Genetically engineered Schizochytrium strain for efficient DHA production, construction method, and application

By knocking out the PEX10 gene of Schizochytrium and overexpressing the ACC1 and DGAT genes, a genetically engineered strain that efficiently produces DHA was constructed, which solved the problem of low genetic transformation efficiency in existing technologies and achieved a significant increase in DHA and PUFA production and cost reduction.

CN119931853BActive Publication Date: 2025-09-30TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510412589.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-09-30
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

The existing Schizochytrium fungi have the problem of low genetic transformation efficiency in lipid production capacity, making it difficult to further increase the production of DHA and PUFA through metabolic engineering.

Method used

By knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and overexpressing the acetyl-CoA carboxylase gene ACC1 and the diacylglycerol acyltransferase gene DGAT, a genetically engineered strain that efficiently produces DHA was constructed, and the relevant gene editing vector was transferred into the strain using Agrobacterium-mediated genetic transformation.

Benefits of technology

It significantly increases the production of DHA and PUFA, reduces the production cost of unsaturated fatty acids, improves the fatty acid ratio, and enhances lipid production capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119931853B_ABST
    Figure CN119931853B_ABST
Patent Text Reader

Abstract

The present invention discloses a genetically engineered Schizochytrium strain for efficient DHA production, as well as a construction method and application. The genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild-type Schizochytrium, which disrupts the β-oxidation pathway and blocks the degradation of fatty acyl-CoA; overexpressing the acetyl-CoA carboxylase gene ACC1 to provide more malonyl-CoA precursors, thereby promoting fatty acid biosynthesis; and overexpressing the diacylglycerol acyltransferase gene DGAT to promote the accumulation of fatty acids in the form of triglycerides. Under shake flask conditions, after fermentation, the DHA and PUFA produced reached 55.10% and 70.47% of the total oil content, respectively. Compared with the wild-type strain, DHA and PUFA increased by 21.6% and 24.77%, respectively, without a significant change in biomass, showing extremely high application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and more specifically, to a genetically engineered Schizochytrium strain capable of efficiently producing DHA, a construction method, and applications thereof. Background Art

[0002] In recent years, with increasing concern about resource and environmental issues, the use of microorganisms to produce fatty acids and their derivatives, replacing traditional products derived from fossil, animal, and plant sources, has been considered a model for green biomanufacturing. Metabolic engineering involves modifying target enzymes and genes involved in regulating protein expression through genetic engineering tools to alter microbial metabolism to achieve specific outcomes, such as enhanced lipid and polyunsaturated fatty acid (PUFA) biosynthesis. Schizochytrium sp., a major member of the Labyrinthulomycetes class, has attracted widespread attention as a potential industrial cell factory for the production of fatty acids and terpenoids. Currently, this strain has been certified as Generally Recognized as Safe (GRAS) by the US Food and Drug Administration (FDA). Furthermore, its fermentative production of docosahexaenoic acid (DHA, C22:6) has also achieved commercial application. Despite these advantages, wild-type Schizochytrium sp. remains in urgent need of metabolic engineering to further enhance its lipid production capacity. To date, there have been numerous reports on the modification of Schizochytrium by overexpressing endogenous or heterologous genes to improve lipid production. However, these modification processes are limited by the low efficiency of genetic transformation methods and are relatively simple. Summary of the Invention

[0003] The purpose of the present invention is to provide a genetically engineered Schizochytrium strain for efficiently producing DHA, a construction method and an application thereof.

[0004] In order to achieve these objects and other advantages according to the present invention, a genetically engineered strain of Schizochytrium that efficiently produces DHA is provided. The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium. The nucleotide sequence of the peroxisomal matrix protein gene PEX10 is SEQ ID NO: 1.

[0005] Preferably, the nucleotide sequence of the target site in the peroxisome matrix protein gene PEX10 is SEQ ID NO: 2.

[0006] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-Coenzyme carboxylase gene ACC1, and the nucleotide sequence of the acetyl-Coenzyme carboxylase gene ACC1 is SEQ ID NO: 5.

[0007] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the diacylglycerol acyltransferase gene DGAT, and the nucleotide sequence of the diacylglycerol acyltransferase gene DGAT is SEQ ID NO: 6.

[0008] Preferably, the genetically engineered strain is obtained by knocking out the peroxisome matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-CoA carboxylase gene ACC1 and the diacylglycerol acyltransferase gene DGAT.

