Cartilage organ constructed based on DNA-silk fibroin hybrid hydrogel sustained release system as well as preparation method and application of cartilage organ

Abstract

The invention relates to a cartilage organ constructed on the basis of a DNA-silk fibroin hybrid hydrogel sustained-release system as well as a preparation method and application of the cartilage organ. The DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system formed by printing a DNA-silk fibroin hybrid hydrogel sustained-release system premix solution through a digital light processing system, and the DNA-silk fibroin hybrid hydrogel sustained-release system premix solution contains DNA, silk fibroin, acryloylated RGD peptide, acryloylated polyethylene glycol NHS ester, glucosamine, TD-198946 and 2, 4, 6-trimethyl-1, 3-pentanediol. The invention discloses a lithium 2, 6-trimethylbenzoyl phosphate. Compared with the prior art, the glucosamine and the TD-198946 introduced into the DNA-silk fibroin hybrid hydrogel sustained-release system disclosed by the invention can be used for remarkably improving and promoting the cartilage differentiation efficiency of the bone marrow mesenchymal stem cells; the cartilage graft can be transplanted to a cartilage defect position as a cartilage graft to promote cartilage regeneration and repair.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical materials, and in particular relates to a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, and a preparation method and application thereof. Background Art

[0002] Osteoarthritis is a common degenerative joint disease characterized by articular cartilage degeneration and is one of the main causes of disability in adults worldwide. According to statistics, more than 500 million people suffer from osteoarthritis worldwide, which brings huge economic burden to patients and society. Currently, the commonly used cartilage repair strategies, including microfracture, cartilage autotransplantation, cartilage allotransplantation, etc., are widely used in clinical practice, but they all have certain limitations and shortcomings. For example, microfracture may lead to poor defect filling and cartilage fibrosis; cartilage autotransplantation is limited by the donor area and has the problem of donor graft incompatibility; cartilage allotransplantation has the risk of immune rejection and infection, and it is difficult to match allogeneic tissue with autologous cartilage, which may lead to unbalanced biomechanical load and decreased joint bearing capacity. Therefore, new technologies and means are urgently needed to solve the problem of cartilage repair. In recent years, researchers have carried out a lot of exploration in the study of using biomaterials to repair cartilage defects. However, after relying solely on the implantation of biomaterials, it usually still needs to go through a series of processes such as endogenous cell recruitment, proliferation and matrix secretion, and the repair cycle is relatively long. Organoids are formed by directed differentiation of stem cells or progenitor cells. They have some of the key characteristics, structures and functions of organs and are capable of self-renewal and self-organization. Compared with biomaterials, cartilage organoids can omit the steps of endogenous cell recruitment and proliferation in repairing cartilage defects, which is expected to shorten the cartilage defect repair cycle.

[0003] At present, the methods for constructing cartilage organoids mainly include scaffold-free self-organization and biomaterial co-culture. Compared with the scaffold-free self-organization method, the addition of biomaterials not only provides cartilage organoids with a three-dimensional network scaffold similar to the extracellular matrix of cartilage cells, supports the proliferation of chondrocytes and maintains their physiological functions, but also regulates the structure and size of organoids by designing biomaterials. Studies have shown that RGD-modified DNA-silk fibroin hybrid hydrogel microspheres can load bone marrow mesenchymal stem cells and successfully culture cartilage organoid precursors under 14 days of chondrogenic induction. However, 14 days of induction is not enough to support the complete synthesis of the extracellular matrix of cartilage cells, making it difficult to form mature cartilage organoids. In addition, long-term in vitro culture may cause chondrocytes to gradually dedifferentiate, present a fibroblast-like morphology with abnormal ECM deposition, and eventually develop into a state of pathological hypertrophy. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system and a preparation method and application thereof, wherein the hydrogel sustained-release system can more effectively construct cartilage organoids by continuously supplying drugs that promote cartilage differentiation of bone marrow mesenchymal stem cells for a long time. The cartilage organoids described in the present invention are prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells through a digital light processing system and then culturing in vitro for 2-6 weeks.

