee of Beijing Chao-Yang Hospital, and all participants signed the informed consent in accordance with the Declaration of Helsinki.
[0071] All animal experiments were approved by the Committee of Experimental Animal Management and Use of Capital Medical University. The mice used in the experiments were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were bred under specific pathogen-free conditions.
[0072] The antibodies used in the following examples and their selling company names are as follows:
[0073] PLOD2 antibody: Proteintech (21214-1-AP);
[0074] DCLK1 antibody: Cell Signaling Technology (D2U3L);
[0075] CD44 antibody: Cell Signaling Technology (156-3C11);
[0076] β-catenin antibody: Cell Signaling Technology (D10A8);
[0077] ALDH1A1 antibody: Proteintech (15910-1-AP);
[0078] CD10 antibody: Proteintech (18008-1-AP);
[0079] CA9 antibody: Proteintech (66243-1-AP);
[0080] AQP1 antibody: Proteintech (20333-1-AP);
[0081] MUC1 antibody: Proteintech (23614-1-AP);
[0082] ZO1 antibody: Cell Signaling Technology (D7D12);
[0083] E-Cadherin antibody: Cell Signaling Technology (4A2);
[0084] N-Cadherin antibody: Cell Signaling Technology (D4R1H);
[0085] Vimentin antibody: Cell Signaling Technology (D21H3);
[0086] Snail antibody: Cell Signaling Technology (C15D3);
[0087] GAPDH antibody: Cell Signaling Technology (14C10);
[0088] β-actin antibody: Proteintech (81115-1-RR);
[0089] HRP-labeled Goat Anti-Rabbit IgG (H+L): Beyotime (A0208);
[0090] HRP-labeled Goat Anti-Mouse IgG (H+L): Beyotime (A0216).
[0091] The primers involved in the following examples are shown in Table 1 below.
[0092] Table 1, primer information
[0093]
[0094] Among them, E-Cadherin can be referred to as E-Cad, Vimentin can be referred to as Vim, and N-Cadherin (N-cadherin) can be referred to as N-Cad.
[0095] Example 1, screening potential molecular markers of sarcomatoid renal cell carcinoma using multi-omics data
[0096] This example uses ccRCC transcriptome and proteome data in TCGA and CPTAC databases, and based on three key features of sarcomatoid dedifferentiation (low differentiation, high EMT and poor prognosis), potential regulatory factors promoting sarcomatoid dedifferentiation of ccRCC are screened. Figure 1
[0097] Clinical information and high-throughput RNA sequencing data of ccRCC patients were obtained from UCSC Xena (https: / / xenabrowser.net / datapages / ). Expression values were represented as FPKM (fragments per kilobase per million) and log2(FPKM+1) was used for log transformation to facilitate statistical analysis. Clinical information and proteomic expression data of ccRCC patients were from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) and obtained through Proteomic Data Commons (PDC Study ID: PDC000411) at https: / / proteomic.datacommons.cancer.gov / . TCGA and CPTAC ccRCC patient information containing sarcomatoid annotations were referenced from previous studies (Zuo Y, Fu S, Zhao Z, et al. Sarcomatoid-associated gene risk index for clear cell renal cell carcinoma. Front Genet. 2022. 13:985641.; Li Y, Lih TM, Dhanasekaran SM, et al. Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness. Cancer Cell. 2023. 41(1): 139-163.e17.). Gene expression profiles of other ccRCC samples and renal cancer patient-derived xenograft samples were downloaded from Gene Expression Omnibus (GEO, accession numbers GSE73731 and GSE78806) at https: / / www.ncbi.nlm.nih.gov / geo / .