[0009] The present invention also provides a method for constructing the first engineered Schizochytrium strain, comprising the following steps:

[0010] The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R;

[0011] The sgRNA PEX10 sequence was obtained by PCR amplification using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers;

[0012] The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 using homologous recombinase to obtain the PEX10 gene editing expression vector;

[0013] The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants.

[0014] The present invention also provides a method for constructing the second engineered Schizochytrium strain, comprising the following steps:

[0015] The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R;

[0016] The sgRNA PEX10 sequence was obtained by PCR amplification using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers;

[0017] The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 using homologous recombinase to obtain the PEX10 gene editing expression vector;

[0018] The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants;

[0019] The plasmid pC322-GFP was used as a backbone, and the C16 elongase gene E16 was inserted into the backbone to obtain the pCA322-E16 expression vector. The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4.

[0020] The acetyl-CoA carboxylase gene ACC1 was inserted into the pCA322-E16 expression vector to obtain the recombinant vector pCA322-ACC1;

[0021] The recombinant vector pCA322-ACC1 was transformed into Schizochytrium sp. SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium sp. SR21-ACC1 transformants.

[0022] The present invention also provides a method for constructing the third engineered Schizochytrium strain, comprising the following steps:

[0023] The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R;

[0024] The sgRNA PEX10 sequence was obtained by PCR amplification using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers;

[0025] The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 using homologous recombinase to obtain the PEX10 gene editing expression vector;

[0026] The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants;

[0027] The plasmid pC322-GFP was used as a backbone, and the C16 elongase gene E16 was inserted into the backbone to obtain the pCA322-E16 expression vector. The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4.

[0028] The diacylglycerol acyltransferase gene DGAT was inserted into the pCA322-E16 expression vector to obtain the recombinant vector pCA322-DGAT;

[0029] The recombinant vector pCA322-DGAT was transformed into Schizochytrium sp. SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium sp. SR21-DGAT transformants.

[0030] The present invention also provides a method for constructing the fourth engineered Schizochytrium strain, comprising the following steps:

[0031] The endogenous tRNA promoter sequence was obtained by PCR amplification using the DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R;

[0032] The sgRNA PEX10 sequence was obtained by PCR amplification using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers;

[0033] The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 using homologous recombinase to obtain the PEX10 gene editing expression vector;

[0034] The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants;

[0035] The plasmid pC322-GFP was used as a backbone, and the C16 elongase gene E16 was inserted into the backbone to obtain the pCA322-E16 expression vector. The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4.

[0036] The acetyl-CoA carboxylase gene ACC1 was inserted into the pCA322-E16 expression vector to obtain the recombinant vector pCA322-ACC1;

[0037] Inserting the diacylglycerol acyltransferase gene DGAT into the recombinant vector pCA322-ACC1 to obtain the recombinant vector pCA322-ACC1-DGAT;

[0038] The recombinant vector pCA322-ACC1-DGAT was transformed into Schizochytrium sp. SR21-ΔPEX10 transformants by Agrobacterium-mediated genetic transformation to obtain Schizochytrium sp. SR21-ΔPEX10-ACC1-DGAT transformants.

[0039] The present invention also provides a method for producing DHA by fermentation using the above-mentioned genetically engineered Schizochytrium strain, comprising the following steps:

[0040] The engineered Schizochytrium strain was spread on a solid plate medium and cultured at a temperature of 20-30°C for 12-96 hours;

[0041] Select a single colony and inoculate it into a secondary seed liquid culture medium. Incubate it in a shaking incubator at 160-220 rpm at 20-30°C for 12-96 hours to obtain a liquid seed solution.

[0042] Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and a shaking table at 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed;

[0043] The solid plate medium consists of 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, and 20 g / L agar powder, with the pH adjusted to 6.5.

[0044] The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH is adjusted to 6.5;

[0045] The composition of the fermentation broth medium is: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH is adjusted to 6.5.

[0046] The present invention has at least the following beneficial effects:

[0047] First, the present invention can significantly improve the proportion of fatty acids and reduce the production cost of unsaturated fatty acids produced by oil-producing fungi fermentation by knocking out an endogenous peroxisomal matrix protein gene PEX10 of Schizochytrium.