[0005] The purpose of the present invention can be specifically achieved through the following technical solutions:

[0006] In a first aspect, the present invention provides a DNA-silk fibroin hybrid hydrogel sustained-release system, wherein the DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system obtained by printing a premix of the DNA-silk fibroin hybrid hydrogel sustained-release system through a digital light processing system.

[0007] Among them, the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system contains DNA, silk fibroin, acryloyl RGD peptide, acryloyl polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate.

[0009] In one embodiment of the present invention, the DNA exists in the form of a DNA supramolecular network structure in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system, and the DNA is composed of a Y-type DNA single strand and an L-type DNA single strand, there are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:1; there are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 to L2 is 1:1; the molar ratio of the Y-type DNA single strand to the L-type DNA single strand is 1:1-1:2; Y1, Y2, and Y3 all have three sticky ends, L1 and L2 each have a sticky end at both ends, and the L-type DNA single strand can be completely complementary to the sticky end of the Y-type DNA single strand.

[0010] In one embodiment of the present invention, the nucleotide sequences of Y1, Y2, Y3, L1, and L2 are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively.

[0011] In one embodiment of the present invention, in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system, the concentration of DNA is 300,000nM to 10,00,000nM, the concentration of silk fibroin is 5 to 20wt%, the concentration of acryloyl RGD peptide is 5 to 10wt%, the concentration of acryloyl polyethylene glycol NHS ester is 4.5 to 10wt%, the concentration of glucosamine is 10-20mM, the concentration of TD-198946 is 100-200nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25-1wt%. In one embodiment of the present invention, preferably, in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system, the concentration of DNA is 500,000 nM, the concentration of silk fibroin is 10 wt%, the concentration of acryloyl RGD peptide is 5 wt%, the concentration of acryloyl polyethylene glycol NHS ester is 4.5 wt%, the concentration of glucosamine is 10 mM, the concentration of TD-198946 is 100 nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25 wt%.

[0012] The second aspect of the present invention provides a method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention, the specific steps comprising:

[0013] Step 1, construction of a DNA supramolecular network: mixing a Y-shaped DNA single strand and an L-shaped DNA single strand in a phosphate buffered saline solution to obtain a DNA solution, and forming a DNA supramolecular network structure through complementary pairing of sticky end bases;

[0014] Step 2, preparation of DNA-silk fibroin hybrid hydrogel sustained release system:

[0015] Preparation of premix: Mix methacrylylated silk fibroin, acrylylated RGD peptide, acrylylated polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate with the DNA solution in step 1 to obtain a premix of a DNA-silk fibroin hybrid hydrogel sustained-release system;

[0016] Preparation of hydrogel spheres: Digital light processing system technology is used to form hydrogel spheres under ultraviolet light irradiation, namely the final DNA-silk fibroin hybrid hydrogel sustained-release system.

[0017] In one embodiment of the present invention, the concentration of the single-stranded DNA in step 1 is 300,000 nM to 10,00,000 nM, preferably 500,000 nM.

[0018] In one embodiment of the present invention, the concentration of silk fibroin dissolved in the DNA solution in step 2 is 5-20wt%, the concentration of acryloyl RGD peptide is 5-10wt%, the concentration of acryloyl polyethylene glycol NHS ester is 4.5-10wt%, the concentration of glucosamine is 10-20mM, the concentration of TD-198946 is 100-200nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25-1wt%; preferably, the concentration of silk fibroin is 10wt%, the concentration of acryloyl RGD peptide is 5wt%, the concentration of acryloyl polyethylene glycol NHS ester is 4.5wt%, the concentration of glucosamine is 10mM, the concentration of TD-198946 is 100nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25wt%.

[0019] In one embodiment of the present invention, the digital light processing system technology described in step 2, the ultraviolet light is set to 365nm wavelength, 4.0-15.0mW cm -2 Light intensity, the particle size of the printed hydrogel spheres is 500 to 10000 microns.