[0098] Heatmaps in this study were generated by the “ComplexHeatmap” R package. Survival analysis was performed using the “survminer” R package. EMT score was based on the gene definition in a previous study (Mak MP, Tong P, Diao L, et al. A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clin Cancer Res. 2016. 22(3):609-20.), and stemness score was calculated by previously identified ccRCC-specific stemness markers CD44, CXCR4, and MET (Fendler A, Bauer D, Busch J, et al. Inhibiting WNT and NOTCH in renal cancer stem cells and the implications for human patients. Nat Commun. 2020. 11(1):929.). The formula to calculate EMT score and stemness score is as follows:
[0099]
[0100]
[0101] To screen candidate drivers of RCC sarcomatoid dedifferentiation, the inventors analyzed ccRCC patient transcriptomic data from TCGA and ccRCC patient proteomic data from CPTAC, based on the three major features of sarcomatoid dedifferentiation ccRCC: poor differentiation, high EMT, and poor prognosis. All analyses were performed using R software (version 4.2.2). Wilcoxon rank-sum test was used to identify differentially expressed genes that were progressively upregulated during ccRCC dedifferentiation (p-value < 0.05, FDR < 0.05). In ccRCC patient samples, Pearson correlation analysis was used to identify genes that were significantly positively correlated with EMT score (r > 0.35, adjusted p-value < 0.0001). The “survminer” R package was used to screen genes that were associated with poor overall survival of ccRCC patients (p-value < 0.05). Finally, genes that overlapped in mRNA and protein levels in TCGA and CPTAC data with “poor differentiation”, “high EMT”, and “poor prognosis” analyses were considered as candidate drivers of RCC sarcomatoid dedifferentiation.
[0102] Screening found that three genes (PLOD1, PLOD2, PLOD3) of the lysine hydroxylase (PLOD) family all appeared in the final list of 13 candidate genes, suggesting that the genes of this family are more closely related to the sarcomatoid dedifferentiation of ccRCC. Among the three genes, PLOD2 has the highest expression in ccRCC, the largest up-regulation, and the highest relative risk (HR) of patient death, HR up to 2.51 Figure 2 ), the inventors preferentially selected PLOD2 as the priority verification object. The reliability of this selection is supported by subsequent RNA-seq analysis in sccRCC cells, which shows that the deletion of PLOD2 can simultaneously cause the significant decrease of the expression of other 6 candidate drivers Figure 3
[0103] Example 2, PLOD2 is significantly highly expressed in sarcomatoid renal cell carcinoma cell lines and patient tissues
[0104] Cell lines to be tested: normal kidney proximal tubular cell line HK-2, epithelioid renal clear cell carcinoma cell lines OS-RC-2, 769-P, Caki-1, sarcomatoid renal clear cell carcinoma cell line 786-O.
[0105] Western blot was used to detect the expression of PLOD2 in each cell, and the antibodies used were PLOD2 antibody (Proteintech, 21214-1-AP) and β-actin antibody (Proteintech, 81115-1-RR), and the secondary antibody was horseradish peroxidase-labeled secondary antibody (1:8000, ZSGB-BIO, China). Cell line level verification found that the expression of PLOD2 in sarcomatoid renal clear cell carcinoma cell lines was significantly higher than that in epithelioid renal clear cell carcinoma cell lines and normal kidney cell lines Figure 4
[0106] TCGA, CPTAC database clinical sample data verification also showed that the expression of PLOD2 in sarcomatoid renal cell carcinoma tissues was significantly higher than that in normal tissues adjacent to cancer Figure 5
[0107] The inventors collected clinical samples for immunohistochemical verification and PLOD2 content score statistics, and also found that the expression of PLOD2 in sarcomatoid renal clear cell carcinoma tissues was significantly higher than that in epithelioid renal clear cell carcinoma tissues Figure 6
[0108] Example 3, the expression of PLOD2 increases with the progression of sarcomatoid dedifferentiation of renal cell carcinoma
[0109] Sarcomatoid renal cell carcinoma tissues generally contain both epithelioid and sarcomatoid tumor cell components, in order to further show the expression of PLOD2 in sarcomatoid and epithelioid components in the same sRCC tissue, the inventors performed HE staining, immunohistochemical staining and score statistics on 6 patient tissues containing obvious epithelioid and sarcomatoid components.