[0048] Second, the present invention further overexpresses the endogenous ACC1 and DGAT genes in the engineered Schizochytrium with the PEX10 gene knocked out, and proposes to increase the production of DHA and PUFA through a "push-pull-resistance" approach.

[0049] Other advantages, objectives and features of the present invention will be reflected in part from the following description and will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1A is a comparison of the sequence editing results of the transformant SR21-ΔPEX10 of the present invention;

[0051] Figure 1B This is a comparison of the fermentation results of the transformant SR21-ΔPEX10 of the present invention and the Schizochytrium wild type SR21-WT;

[0052] Figure 2A This is a comparison of the fermentation results of the transformant SR21-ACC1 of the present invention and the wild type SR21-WT of Schizochytrium;

[0053] Figure 2B 1 is a comparison chart of the fermentation results of the transformant SR21-DGAT of the present invention and the wild type SR21-WT of Schizochytrium sp.;

[0054] Figure 3 It is a comparison chart of the fermentation results of the transformant SR21-ΔPEX10-ACC1-DGAT of the present invention and the wild type SR21-WT of Schizochytrium. DETAILED DESCRIPTION

[0055] The present invention will be described in further detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0056] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0057] Example 1: Validation of knocking out the peroxisomal biogenesis factor 10 (PEX10) gene to disrupt the β-oxidation pathway and block the degradation of fatty acyl-CoA

[0058] The specific method is as follows:

[0059] 1. Primers

[0060]

[0061] 2. Fragment amplification and homologous recombination procedures

[0062]

[0063] 3. Experimental methods

[0064] To construct the PEX10 deletion cassette, plasmid pCB322 was first digested with restriction endonuclease BcuI (Thermo Scientific), and the primer pairs tRNA-F / PEX10-N20-1R and PEX10-N20-1F / tRNA-R were used to generate the PEX10 deletion cassette from the wild type of Schizochytrium ( Aurantiochytrium limacinum SR21, the Schizochytrium has been disclosed in patent CN119307499A) genome, tRNA was amplified from pCB332 Gly The fragments were then fused and ligated with the digested pCB322 plasmid to construct the PEX10 gene-editing expression vector pCB322-ΔPEX10-1. pCB322-ΔPEX10-1 was then transformed into Agrobacterium tumefaciens AGL-1. Positive transformants were then infected with Schizochytrium sp. using the same method described in our laboratory's previous patent CN119307499A. Transformants of Schizochytrium sp. SR21-ΔPEX10 were obtained. Finally, the transformants were passaged multiple times on plates expressing the corresponding resistance gene and verified.

[0065] Fermentation validation of transformants. Transformants of Schizochytrium sp. SR21-ΔPEX10 were first plated onto solid seed plates (28°C, 48 h). Single colonies were then selected and inoculated into secondary seed liquid medium (28°C, 200 rpm, 48 h) to obtain a liquid seed solution. Subsequently, the liquid seed solution was inoculated into fermentation broth at an inoculum ratio of 1–10% (28°C, 220 rpm, 120 h). Finally, the cells were harvested and the fatty acid composition of the lipids was determined using gas chromatography (GC-2010, Shimadzu, Japan) equipped with an SP-2560 column (100 m × 0.25 mm × 0.20 μm, Supelco, USA) and a flame ionization detector. The fatty acids were then converted to fatty acid methyl esters using a modified standard method. The relative content of each component was calculated using peak area normalization.

[0066] The composition of the solid plate medium was as follows: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, agar powder 20 g / L, and the pH was adjusted to 6.5. The composition of the secondary seed liquid medium was as follows: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH was adjusted to 6.5. The composition of the fermentation broth medium was as follows: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH was adjusted to 6.5.

[0067] The nucleotide sequence of PEX10 is SEQ ID NO: 1:

[0068]

[0069] The nucleotide sequence of the target site of PEX10 is shown in SEQ ID NO: 2:

[0070] CAGTCGTAAGAGACAAGCTG

[0071] The gRNA scaffold fragment sequence is as shown in SEQ ID NO: 3:

[0072] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

[0073] 4. Results

[0074] Figure 1B The results showed that compared with the wild type of Schizochytrium (hereinafter referred to as SR21-WT), the TFA accumulation capacity was improved without significant changes in biomass. 71.98% of TFA was accumulated in DCW (cell dry weight). Figure 1B In addition, the composition of TFAs (unsaturated fatty acids) also changed significantly. Compared with SR21-WT, the proportions of DPA (docosapentaenoic acid), DHA, and PUFA in the Schizochytrium sp. SR21-ΔPEX10 transformant (hereinafter referred to as SR21-ΔPEX10) increased by 2.1%, 10.32%, and 9.43%, respectively. This may be because, in the late fermentation period, due to nutrient limitations, SR21-WT breaks down synthesized DHA and other fatty acids through β-oxidation to maintain metabolism. Knocking out PEX10 disrupts the β-oxidation pathway and blocks the degradation of fatty acyl-CoA, thereby alleviating lipid degradation caused by β-oxidation.

[0075] Example 2: Verification of overexpression of ACC1 to provide more malonyl-CoA precursors and thus promote fatty acid biosynthesis

[0076] The specific method is as follows:

[0077] 1. Primers

[0078]

[0079] 2. Fragment amplification and homologous recombination procedures

[0080]

[0081] 3. Experimental methods

[0082] Construction of expression vector. First, the existing expression plasmid pC322-GFP in the laboratory was digested with restriction endonuclease ApaI to obtain the basic skeleton. Then, the primer pair PA-F / R and CYC-F11 / R11 were used to extract the wild type of Schizochytrium ( Aurantiochytrium limacinum The endogenous promoter PA and terminator CYC sequences were amplified from the DNA genome of Schizochytrium SR21 (disclosed in patent CN119307499A). The codon-optimized C16 elongase gene E16 was amplified using primer pair E16-F / R. This gene was then ligated into the pC322-GFP expression vector after enzyme digestion using a homologous recombinase. This gene was then transformed into Escherichia coli DH5α, and single colonies were selected for PCR verification. Positive transformants were identified, thus successfully constructing pCA322-E16.

[0083] Regarding obtaining transformants. The plasmid pCA322-E16 was digested with the restriction endonuclease XmaJI, and the codon-optimized acetyl-CoA carboxylase gene ACC1 was amplified using the primer pair ACC1-F / R. Subsequently, the gene was ligated into the pCA322-E16 expression vector after restriction digestion using a homologous recombinase. Next, the gene was transformed with Escherichia coli DH5α, and single colonies were selected for PCR verification to confirm positive transformants, thus successfully constructing pCA322-ACC1. Finally, pCA322-ACC1 was first transformed into Agrobacterium tumefaciens AGL-1, and the resulting positive transformants were then used to infect Schizochytrium sp. SR21-ΔPEX10 to obtain Schizochytrium sp. SR21-ACC1 transformants. For specific methods, refer to Example 1.

[0084] The fermentation verification of Schizochytrium sp. SR21-ACC1 transformants was carried out according to the method in Example 1.

[0085] The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 4:

[0086] ATGGAGTCTGGTCCTATGCCTGCTGGTATCCCTTTCCCTGAGTACTACGACTTCTTCATGGACTGGAAGACCCCTCTCGCTATTGCTGCTACCTACACCGTCGCTGTCGGTCTCTTCAACCCTAAGGTCGGTAAGGTCTCTCGCGTCGTCGCTAAGTCTGCTAACGCTAAGCCTGCTGAGCGCACTCAGTCTGGTGCTGCTATGACCGCTTTCGTCTTCGTCCACAACCTCATCCTCTGCGTCTACTCTGGTATCACCTTCTACCACATGTTCCCTGCTATGGTCAAGAACTTCCGCACCCACACCCTCCACGAGGCTTACTGCGACACCGATCAGTCTCTCTGGAACAACGCTCTCGGTTACTGGGGTTATCTCTTTTACCTCTCTAAGTTCTACGAGGTCATCGACACCATCATTATCATCCTCAAGGGTCGCCGCTCTTCTCTCCTTCAGACCTACCACCACGCTGGTGCTATGATCACCATGTGGTCTGGTATCAACTACCAAGCTACCCCTATCTGGATCTTCGTCGTCTTCAACTCTTTCATCCACACCATCATGTACTGCTACTACGCTTTCACCTCTATCGGTTTCCACCCTCCTGGTAAGAAGTACCTCACCTCTATGCAGATCACTCAGTTCCTCGTCGGTATCACCATCGCTGTCTCTTACCTCTTCGTCCCTGGTTGCATCCGCACCCCTGGTGCTCAGATGGCTGTCTGGATCAACGTCGGTTACCTCTTCCCTCTTACCTACCTCTTCGTTGATTTTGCTAAGCGCACCTACTCTAAGCGCACCGCTATCGCTGCTCAAAAAAAGGCTCAGTAG