[0020] Further preferably, in the digital light processing system technology described in step 2, the ultraviolet light is set to a wavelength of 365 nm and 8.0 mW cm -2 Light intensity, the particle size of the printed hydrogel sphere is 2500 μm.

[0021] In a third aspect, the present invention provides a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, wherein the cartilage organoid is prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells through a digital light processing system and then culturing in vitro for 2-6 weeks, and the specific steps include:

[0022] Step 1, preparation of bio-ink: mixing the premix of DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells at a concentration of (1-10)×106 cells / mL to obtain bio-ink;

[0023] Step 2, preparation of cartilage organoids: using digital light processing system technology, the bio-ink is formed into 3D bio-printed spheres under ultraviolet light irradiation. The 3D bio-printed spheres are cultured in vitro with chondrogenic induction medium for 2-6 weeks to obtain cartilage organoids.

[0024] Furthermore, in the digital light processing system technology described in step 2, the ultraviolet light is set to a wavelength of 365nm and a power of 4.0 to 15.0mW cm -2 Light intensity, the particle size of the printed hydrogel spheres is 500-10000 μm.

[0025] Further preferably, in step 2, the hydrogel spheres are cultured in vitro with chondrogenic induction medium for 4 consecutive weeks.

[0026] In a fourth aspect, the present invention provides an application of the cartilage organoid constructed based on the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention, which is selected from one of the following applications:

[0027] (1) Used for preparing cartilage tissue repair materials;

[0028] (2) Used for drug screening;

[0029] (3) Used for disease model construction.

[0030] In a fifth aspect, the present invention provides an application of the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention, which is selected from one of the following applications:

[0031] (1) Cell culture;

[0032] (2) Construction of organizational structure;

[0033] (3) Organoid construction.

[0034] The DNA-silk fibroin hybrid hydrogel can sustainably provide the function of promoting the chondrogenic differentiation of bone marrow mesenchymal stem cells, promoting the efficiency of chondrogenic extracellular matrix synthesis, and preventing the dedifferentiation and hypertrophy of bone marrow mesenchymal stem cells during the long-term differentiation process, which is expected to achieve long-term culture and construction of mature cartilage organoids.

[0035] The present application is proposed based on the above inventive concept.

[0036] Glucosamine is a component of cartilage matrix and a precursor for the synthesis of glycosaminoglycans (such as hyaluronic acid, chondroitin sulfate and dermatan sulfate) and proteoglycans. It can not only stimulate bone marrow mesenchymal stem cells to produce an extracellular matrix that is closer to natural cartilage, but also maintain the stability of chondrocytes and cartilage cell extracellular matrix. In a three-dimensional culture system, with the proliferation of cells and changes in the matrix, local mechanical tension will cause bone marrow mesenchymal stem cells to dedifferentiate and hypertrophy.

[0037] TD-198946, a thiophene azole derivative, is a highly effective chondrogenic inducer. Compared with other chondrogenic inducers, TD-198946 can not only promote hyaline cartilage differentiation of bone marrow mesenchymal stem cells but also inhibit their hypertrophy and dedifferentiation. However, simple drug encapsulation in hydrogels is prone to cause burst release problems. Chemical grafting of drugs into hydrogels is a common strategy to avoid burst release. Currently commonly used drug chemical grafting methods include covalent grafting, molecular imprinting, self-assembly and click chemistry. Compared with other methods, covalent grafting has higher stability, targeting and controllable drug release.

[0038] Acryloyl polyethylene glycol NHS ester is a covalent crosslinker for bifunctional esterification reactions. Its NHS ester functional group can react with the amino groups on glucosamine and TD-198946, and the acrylate group on the other end can react with SilMA. Therefore, the covalent grafting of glucosamine and TD-198946 to the silk fibroin hydrogel network can be achieved with the help of acryloyl polyethylene glycol NHS ester. Therefore, by covalently anchoring glucosamine and TD-198946 to the DNA-silk fibroin hybrid hydrogel through acryloyl polyethylene glycol NHS ester, continuous nutrient supply can be achieved for the long-term culture of cartilage organoids.