[0110] It was found that PLOD2 was significantly higher in sarcomatoid components than in adjacent epithelioid components and normal kidney tissues adjacent to the cancer in the tissue Figure 7 ). The inventors specifically demonstrated three typical cases: patient 1 Figure 8 ), patient 2 Figure 9 ), and patient 3 Figure 10 ). Immunohistochemical staining showed that PLOD2 could specifically recognize sarcomatoid components in sarcomatoid renal cell carcinoma tissues, and the inventors found that the expression of PLOD2 in the epithelioid-sarcomatoid transition zone was between the epithelioid and sarcomatoid regions Figures 8-11 ), indicating that PLOD2 expression gradually increased with the progression of sarcomatoid dedifferentiation of RCC, and further indicating the specificity of PLOD2 in recognizing sarcomatoid components.
[0111] Example 4, PLOD2 knockout can cause sarcomatoid differentiation of sarcomatoid renal cell carcinoma into epithelioid
[0112] In order to further verify the reliability of PLOD2 as a molecular marker of sarcomatoid renal cell carcinoma, the inventors knocked out PLOD2 in sarcomatoid renal cell carcinoma cell 786-O, and found that the nude mouse transplanted tumor changed from typical sarcomatoid morphology to clear cell-like epithelioid morphology, and appeared epithelioid morphology similar to normal kidney proximal tubules Figure 12 ), further confirming the key role of PLOD2 in sarcomatoid transformation of RCC, and in turn supporting the reliability of PLOD2 as a molecular marker of sRCC.
[0113] CRISPR / Cas9-mediated PLOD2 gene knockout:
[0114] PLOD2 gene expression was precisely knocked out by CRISPR / Cas9 technology. Single guide RNA (sgRNA) sequences targeting PLOD2 were synthesized, annealed and inserted into the upstream of sgRNA backbone in lentiCRISPRv2 vector to obtain three recombinant vectors, all of which can transcribe sgRNA targeting PLOD2. The three recombinant vectors were used together with packaging vectors psPAX2 and pMD2.G to co-transfect HEK293T cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) to produce lentivirus particles. After 48-72 hours of transfection, three recombinant lentiviruses were collected and purified by 0.45 μm filter membrane. Then the three recombinant lentiviruses were mixed and used to infect ccRCC cell line 786-O, and 3 days after infection, 2 μg / ml puromycin (Gibco, USA) was used to screen the cell line with stable knockout of PLOD2 gene. The resulting cell line was detected by Western Blot, and the PLOD2 protein content was significantly reduced compared with 786-O cells. The three PLOD2-specific sgRNA target sequences are as follows: PLOD2-sgRNA-1: 5'-ATATTTCAATTATACTGTGA-3' (SEQ ID No. 3); PLOD2-sgRNA-2: 5'-GTAGCAACAAAAGAAAGTGA-3' (SEQ ID No. 4); PLOD2-sgRNA-3: 5'-GTTGTGGCTGAGAAGATGAG-3' (SEQ ID No. 5).
[0115] Example 5, PLOD2 is also a molecular marker of sarcomatoid dedifferentiation of other subtypes of renal cell carcinoma
[0116] Renal cell carcinoma includes common subtypes such as renal clear cell carcinoma, chromophobe renal cell carcinoma, papillary renal cell carcinoma, etc. The above study is mainly for the study of the renal clear cell carcinoma subtype. In addition, analysis of the PLOD2 expression of TCGA chromophobe renal cell carcinoma patient samples showed that the PLOD2 expression of two patients out of three patients clearly annotated as sarcomatoid dedifferentiation was significantly higher than that of all patients annotated as non-sarcomatoid Figure 13 ), indicating that PLOD2 is likely to be a universal molecular marker of sarcomatoid dedifferentiation phenotype of various subtypes of renal cell carcinoma.
[0117] Example 6, PLOD2 drives sarcomatoid dedifferentiation of ccRCC
[0118] Epithelioid RCC cells acquire sarcomatoid phenotype through stepwise dedifferentiation and EMT activation. To explore the role of PLOD2 in sarcomatoid dedifferentiation, the inventors overexpressed PLOD2 in epithelioid ccRCC cell line 769-P with low PLOD2 expression.
