Glycine oxidase mutant strain as well as construction method and application thereof in nucleoside production

Abstract

The invention provides a glycine oxidase mutant strain as well as a construction method and application thereof in nucleoside production. A new microorganism capable of efficiently producing nucleoside is successfully constructed by performing point mutation on a thiO gene (enabling the 143rd amino acid of a ThiO protein coded by the thiO gene to be subjected to nonsense mutation) or directly knocking out the gene in wild type or bacillus amyloliquefaciens or bacillus subtilis with nucleoside production capacity by utilizing a genetic engineering technology.

Description

Technical Field

[0001] The invention relates to the fields of bioengineering and microbial fermentation, and in particular to a glycine oxidase mutant strain and a construction method thereof, as well as an application in nucleoside production. Background Art

[0002] Nucleoside is a general term for a class of glycosides. Nucleoside is a component of nucleic acid and nucleotide. Nucleoside is formed by the condensation of D-ribose or DZ-deoxyribose with pyrimidine base or purine base. Nucleoside is generally a colorless crystal, insoluble in common organic solvents, easily soluble in hot water, with a melting point of 160-240°C. Nucleosides generated from D-ribose are called ribonucleosides, which participate in the composition of RNA, and nucleosides generated from D-α-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine or uracil to generate the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside and uracil ribonucleoside, which are respectively referred to as adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uridine (U).

[0003] Guanosine (guanosine) and inosine (inosine) play a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as food flavor enhancers, and are widely used in condiments such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for a variety of antiviral drugs, such as acyclovir, triazole nucleoside, and sodium guanosine triphosphate, which all require guanosine as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for the synthesis of adenosine (AMP) and guanylate (GMP), which is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons. In addition, it can also treat central retinitis and optic atrophy.

[0004] Adenosine is adenine nucleoside, and its chemical name is 6-amino-9-β-D-ribofuranosyl-9-hydrogen purine. It is the product of adenine nucleotide dephosphorylation and is an important nucleotide derivative. Adenosine is an endogenous nucleoside that is found throughout human cells. It can directly enter the myocardium and generate adenosine acid through phosphorylation, and participate in myocardial energy metabolism. It also participates in dilating coronary vessels and increasing blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. In addition to being used as a specific drug for treating the heart, adenosine is also an important intermediate for the synthesis of adenosine triphosphate (ATP), adenine, adenosine acid, and adenosine arabinoside, and is widely used in the pharmaceutical and other industries.

[0005] At present, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus. In the process of selecting and transforming the growing strains, ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding are used to selectively select high-yielding strains of nucleosides; or according to the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are deeply understood, and the strains are purposefully transformed through metabolic engineering methods to obtain production strains with excellent traits and high nucleoside production. However, the fermentation performance of nucleoside strains is still poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. Summary of the invention

[0006] The purpose of the present invention is to provide a glycine oxidase mutant strain and a construction method thereof as well as an application thereof in nucleoside production.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a modified microorganism, wherein the activity of glycine oxidase (encoded by thiO gene) is reduced or lost compared to an unmodified microorganism, and the microorganism has an enhanced nucleoside production capacity compared to an unmodified microorganism.

[0008] In the present invention, the reference sequence number of the glycine oxidase in NCBI is CAB13024.1.

[0009] Further, the reduction or loss of glycine oxidase activity in the microorganism is achieved by selecting from the following 1)-3), or an optional combination:

[0010] 1) reducing or losing the glycine oxidase by changing the amino acid sequence of the glycine oxidase;

[0011] 2) reducing or losing the glycine oxidase by changing the nucleotide sequence encoding the glycine oxidase;

[0012] 3) Loss by knocking out the coding sequence of the glycine oxidase.

[0013] Furthermore, mutagenesis, site-directed mutagenesis or homologous recombination are used to reduce the expression of the gene encoding the glycine oxidase or knock out the gene encoding the glycine oxidase.

[0014] In a specific embodiment of the present invention, the reduction or loss of glycine oxidase activity is achieved by mutating the base encoding the 143rd amino acid of glycine oxidase into a terminator.

[0015] The microorganism can be Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, etc. For example, the starting strain is B. subtilis 168, B. subtilis A5 (see CN110257315B), Ba 836 (see CN112574934B).

[0016] In a second aspect, the present invention provides a method for constructing a nucleoside-producing strain, the method comprising: utilizing genetic engineering means to inactivate or weaken the gene encoding glycine oxidase in the microorganism.