[0087] The nucleotide sequence of ACC1 is SEQ ID NO: 5:

[0088]

[0089] 4. Results

[0090] The fatty acid content and fatty acid composition of the obtained strain SR21-ACC1 are as follows Figure 2A Compared to SR21-WT, the lipid content of SR21-ACC1 increased from 66.34% to 75.65%, the DPA yield of SR21-ACC1 increased from 8.03% to 14.49%, and the DHA yield of SR21-ACC1 increased from 33.50% to 49.40%. The PUFA ratio of SR21-ACC1 also increased from 45.70% to 64.80%.

[0091] Example 3: Verification of Overexpression of DGAT to Promote Fatty Acid Accumulation in the Form of Triacylglycerol (TAG)

[0092] The specific method is as follows:

[0093] 1. Primers

[0094]

[0095] 2. Fragment amplification and homologous recombination procedures

[0096]

[0097] 3. Experimental methods

[0098] The pCA322-E16 expression vector was constructed. The specific method is as shown in Example 2.

[0099] Plasmid pCA322-E16 was digested with the restriction endonuclease XmaJI, and the codon-optimized acetyl-CoA carboxylase gene (DGAT) was amplified using the primer pair DGAT-F / R. This gene was then ligated into the digested pCA322-E16 expression vector using a homologous recombinase. Next, the gene was transformed with Escherichia coli DH5α, and individual colonies were selected for PCR verification. Positive transformants were identified, thus successfully constructing pCA322-DGAT. Finally, pCA322-DGAT was first transformed into Agrobacterium tumefaciens AGL-1, and the resulting positive transformants were then used to infect Schizochytrium sp. SR21-ΔPEX10 to obtain Schizochytrium sp. SR21-DGAT transformants. For specific methods, refer to Example 1.

[0100] For fermentation verification of the transformants, refer to Example 1.

[0101] The nucleotide sequence of DGAT is SEQ ID NO: 6:

[0102]

[0103] 4. Results

[0104] The fatty acid content and fatty acid composition of the obtained strain SR21-DGAT are as follows Figure 2B Compared to SR21-WT, the lipid content of SR21-DGAT increased from 66.34% to 73.14%, the DPA yield of SR21-DGAT increased from 8.03% to 15.16%, and the DHA yield of SR21-DGAT increased from 33.50% to 53.21%. The PUFA ratio of SR21-DGAT also increased from 45.70% to 66.63%.

[0105] Example 4: Co-expression of ACC1 and DGAT to design the “push-pull-resistance” process for TAG synthesis

[0106] 1. Primers

[0107]

[0108] 2. Fragment amplification and homologous recombination procedures

[0109]

[0110] 3. Experimental methods

[0111] The pCA322-E16 expression vector was constructed. The specific method is as shown in Example 2.

[0112] Plasmid pCA322-ACC1 was digested with the restriction endonuclease BcuI. The sequences of the endogenous promoter PATP and terminator TA were amplified from the genomic DNA of SR21-WT using the primer pairs PATP-F / R and TA-F / R. The codon-optimized acetyl-CoA carboxylase gene DGAT was amplified using the primer pair DGAT-F1 / R1. This gene was then ligated into the pCA322-ACC1 expression vector after restriction enzyme digestion using a homologous recombinase. Subsequently, this gene was transformed with Escherichia coli DH5α, and single colonies were selected for PCR verification. Positive transformants were identified, thus successfully constructing pCA322-ACC1-DGAT. Finally, pCA322-ACC1-DGAT was first transformed into Agrobacterium tumefaciens AGL-1. The resulting positive transformants were then used to infect Schizochytrium sp. SR21-ΔPEX10, resulting in Schizochytrium sp. SR21-ΔPEX10-ACC1-DGAT transformants. For specific methods, see Example 1.