[0119] Overexpression of human PLOD2:
[0120] Overexpression of PLOD2 was achieved by using pLV(Exp)-mCherry / Neo- EFlA>hPLOD2 lentivirus vector (Cat No: VB900122-1045uaw) from YUNSHOU BIOTECH (GUANGZHOU) CO., LTD (Guangzhou, China). pLV(Exp)-mCherry / Neo- EFlA>hPLOD2 contains PLOD2 gene coding sequence shown in SEQ ID No. 1 and can express PLOD2 protein shown in SEQ ID No. 2.
[0121] PLOD2 gene coding sequence (SEQ ID No. 1):
[0122] ATGGGGGGATGCACGGTGAAGCCTCAGCTGCTGCTCCTGGCGCTCGTCCTCCACCCCTGGAATCCCTGTCTGGGTGCGGACTCGGAGAAGCCCTCGAGCATCCCCACAGATAAATTATTAGTCATAACT GTAGCAACAAAAGAA AGTGA TGGATTCCATCGATTTATGCAGTCAGCCAA ATATTTCAATTATACTGTGA
[0123] PLOD2 protein (SEQ ID No. 2):
[0124] MGGCTVKPQLLLLALVLHPWNPCLGADSEKPSSIPTDKLLVITVATKESDGFHRFMQSAKYFNYTVKVLGQGEEWRGGDGINSIGGGQKVRLMKEVMEHYADQDDLVVMFTECFDVIFAGGPEEVLKKFQKANHKVVFAADGILWPDKRLADKYPVVHIGKRYLNSGGFIGYAPYVNRIVQQWNLQDNDDDQLFYTKVYIDPLKREAINITLDHKCKIFQTLNGAVDEVVLKFENGKARAKNTFYETLPVAINGNGPTKILLNYFGNYVPNSWTQDNGCTLCEFDTVDLSAVDVHPNVSIGVFIEQPTPFLPRFLDILLTLDYPKEALKLFIHNKEVYHEKDIKVFFDKAKHEIKTIKIVGPEENLSQAEARNMGMDFCRQDEKCDYYFSVDADVVLTNPRTLKILIEQNRKIIAPLVTRHGKLWSNFWGALSPDGYYARSEDYVDIVQGNRVGVWNVPYMANVYLIKGKTLRSEMNERNYFVRDKLDPDMALCRNAREMTLQREKDSPTPETFQMLSPPKGVFMYISNRHEFGRLLSTANYNTSHYNNDLWQIFENPVDWKEKYINRDYSKIFTENIVEQPCPDVFWFPIFSEKACDELVEEMEHYGKWSGGKHHDSRISGGYENVPTDDIHMKQVDLENVWLHFIREFIAPVTLKVFAGYYTKGFALLNFVVKYSPERQRSLRPHHDASTFTINIALNNVGEDFQGGGCKFLRYNCSIESPRKGWSFMHPGRLTHLHEGLPVKNGTRYIAVSFIDP.
[0125] The resulting recombinant vector pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 was co-transfected with packaging plasmids pMD2G and psPAX2 into HEK293T cells to produce lentiviral particles. The resulting lentivirus was used to transfect ccRCC cells 769-P, and after 3 days of transfection, stable cell lines overexpressing PLOD2 were selected using 400 pg / mL G418.
[0126] The expression of PLOD2, stem cell markers, and epithelial markers in the obtained cell lines was detected by Western blotting and qPCR. The results showed that stem cell markers such as DCLK1, CD44, ALDH1A1, and β-catenin were significantly upregulated, while ccRCC-related epithelial markers CD10, CA9, and MUC1 were significantly downregulated. Figure 14 The presence of A indicates that the cells underwent dedifferentiation. Flow cytometry analysis showed an increase in the proportion of side population (SP) cells. Figure 14 In the middle B group, the ALDH1A1 staining intensity increased, and the proportion of ALDH1A1+ cancer stem cells increased. Figure 14 The study further verified that PLOD2 overexpression enhances the cancer stemness of epithelial-like ccRCC cells.