[0039] In the scheme of the present invention, the DNA network in the DNA-silk fibroin hybrid hydrogel sustained-release system is formed by single-stranded DNA through base complementary pairing. The DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention is mainly composed of DNA-silk fibroin hybrid hydrogel, and two drugs (glucosamine and TD-198946) are covalently anchored on the silk fibroin hydrogel network by acryloylating polyethylene glycol NHS ester. The introduction of glucosamine in the system can promote the synthesis of cartilage extracellular matrix, the introduction of TD-198946 can promote the cartilage differentiation of bone marrow mesenchymal stem cells, and the acryloylating RGD peptide can provide cell adhesion sites. The hydrogel sustained-release system can realize the long-term culture of bone marrow mesenchymal stem cells in the system by continuously releasing drugs that support the cartilage differentiation of bone marrow mesenchymal stem cells for a long time. Using this system, cartilage organoids that can efficiently repair cartilage defects can be prepared by culturing with bone marrow mesenchymal stem cells in vitro for 2 to 6 weeks, providing a new treatment strategy for repairing cartilage defects.

[0040] Compared with the prior art, the present invention has the following effects:

[0041] First, the NHS ester functional group of the acryloyl polyethylene glycol NHS ester in the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention can react with the amino groups on glucosamine and TD-198946, and the acrylate group at the other end can react with SilMA to covalently anchor glucosamine and TD-198946 to the DNA-silk fibroin hybrid hydrogel, thereby achieving continuous nutrient supply;

[0042] Secondly, the glucosamine and TD-198946 introduced into the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention can significantly improve the efficiency of promoting the chondrogenic differentiation of bone marrow mesenchymal stem cells;

[0043] Thirdly, the present invention can be used as a cartilage graft and transplanted into cartilage defects to promote cartilage regeneration and repair. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1.Preparation flow chart of the DNA-silk fibroin hybrid hydrogel sustained-release system obtained in Example 1 of the present invention.

[0045] Figure 2 . Actual picture of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 1 of the present invention.

[0046] Figure 3 .Scanning electron micrograph of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention.

[0047] Figure 4 .Swelling curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in phosphate buffer solution.

[0048] Figure 5 .Degradation curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in complete cell culture medium.

[0049] Figure 6 .Drug release curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in phosphate buffer solution.

[0050] Figure 7 .Flow chart for preparing the 3D bioprinted sphere obtained in Example 1 of the present invention.

[0051] Figure 8 .Figure 3 of the cell death and viability staining experiment results of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheres in Example 3 of the present invention.

[0052] Fig. 9 . Graph showing the results of a cytoskeleton staining experiment of bone marrow mesenchymal stem cells in 3D bioprinted spheres in Example 3 of the present invention.

[0053] Fig.10 . Graph showing the results of an Alcian blue staining experiment of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheres in Example 3 of the present invention.

[0054] Fig.11 . Macroscopic, HE, Alcian blue, Safranin fast green and immunostaining experimental results of cartilage organoids constructed using the DNA-silk fibroin hybrid hydrogel sustained-release system at different culture periods in Example 4 of the present invention.

[0055] Fig.12 . Macroscopic observation of cartilage repair using the DNA-silk fibroin hybrid hydrogel sustained-release system and cartilage organoids in Example 5 of the present invention. DETAILED DESCRIPTION

[0056] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0057] The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several modifications and improvements may be made without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0058] To complete the contents of the present invention, the experimental reagents, materials or instruments used in the examples were purchased from commercial products unless otherwise specified.