[0113] 4. Results

[0114] By overexpressing ACC1 in the SR21-ΔPEX10 strain to provide more malonyl-CoA precursors, the biosynthesis of TFA was promoted. At the same time, overexpression of DGAT was also attempted to promote the accumulation of TFA in the form of TAG. The fatty acid content and fatty acid composition of the resulting strain SR21-ΔPEX10-ACC1-DGAT are shown in Figure 2. Figure 3 Compared to SR21-WT, the lipid content of SR21-ΔPEX10-ACC1-DGAT increased from 66.34% to 77.14%; the DPA production of SR21-ΔPEX10-ACC1-DGAT increased from 8.03% to 15.80%; and the DHA production of SR21-ΔPEX10-ACC1-DGAT increased from 33.50% to 55.10%. The PUFA ratio of SR21-ΔPEX10-ACC1-DGAT also increased from 45.70% to 70.47%. This increase in ratio is significantly greater than previously reported in the literature.

[0115] The number of devices and processing scales described herein are intended to simplify the description of the present invention. Applications, modifications, and variations of the endogenous tRNA promoters and their applications of the present invention will be readily apparent to those skilled in the art.

[0116] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the description and implementation methods. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A genetically engineered strain of Schizochytrium for efficient production of DHA, characterized in that: The genetically engineered strain is obtained by knocking out the peroxisomal matrix protein gene PEX10 in the wild type of Schizochytrium and then overexpressing the acetyl-CoA carboxylase gene ACC1, the diacylglycerol acyltransferase gene DGAT, and the C16 elongase gene E16. The nucleotide sequence of the peroxisomal matrix protein gene PEX10 is SEQ ID NO: 1, the nucleotide sequence of the acetyl-CoA carboxylase gene ACC1 is SEQ ID NO: 5, the nucleotide sequence of the diacylglycerol acyltransferase gene DGAT is SEQ ID NO: 6, and the nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO:

4. The wild type of Schizochytrium Aurantiochytrium limacinum SR21; The nucleotide sequence of the target site in the peroxisome matrix protein gene PEX10 is SEQ ID NO:

2.

2. The method for constructing an engineered strain of Schizochytrium according to claim 1, wherein: The steps include: The endogenous tRNA promoter sequence was obtained by PCR amplification using the wild-type DNA genome of Schizochytrium as a template and the primer pair tRNA-F / R; The sgRNA PEX10 sequence was obtained by PCR amplification using the gRNA scaffold fragment shown in SEQ ID No: 3 as a template and the primer pair PEX10-N20-1F / 1R as primers; The endogenous tRNA promoter sequence was fused with the sgRNA PEX10 sequence, and the fused fragment was inserted into the BcuI site of the backbone vector pCB322 using homologous recombinase to obtain the PEX10 gene editing expression vector; The PEX10 gene editing expression vector was transferred into Schizochytrium through Agrobacterium-mediated genetic transformation to obtain Schizochytrium SR21-ΔPEX10 transformants; The plasmid pC322-GFP was used as a backbone, and the C16 elongase gene E16 was inserted into the backbone to obtain the pCA322-E16 expression vector; The acetyl-CoA carboxylase gene ACC1 was inserted into the pCA322-E16 expression vector to obtain the recombinant vector pCA322-ACC1; Inserting the diacylglycerol acyltransferase gene DGAT into the recombinant vector pCA322-ACC1 to obtain the recombinant vector pCA322-ACC1-DGAT; The recombinant vector pCA322-ACC1-DGAT was transferred into Schizochytrium sp. SR21-ΔPEX10 transformants through Agrobacterium-mediated genetic transformation to obtain Schizochytrium sp. SR21-ΔPEX10-ACC1-DGAT transformants.

3. The method for producing DHA by fermentation using a genetically engineered Schizochytrium sp. strain according to claim 1, wherein: The following steps are involved: The engineered Schizochytrium strain was spread on a solid plate medium and cultured at a temperature of 20-30°C for 12-96 hours; Select a single colony and inoculate it into a secondary seed liquid culture medium. Incubate it in a shaking incubator at 160-220 rpm at 20-30°C for 12-96 hours to obtain a liquid seed solution. Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and a shaking table at 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed; The solid plate medium consists of 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, and 20 g / L agar powder, with the pH adjusted to 6.

5. The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH is adjusted to 6.5; The composition of the fermentation medium was as follows: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH was adjusted to 6.5.

Citation Information

Patent Citations

  • Endogenous tRNA promoter and thraustochytriaceae microorganism gene editing method

    CN119307499A

  • Microorganisms producing docosahexaenoic acid and utilization thereof

    CN104995291A