[0127] In addition to promoting cell dedifferentiation, PLOD2 overexpression also activated the EMT program in epithelial-like ccRCC cells. This was reflected in the decreased expression of epithelial markers E-cadherin and ZO-1, and the increased expression of mesenchymal markers vimentin, Snail, and N-cadherin, all of which were verified at the mRNA and protein levels. Figure 14 These results indicate that PLOD2 promotes both dedifferentiation and activates EMT in epithelial-like ccRCC cells, highlighting its role in sarcomatoid dedifferentiation.
[0128] To further verify the functional necessity of PLOD2 in ccRCC sarcoma-like dedifferentiation, the inventors knocked out PLOD2 in sccRCC cells (786-O) (the cells tested were the PLOD2 gene stably knocked out cell line obtained in Example 4). The results showed that the stemness of the cancer cells was significantly reduced, while epithelial differentiation was increased, which could be clearly seen from the changes in the expression of molecular markers. Figure 14 (E). In addition to epithelial markers related to ccRCC, the inventors also observed a significant increase in AQP1, a molecular marker specific to normal proximal tubular epithelial cells of the kidney, from which ccRCC originates ( Figure 14 (E).
[0129] Flow cytometry results showed a significant decrease in the proportion of SP cells. Figure 14 In the middle F), the ALDH1A1 staining intensity decreased, and the proportion of ALDH1A1+ cancer stem cells decreased. Figure 14 (G). Immunofluorescence staining further supported these findings, showing a significant decrease in the stemness markers DCLK1 and ALDH1A1, while a significant increase in the epithelial differentiation markers CA9 and AQP1. Figure 14 (H).
[0130] These results indicate that PLOD2 knockout can reduce the cancer stemness of sccRCC cells and promote their differentiation towards epithelial phenotype, highlighting the value of PLOD2 as a potential therapeutic target to reverse the sarcomatoid dedifferentiation of ccRCC.
[0131] It is important to note that no specific marker for sccRCC has been identified to date. However, based on the existing literature, the inventors found that the high expression of CA9 (an epithelial marker associated with ccRCC) and AQP1 (a specific marker for proximal tubule of kidney) can characterize the differentiation status of sccRCC at the molecular level: (1) Although CA9 is significantly upregulated during ccRCC tumorigenesis, its expression gradually decreases during ccRCC dedifferentiation. More importantly, a recent study showed that in the same sccRCC tissue, CA9 is more highly expressed in the epithelial-like component than in the sarcomatoid component. (2) ccRCC originates from the proximal tubule of normal kidney, and AQP1 is a specific marker for proximal renal tubule. This suggests that the expression of AQP1 can help assess the differentiation degree of ccRCC. Indeed, the high expression of AQP1 was significantly associated with the high differentiation level of ccRCC, a finding that was also validated by TCGA and CPTAC data.
[0132] EMT plays a key role in maintaining the sarcomatoid morphology of sccRCC. By Western blot, RT-qPCR ( Figure 14 I) and immunofluorescence staining ( Figure 14 J), the inventors observed a significant reversal of EMT after knocking out PLOD2 in sccRCC cells, with increased expression of epithelial markers (E-cadherin and ZO-1) and decreased expression of mesenchymal markers (vimentin, Snail and N-cadherin).
[0133] In addition, the inventors' RNA sequencing data also showed significant changes in the expression of molecular markers related to cancer stemness, epithelial differentiation and EMT in sccRCC cells with PLOD2 deletion ( Figure 14 K). Gene Ontology (GO) analysis showed that the gene changes caused by PLOD2 deletion were significantly enriched in processes related to the biology of sRCC, including the establishment of cell polarity, stem cell differentiation, renal tubule development, and mitotic cell cycle G2 / M transition ( Figure 15 ). These results further confirmed the key role of PLOD2 in driving the sarcomatoid dedifferentiation molecular events of ccRCC.