[0059] Example 1

[0060] The preparation of DNA-silk fibroin hybrid hydrogel sustained-release system comprises the following steps:

[0061] Step 1, construction of DNA supramolecular network:

[0062] Mixing DNA single strands: mixing Y-shaped DNA single strands and L-shaped DNA single strands in a phosphate buffer solution at pH 7.4 at 37° C., wherein the total molar concentration of the Y-shaped DNA single strand and the L-shaped DNA single strand is 500,000 nM, to obtain a DNA solution, wherein the Y-shaped DNA single strand and the L-shaped DNA single strand form a DNA supramolecular network structure through complementary pairing of sticky end bases;

[0063] Among them, there are three Y-shaped DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:1; there are two L-shaped DNA single strands, namely L1 and L2, and the molar ratio of L1 to L2 is 1:1; in this embodiment, the molar ratio of the Y-shaped DNA single strand to the L-shaped DNA single strand is 1:1.

[0064] The nucleotide sequences of Y1, Y2, Y3, L1 and L2 are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0065] The nucleotide sequences of the Y-shaped DNA single strand and the L-shaped DNA single strand are as follows:

[0066] Length of single-stranded ssDNA sequence (5' to 3') (nt)

[0067] Y1 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT(SEQ ID NO.1)

[0068] Y2 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT(SEQ ID NO.2)

[0069] Y3 CTCATGATCTCCTTTAGGCAGACAGGTAACTGGACACTT(SEQ ID NO.3)

[0070] L1 CTACGGTGAATGGAATTCTCATGCGAATAGAAAGTGTCCAGTTA

[0071] (SEQ ID NO.4)

[0072] L2 TCTATTCGCATGAGAATTCCATTCACCGTAGAAGTGTCCAGTTA

[0073] (SEQ ID NO.5)

[0074] Step 2, preparation of DNA-silk fibroin hybrid hydrogel sustained release system and 3D bioprinted spheroids

[0075] (1) Preparation of premix: Silk fibroin (methacryloyl silk fibroin, SilMA), acryloyl RGD peptide (Pep-RGDfKAC), acryloyl polyethylene glycol NHS ester (AC-PEG-NHS), glucosamine, TD-198946, 2,4,6-trimethylbenzoyl lithium phosphate and the DNA solution in step 1 are mixed to obtain a DNA-silk fibroin hybrid hydrogel sustained-release system premix. The concentration of each substance in the DNA-silk fibroin hybrid hydrogel sustained-release system premix is: 10wt% silk fibroin, 5wt% acryloyl RGD peptide, 4.5wt% acryloyl polyethylene glycol NHS ester, 10mM glucosamine, 100nM TD-198946, and 0.25wt% 2,4,6-trimethylbenzoyl lithium phosphate.

[0076] (2) Preparation of DNA-silk fibroin hybrid hydrogel sustained-release system: A digital light processing system (which is a prior art, and the one used in this embodiment is EFL-BP8601Pro, and the specific processing method is to add the premixed liquid into the machine tank and print according to the parameters set below) is used to prepare the DNA-silk fibroin hybrid hydrogel sustained-release system premixed liquid obtained in the above steps, and the ultraviolet light is set to 365 nm wavelength and 8.0 mW cm -2 Light intensity, the particle size of the printed hydrogel sphere is 2500 μm.

[0077] (3) Construction of 3D bioprinted spheres: Based on the DNA-silk fibroin hybrid hydrogel sustained-release system premix obtained in Example 1, bone marrow mesenchymal stem cells were added at a concentration of 1×10 6 The cells / mL were mixed with the premix of DNA-silk fibroin hybrid hydrogel sustained-release system, and the digital light processing system was used to set the ultraviolet light to 365 nm wavelength and 8.0 mW cm -2 Light intensity, the particle size of the 3D bioprinted spheres is 2500 microns.