[0017] The weakening is achieved by selecting from the following a) to c), or any combination thereof:

[0018] a) reducing or losing the glycine oxidase by changing the amino acid sequence of the glycine oxidase;

[0019] b) reducing or losing the glycine oxidase by changing the nucleotide sequence encoding the glycine oxidase;

[0020] c) Loss by knocking out the coding sequence of the glycine oxidase.

[0021] The weakening method can be selected from at least one of mutagenesis, site-directed mutagenesis, homologous recombination, and the like.

[0022] Preferably, the weakening is achieved by mutating the base encoding the 143rd amino acid of glycine oxidase into a terminator.

[0023] In a third aspect, the present invention provides a glycine oxidase mutant strain constructed according to the method.

[0024] In a fourth aspect, the present invention provides the use of the microorganism or the glycine oxidase mutant strain constructed according to the method in the fermentation production of nucleosides or nucleoside derivatives or in increasing the fermentation yield of nucleosides or nucleoside derivatives.

[0025] The nucleoside derivatives of the present invention include, but are not limited to, nucleosides such as inosine, guanosine or adenosine or corresponding nucleoside derivatives, such as hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, adenosine triphosphate (ATP), adenine, adenosine, adenosine arabinoside, etc.

[0026] In a fifth aspect, the present invention provides a method for producing nucleosides, the method comprising the steps of:

[0027] i) culturing the microorganism or the glycine oxidase mutant strain constructed according to the method to obtain a culture;

[0028] ii) collecting the produced nucleosides from the culture obtained in step i).

[0029] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0030] The invention provides a Bacillus amyloliquefaciens or Bacillus subtilis, in which a nonsense mutation occurs in the 143rd lysine or glutamine encoding glycine oxidase in the cell, or the gene is directly knocked out, so that the ability of the strain to produce nucleosides is enhanced compared with that of an unmodified strain.

[0031] Bacillus amyloliquefaciens Bs 833 and Ba 836 (which have a certain ability to produce guanosine or inosine) were used as starting strains to construct yrhL gene weakened strains, and the weakening method was to perform point mutation on the yrhL gene and / or completely knock out its entire ORF frame. The strains obtained by construction have improved nucleoside production capabilities to varying degrees. At the same time, the present invention uses Bacillus subtilis B.subtilis A5 (which has a certain ability to produce adenosine or inosine) as a starting strain to construct a yrhL mutation and / or completely knock out its entire ORF frame. The engineered strains obtained by construction have a certain improvement in their ability to produce inosine or adenosine.

[0032] The above modification can be applied to Bacillus amyloliquefaciens or Bacillus subtilis, but is not limited to the above two strains, such as host bacteria such as Bacillus pumilus and Escherichia coli, for producing nucleosides such as inosine, guanosine or adenosine or corresponding nucleoside derivatives, such as hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, adenosine triphosphate (ATP), adenine, adenylic acid, adenosine arabinoside, etc. DETAILED DESCRIPTION

[0033] The present invention aims to provide a glycine oxidase mutant and a construction method and application thereof, and specifically relates to the construction and application of a glycine oxidase ThiO (Glycine oxidase, encoded by thiO gene) mutant.

[0034] The study found that by modifying the glycine oxidase (encoded by the thiO gene) of Bacillus subtilis or Bacillus amyloliquefaciens, the activity of the ThiO protein was weakened, so that the microorganisms could efficiently and quickly generate guanosine or inosine nucleoside, and successfully created a new microorganism capable of efficiently producing nucleosides, thereby completing the present invention.

[0035] Wherein, weakening or inactivation is achieved by any of the following methods:

[0036] 1) By means of amino acid mutation or knockout, the activity of the protein encoded by thiO is reduced or inactivated compared with the wild type.

[0037] 2) A nonsense mutation or knockout of the 143rd amino acid of ThiO protein results in reduced or no activity of the protein encoded by thiO.

[0038] At present, there are reports that weakening ThiO expression can improve the ability of microorganisms to produce nucleosides. The present invention is the first to obtain corresponding mutants that can efficiently produce nucleosides by interrupting or knocking out in Bacillus amyloliquefaciens or Bacillus subtilis.

[0039] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0040] The primer names and primer sequences involved in the following examples are shown in Table 1.