[0134] In addition, the analysis of TCGA on sccRCC subtype samples showed that PLOD2 expression was significantly higher in three patients annotated as sarcomatoid dedifferentiation than in all 22 patients annotated as non-sarcomatoid (Figure 16 PLOD2 was also significantly associated with stromal features of clear cell renal cell carcinoma subtypes (Fig. 2A). PLOD2 was also significantly associated with stromal features of clear cell renal cell carcinoma subtypes (Fig. 2A), suggesting that PLOD2 might also have a role in regulating sarcomatoid dedifferentiation in other RCC subtypes. These results suggest that PLOD2 is a key regulator of sarcomatoid dedifferentiation in multiple RCC types. Figure 16
[0135] Example 7, PLOD2 knockout induces sccRCC differentiation and improves therapeutic response
[0136] Pathomorphological examination is the gold standard for diagnosing sRCC. To further explore the effect of PLOD2 knockout on sccRCC differentiation, the inventors performed histopathological analysis on 786-O cell-derived sarcomatoid tumor masses in vivo in mice.
[0137] A total of 5 x 106control cells (sarcomatoid renal cell carcinoma cells 786-O) or PLOD2-knockout sccRCC cells (PLOD2 gene stably knocked out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. The mice were sacrificed 40 days after transplantation, and the tumors were excised for detection.
[0138] HE staining showed that the sarcomatoid appearance of sccRCC was significantly reversed to clear cell epithelioid morphology after PLOD2 knockout (Fig. 3A). Figure 17 Figure 17 In addition, Masson staining showed that cytoplasm-rich proximal tubule-like structures appeared in PLOD2-depleted sccRCC xenograft tumors, similar to normal kidney tissue (Fig. 3A).
[0139] These morphological changes were accompanied by a significant increase in differentiation markers CA9 and AQP1, and a significant decrease in stemness markers ALDH1A1 and DCLK1, which were verified by IHC analysis in PLOD2-depleted sccRCC xenograft tumors (Fig. 3B). Further IHC analysis also showed a significant decrease in EMT markers, indicating the induction of mesenchymal-epithelial transition (MET) (Fig. 3C). These in vivo experimental results further confirmed the role of PLOD2 knockout in driving sccRCC differentiation towards an epithelioid morphology (eccRCC), by reducing cancer cell stemness, enhancing epithelial differentiation, and inducing MET. Figure 17 Figure 17
[0140] Analysis of patient sample data from TCGA, CPTAC, and GSE73731 showed a significant negative correlation between PLOD2 and the epithelial differentiation marker AQP1. Figure 17 (D), and showed a significant positive correlation with the specific ccRCC dry marker (CXCR4+MET+CD44+). Figure 17 (E), supporting the dedifferentiation role of PLOD2 in ccRCC.
[0141] In ccRCC, poor differentiation is directly associated with rapid tumor progression and poor survival. Figure 17 In this embodiment, PLOD2 knockout-induced sccRCC differentiation significantly inhibited tumor growth (F). Figure 17 (G), accompanied by a significant decrease in the Ki-67 proliferation index (G). Figure 17 These results were confirmed in a nude mouse subcutaneous xenograft tumor model. Furthermore, in the TCGA, CPTAC, and GSE73731 datasets, PLOD2 expression was significantly correlated with Ki-67 levels. Figure 17 Middle I).
[0142] Sarcoma-like dedifferentiation is associated with resistance to cytotoxic chemotherapy and anti-angiogenic therapy. Treatment of sarcoma-like renal cell carcinoma 786-O cells or PLOD2 knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) with doxorubicin, gemcitabine, and IFN-α (α-interferon) showed that PLOD2 knockout-induced differentiation significantly enhanced the sensitivity of sccRCC cells to doxorubicin, gemcitabine, and IFN-α, as evidenced by a significant decrease in IC50 values. Figure 17 (J). In xenograft mouse model experiments, intervention with PLOD2 alone showed a stronger antitumor effect than the anti-angiogenic drug axitinib. Figure 17 (K). Furthermore, combining PLOD2 intervention with axitinib significantly enhanced the sensitivity of sccRCC xenograft tumors to axitinib ( Figure 18 (Middle K). The experimental steps for the xenograft mouse model are as follows: A total of 5 × 10^6 control cells (sarcoma-like renal cell carcinoma cells 786-O) or PLOD2 knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and the xenograft tumor was excised and cut into pieces approximately 4 mm in size. 3Small pieces of sccRCC were implanted into the right abdomen of 4-week-old male BALB / C nude mice. When sccRCC xenografts reached the designated size, each tumor mouse was randomly divided into two groups (n = 5 in each group) and given DMSO or 5 mg / kg / day of axitinib treatment, respectively. Mice were sacrificed 40 days after tumor transplantation, and tumors were cut for size and weight detection, and tumor volume was monitored before the mice were sacrificed. DMSO was administered by intraperitoneal injection, and axitinib was administered by gavage.