[0078] The flow chart of the preparation of DNA-silk fibroin hybrid hydrogel sustained release system in this example is as follows: Figure 1 As shown, Figure 1 In the figure, Y-scaffold is a Y-shaped DNA single strand, and Linker is an L-shaped DNA single strand. Figure 2 As shown in the figure, it can be seen that the DNA-silk fibroin hybrid hydrogel sustained-release system printed by the digital light processing system has a smooth surface and a complete shape.

[0079] Example 2

[0080] This example mainly examines whether the material properties of the DNA-silk fibroin hybrid hydrogel sustained-release system are helpful in supporting the long-term culture of cartilage organoids.

[0081] The hydrogel spheres obtained in step (2) of the second step in the above Example 1 are used as the DNA-silk fibroin hybrid hydrogel sustained-release system in this example. Figure 3 This is a scanning electron micrograph of the DNA-silk fibroin hybrid hydrogel sustained-release system of Example 2. From the figure, it can be seen that it has a porous structure, which is conducive to the transportation of cell nutrients and the discharge of metabolic waste, as well as cell adhesion.

[0082] Figure 4 This is the swelling curve of the DNA-silk fibroin hybrid hydrogel sustained-release system, which shows that it has good swelling properties and is suitable for long-term 3D cell culture.

[0083] Figure 5 This is the degradation curve of the DNA-silk fibroin hybrid hydrogel sustained-release system in complete cell culture medium. It can be seen from the figure that after 6 weeks, more than 40% of the DNA-silk fibroin hybrid hydrogel sustained-release system still remains. This moderate degradation rate provides favorable conditions for the growth of cartilage organoids, ensuring that the hydrogel can support cell growth and tissue construction during cell expansion, and can gradually degrade during long-term culture without affecting the growth of cartilage tissue.

[0084] Figure 6This is the drug release curve of glucosamine and TD-198946 in the DNA-silk fibroin hybrid hydrogel sustained-release system. It can be seen from the figure that the DNA-silk fibroin hybrid hydrogel sustained-release system can support the sustained release of drugs for up to 4 weeks.

[0085] Example 3

[0086] The 3D bioprinted sphere obtained in step (3) of Example 1 was used as the research object of this example.

[0087] Figure 7 This is a flow chart of preparing 3D bioprinted spheres in step 2 (3) of Example 1. In order to explore the effect of the DNA-silk fibroin hybrid hydrogel sustained-release system on the behavior of bone marrow mesenchymal stem cells, the obtained 3D bioprinted spheres and the cells co-cultured therewith were incubated at 37°C for 15 minutes in the dark using a cell death and viability staining kit, and cell death and viability staining (green represents live cells and red represents dead cells) was performed. The experimental results are shown in the figure. Figure 8 As shown, from Figure 8 It can be seen that the DNA-silk fibroin hybrid hydrogel sustained-release system has good cell compatibility.

[0088] The bone marrow mesenchymal stem cells cultured in the 3D bioprinted spheres were fixed with a universal tissue fixative after one day of culture, and the cell skeleton was stained with a microfilament skeleton staining reagent labeled with phalloidin at room temperature in the dark for 30 minutes. The results are as follows: Fig. 9 As shown in the figure, bone marrow mesenchymal stem cells showed good spreading effect in the DNA-silk fibroin hybrid hydrogel sustained-release system. The 3D bioprinted spheres containing bone marrow mesenchymal stem cells were co-cultured and induced into cartilage for 7 days (7D). After 14 days (14D), the cells were fixed with a universal tissue fixative and incubated with Alcian blue dye for 30 minutes for Alcian blue staining experiment. The experimental results are shown in the figure. Fig.10 As shown, the experimental results showed a relatively significant positive staining signal, indicating that the DNA-silk fibroin hybrid hydrogel sustained-release system has a significant effect in promoting the chondrogenic differentiation of bone marrow mesenchymal stem cells.

[0089] Example 4

[0090] The 3D bioprinted sphere obtained in step (3) of Example 1 was used as the research object of this example.