[0143] These findings suggest that PLOD2 plays a key role in the sarcomatoid dedifferentiation and treatment resistance of sccRCC, and targeting PLOD2 can be a new strategy to improve the effectiveness of existing treatments.
[0144] Example 8, Pharmacological targeting inhibitor of PLOD2, minoxidil, drives sccRCC differentiation and increases its sensitivity to treatment
[0145] Minoxidil is an FDA-approved drug for the treatment of androgenetic alopecia and has recently been found to be an inhibitor of PLOD2. To explore whether pharmacological targeting of PLOD2 can bring therapeutic benefits to sccRCC patients, the inventors used minoxidil to treat sccRCC cells.
[0146] 1. Drug sensitivity experiment
[0147] Sarcomatoid renal cell carcinoma cells 786-O were seeded in 96-well plates (2000 cells per well) and cultured in a humidified incubator with 5% CO2, followed by CCK8 analysis after treatment with different concentrations of doxorubicin (MedChemExpress, China), gemcitabine (MedChemExpress, China), or everolimus (MedChemExpress, China) for 48 hours, or IFN-a (Genscript, USA) for 72 hours. For combination drug experiments, pre-cultured 786-O sccRCC cells (2000 cells per well) were treated with different concentrations of therapeutic drugs combined with minoxidil (MedChemExpress, China) at low doses (0.25 mM and 0.5 mM) for 48 hours. Subsequently, CCK8 reagent (Lablead, China) was mixed with 90 μL RPMI-1640 medium and incubated at 37°C for 1 hour, and the absorbance was measured at 450 nm. Cell survival rate was expressed as %, and the calculation formula was: [(experimental group OD value-blank group OD value) / (control group OD value-blank group OD value)] x 100%. Data analysis was performed by GraphPad 8.0 software (GraphPad, San Diego, CA), and the combination index (CI) was calculated by CompuSyn software version 1.0, CI <1 indicating synergy, and CI <0.1 indicating extremely strong synergy.
[0148] The results showed that minoxidil treatment (0.5 mM) significantly increased the expression of ccRCC epithelial differentiation markers, while significantly decreasing the expression of cancer stem cell and EMT markers. This phenomenon was confirmed by in vitro Western blot and RT-qPCR analysis. Figure 18 (A and B), and further confirmed by IHC staining of tumor tissue in an in vivo xenograft experiment ( Figure 18 These molecular changes are accompanied by significant epithelial-like differentiation in approximately 60% of sccRCC xenograft tumors (C). Figure 18 (D). In areas with higher PLOD2 residues, the tissue morphology tends towards sarcoma-like, while in areas with lower PLOD2 residues, the morphology is more epithelial-like. Figure 18 (D). The in vivo xenograft experiment proceeded as follows: 5 × 10^6 786-O cells were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish an sccRCC xenograft tumor model. Mice were sacrificed 40 days post-transplantation, and the xenograft tumor was harvested and cut into approximately 4 mm sections. 3 Small xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor-bearing mice were randomly divided into two groups (n=5 per group), and were administered DMSO or minoxidil at 6 mg / kg / day by gavage, respectively. The mice were sacrificed 40 days after tumor transplantation, and the tumors were excised for analysis.
[0149] To evaluate whether minoxidil, when combined with conventional drugs, could enhance therapeutic sensitivity, the inventors treated sccRCC cells with two relatively mild minoxidil doses: 0.25 mM and 0.5 mM. Single-dose treatment did not induce significant cell death. Subsequently, minoxidil was combined with doxorubicin, gemcitabine, and IFN-α. Results showed that minoxidil at both doses significantly enhanced the tumor-killing effects of all three drugs, exhibiting a synergistic effect. CompuSyn's combination index (CI) calculations showed that all CI values were <1. Figure 18 (E and F in the middle).