[0091] The 3D bioprinted spheres were cultured in chondrogenic induction medium for up to 6 weeks to construct cartilage organoids. The cartilage organoids at different culture time points were photographed to observe their macroscopic morphology. The cartilage organoids at different culture time points were then embedded in paraffin and sectioned, and then stained with HE, safranin fast green, and alcian blue. Finally, the cartilage organoids at different culture time points were fixed with a universal tissue fixative, permeated with a rapid permeation solution for 10 minutes, incubated with 10% normal goat serum at room temperature for 2 hours for blocking, and added with a primary antibody solution with a dilution ratio of 1:200 to 1:1000 and incubated overnight at 4°C. The next day, the primary antibody was washed off, and a secondary antibody solution with a dilution ratio of 1:500 and a microfilament skeleton staining reagent labeled with phalloidin were added and incubated at room temperature for 1 hour in the dark. Finally, an anti-fluorescence quenching sealing agent containing DAPI was dropped on the cells for immunofluorescence staining of ACAN, COL II (cartilage marker), COL I (fibrosis marker), and COL X (hypertrophy marker). The experimental results are as follows Fig.11 As shown in the figure, HE experimental results showed that bone marrow mesenchymal stem cells formed tissue-like structures in the hydrogel at the 2nd and 4th weeks. However, at the 6th week, some vacuoles caused by apoptosis appeared inside the hydrogel. Alcian blue staining results showed that the staining signal of cartilage organoids cultured for 4 weeks was the strongest compared with that at the 2nd and 6th weeks, indicating that the content of glycosaminoglycans in cartilage organoids cultured for 4 weeks was the richest. Safranin fast green staining results showed that cartilage organoids at 2, 4 and 6 weeks all showed cartilage-specific red staining, further proving the effective formation of cartilage organoids. Compared with the 2nd and 6th weeks, the staining signal was the strongest at the 4th week, further indicating that the phenotype of cartilage organoids at 4 weeks was closest to natural cartilage. Immunofluorescence staining results showed that the cartilage indicators of cartilage organoids cultured for 4 weeks were highly expressed while maintaining low fibrosis and hypertrophy indicators. This indicates that the 4-week culture period may be the best period for the development of cartilage organoids, showing the most potential cartilage phenotype.

[0092] Example 5

[0093] (1) Construction of rat cartilage defect model: 6-7 week old SD male rats (weighing about 200 g) were selected and, after general anesthesia, the joint capsule was incised to expose the intercondylar notch of the distal femur, and a cartilage defect with a diameter of 2 mm and a depth of 1.5 mm was constructed in the middle with a punch.

[0094] (2) Use DNA-silk fibroin hybrid hydrogel sustained-release system (DSRGT, i.e., the hydrogel sphere without bone marrow mesenchymal stem cells obtained in step (2) of Example 1) and cartilage organoids cultured for 4 weeks (Or, i.e., the 3D bioprinted sphere containing bone marrow mesenchymal stem cells obtained in step (3) of Example 1 cultured in cartilage induction medium for 4 weeks) to repair cartilage defects: transplant the above materials into the cartilage defects, spray fibrin glue on the surface for fixation, and then suture the rats layer by layer. The Sham group is a sham operation group, and the Control group is a group without treatment. The rats were raised normally after surgery, and the rats were killed 8 weeks later to analyze the repair effect.

[0095] This example mainly investigates the repair effect of DNA-silk fibroin hybrid hydrogel sustained-release system and cartilage organoids on cartilage defects. Fig.12 These are the macroscopic observation pictures of the femurs of each group of animals at the 8th week of the experiment. Compared with the control group and the DNA-silk fibroin hybrid hydrogel sustained-release system group, there was almost no cartilage defect in the cartilage organoid group, which was closest to the sham operation group. The results showed that cartilage organoids can promote rapid regeneration and repair of cartilage.

[0096] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that: The DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system obtained by printing a premix of the DNA-silk fibroin hybrid hydrogel sustained-release system through a digital light processing system. Among them, the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system contains DNA, silk fibroin, acryloyl RGD peptide, acryloyl polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate.

2. A DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 1, characterized in that: The DNA exists in the form of a DNA supramolecular network structure in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA is composed of a Y-type DNA single strand and an L-type DNA single strand. There are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:1; there are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 to L2 is 1:1; the molar ratio of the Y-type DNA single strand to the L-type DNA single strand is 1:1-1:2; Y1, Y2, and Y3 all have three sticky ends, L1 and L2 have sticky ends at both ends, and the L-type DNA single strand can be completely complementary to the sticky end of the Y-type DNA single strand; The nucleotide sequences of Y1, Y2, Y3, L1 and L2 are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively.

3. A DNA-silk fibroin hybrid hydrogel sustained release system according to claim 1, characterized in that: In the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system, the concentration of DNA is 300,000nM to 10,00,000nM, the concentration of silk fibroin is 5 to 20wt%, the concentration of acryloyl RGD peptide is 5 to 10wt%, the concentration of acryloyl polyethylene glycol NHS ester is 4.5 to 10wt%, the concentration of glucosamine is 10 to 20mM, the concentration of TD-198946 is 100 to 200nM, and the concentration of 2,4,6-trimethylbenzoyl lithium phosphate is 0.25 to 1wt%.

4. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to any one of claims 1 to 3, characterized in that: The specific steps include: Step 1, construction of a DNA supramolecular network: mixing a Y-shaped DNA single strand and an L-shaped DNA single strand in a phosphate buffered saline solution to obtain a DNA solution, and forming a DNA supramolecular network structure through complementary pairing of sticky end bases; Step 2, preparation of DNA-silk fibroin hybrid hydrogel sustained release system: Preparation of premix: Mix methacrylylated silk fibroin, acrylylated RGD peptide, acrylylated polyethylene glycol NHS ester, glucosamine, TD-198946 and 2,4,6-trimethylbenzoyl lithium phosphate with the DNA solution in step 1 to obtain a premix of a DNA-silk fibroin hybrid hydrogel sustained-release system; Preparation of hydrogel spheres: Digital light processing system technology is used to form hydrogel spheres under ultraviolet light irradiation, namely the final DNA-silk fibroin hybrid hydrogel sustained-release system.

5. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 4, characterized in that: The digital light processing system technology described in step 2, the ultraviolet light is set to 365nm wavelength, 4.0~15.0mW cm -2 Light intensity, the particle size of the printed hydrogel spheres is 500-10000 μm.

6. A cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that: The cartilage organoid is prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system according to any one of claims 1 to 3 and bone marrow mesenchymal stem cells through a digital light processing system and culturing in vitro for 2 to 6 weeks, comprising the following steps: Step 1, preparation of bio-ink: mixing the premix of DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells at a concentration of (1-10)×106 cells / mL to obtain bio-ink; Step 2, preparation of cartilage organoids: using digital light processing system technology, the bio-ink is formed into 3D bio-printed spheres under ultraviolet light irradiation. The 3D bio-printed spheres are cultured in vitro with chondrogenic induction medium for 2-6 weeks to obtain cartilage organoids.

7. The cartilage organoid according to claim 6, characterized in that The digital light processing system technology described in step 2, the ultraviolet light is set to 365nm wavelength, 4.0~15.0mW cm -2 Light intensity, the particle size of the printed hydrogel spheres is 500-10000 μm.

8. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 4, characterized in that: In step 2, the hydrogel spheroids were cultured in vitro with chondrogenic induction medium for 4 consecutive weeks.

9. The use of cartilage organoids according to claim 6, characterized in that: Select one of the following applications: (1) Used for preparing cartilage tissue repair materials; (2) Used for drug screening; (3) Used for disease model construction.

10. Use of the DNA-silk fibroin hybrid hydrogel sustained-release system according to any one of claims 1 to 3, characterized in that: Select one of the following applications: (1) Cell culture; (2) Construction of organizational structure; (3) Organoid construction.

Images