[0150] 2. In vivo xenotransplantation experiment
[0151] To investigate the effects of PLOD2 knockout on the biology of sccRCC, a total of 5 × 10^6 control cells (sarcomatoid renal cell carcinoma 786-O) or PLOD2-knockout sccRCC cells (the PLOD2 gene stably knocked-out cell line obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and the tumor xenograft was harvested and cut into pieces approximately 4 mm in size. 3Small xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor-bearing mice were randomly divided into two groups (n=5 per group), and were administered DMSO or axitinib (5 mg / kg / day) by gavage, respectively. Tumor size was monitored and recorded every two days, and tumor volume was calculated using the following formula: Tumor volume = (tumor length × tumor width²) / ².
[0152] For in vivo combination therapy experiments, BALB / C nude mice with 786-O-derived sccRCC xenografts of comparable size were randomly divided into four groups (n=4 per group): one group received DMSO (control group), one group received minoxidil at 6 mg / kg / day, one group received axitinib at 5 mg / kg / day, and the other group received a combination of minoxidil at 6 mg / kg / day and axitinib at 5 mg / kg / day. DMSO and minoxidil were administered intraperitoneally, while axitinib was administered by gavage.
[0153] In the sccRCC xenograft mouse model, minoxidil alone (6 mg / kg) significantly reduced the Ki-67 index ( Figure 18 (G) and tumor growth rate ( Figure 18 In addition to the H), the combination of minoxidil and other treatments significantly improved the sensitivity of sccRCC xenografts to axitinib (a treatment targeting angiogenesis). These findings suggest that PLOD2 is a promising pharmacological target for the future treatment of sRCC, and that minoxidil combined with conventional therapy may be a more effective strategy for managing sccRCC.
[0154] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Application of substances that knock out the PLOD2 gene in the preparation of products for the treatment of sarcomatoid renal cell carcinoma; The substance that knocks out the PLOD2 gene is a substance that specifically recognizes the PLOD2 gene in the gene editing system, which is a CRISPR / Cas9 system. The substance that specifically recognizes the PLOD2 gene is an sgRNA that targets the PLOD2 gene, and the target sequences of the sgRNA are SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No.
5.
2. Application of minoxidil in the preparation of products for the treatment of sarcomatoid renal cell carcinoma.
3. The application according to claim 1 or 2, characterized in that: The treatment for sarcomatoid renal cell carcinoma is manifested in any one of X1)-X5): X1) Inhibits the growth of sarcomatoid renal cell carcinoma; X2) induces sarcomatoid renal cell carcinoma tissue to transform into epithelioid renal cell carcinoma tissue; X3) induces sarcomatoid renal cell carcinoma cells to transform into epithelioid renal cell carcinoma cells; X4) Reduces the stemness of sarcomatoid renal cell carcinoma cells; X5) induces mesenchymal-epithelial transformation in renal cell carcinoma cells.
4. Application of substances that knock out the PLOD2 gene in the preparation of products that enhance the sensitivity of sarcomatoid renal cell carcinoma to therapeutic drugs; The substance that knocks out the PLOD2 gene is a substance that specifically recognizes the PLOD2 gene in the gene editing system, the gene editing system being a CRISPR / Cas9 system, the substance that specifically recognizes the PLOD2 gene being an sgRNA that targets the PLOD2 gene, and the target sequences of the sgRNA being SEQ ID No. 3, SEQ ID No. 4, and SEQ ID No. 5; The drug in question is axitinib, doxorubicin, gemcitabine, or IFN-α.
5. Application of minoxidil in the preparation of products that enhance the sensitivity of sarcomatoid renal cell carcinoma to treatment drugs; The drug in question is axitinib, doxorubicin, gemcitabine, or IFN-α.
Citation Information
Patent Citations
Application of small-molecule inhibitor minoxidil of PLOD2 in tumor treatment
CN111557941A