[0041] Table 1 Primer names and sequence information

[0042] Primer Name Primer Sequence (5′-3′) A5-thiO-143-1f acaaaataaggatcctctagaaaacggattgcaaaaagggtc A5-thiO-143-1r ggctccacatgcacatcatcctaaataaaagatgcaccaaag A5-thiO-143-2f ctttggtgcatcttttatttaggatgatgtgcatgtggagcctta A5-thiO-143-2r gccaagcttgcatgcctgcaggatgagatcactgatcaaagcgc A5-DthiO-1f acaaaataaggatcctctagaagccggtagaagagctagcga A5-DthiO-1r tctgaaccgcctccttgcgatcttgtcgttctgccgcccattg A5-DthiO-2f acaatgggcggcagaacgacaagatcgcaaggaggcggttcaga A5-DthiO-2r gccaagcttgcatgcctgcaggattccttgtcctgatccaatcg thiO-143-1f acaaaataaggatcctctagattcattcgctgaaagaagcgg thiO-143-1r gctcgacatggacatcgtcttAtataaaacttgcgccgagaatgt thiO-143-2f attctcggcgcaagttttataTaagacgatgtccatgtcgagccgt thiO-143-2r gccaagcttgcatgcctgcagtcgatcccaatcaatttgttttc DthiO-1f acaaaataaggatcctctagaattctttcgattcagcatgaagtg DthiO-1r cacctgtttccccaggatcatcgcatgagcacccagcattcc DthiO-2f ggaatgctgggtgctcatgcgatgatcctggggaaacaggtg DthiO-2r gccaagcttgcatgcctgcagggcctgaaccgatcggtg

[0043] Example 1: ThiO in Bacillus amyloliquefaciens K143* Construction of mutant strains

[0044] Using the DSM7 genome as a template, thiO-143-1f / / thiO-143-1r, thiO-143-2f / thiO-143-2r primer pairs and pfu high-fidelity DNA polymerase were used to amplify the upstream and downstream homologous arms of thiO. The obtained fragments were recovered and fused, and ThiO was amplified. K143*The full-length fragment was recovered by gel extraction (ThiO EC number is 1.4.3.19). The pKSU plasmid (pKSU plasmid was kindly donated by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production [J], Applied Microbiology and Biotechnology, 2014, 98 (21): 8963-8973. Zhang W, Gao W, Feng J, et al DOI: 10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and recovered by gel extraction. The linearized plasmid and ThiO were assembled using an assembly kit. K143* The fragments were assembled and transformed into TransT1 competent cells, and then the recombinant plasmid pKSU-ThiO was obtained by identification and screening. K143* The strains were transformed into the laboratory-constructed Ba 836 (see CN112574934A) and the wild-type strain DSM7, and the transformants were screened at 30°C on an LB plate containing 2.5 μg / mL chloramphenicol. The obtained transformants were inoculated into 5 ml LB liquid culture medium, cultured at 42°C and 200 rpm for 12 h and propagated for one generation, and diluted and coated on an LB plate containing 5 μg / mL chloramphenicol to obtain the primary recombinant; the primary recombinant was inoculated into 5 ml LB liquid culture medium, cultured at 42°C and 200 rpm for 12 h and propagated for one generation, and diluted and coated on an LB plate containing 0.8 μM 5-FU to screen the secondary recombinant. The strains with nonsense mutation at position 143 of lysine obtained by screening were named Ba 8502 and Ba 8503.

[0045] The gene sequence encoding glycine oxidase in Bacillus amyloliquefaciens is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0046] Example 2 Construction of thiO knockout strain in Bacillus amyloliquefaciens

[0047] The primer pairs DthiO-1f / DthiO-1r, DthiO-2f / DthiO-2r and the genome of DSM7 strain were used as templates to amplify and fuse the left homologous arm DthiO-L and DthiO-R fragments. The full-length fragment of DthiO was obtained by constructing the pKSU-DthiO plasmid according to the construction method of the plasmid in Example 1, which was transformed into the laboratory-constructed Ba 836 and wild-type strain DSM7 strains, and the thiO knockout strains were screened and named Ba 8504 and Ba 8505.

[0048] Example 3: ThiO in Bacillus subtilis Q143* Construction of mutant strains

[0049] The primer pairs A5-thiO-143-1f / A5-thiO-143-1r and A5-thiO-143-2f / A5-thiO-143-2r were used respectively, and the genome of strain 168 was used as a template to amplify and obtain the left homologous arm A5-thiO-143-L and A5-thiO-143-R fragments and fuse them. Q143* The full-length fragment (the number of ThiO on NCBI is CAB13024.1, and the EC number is 1.4.3.19). The plasmid pKSU-ThiO was obtained according to the construction method of Example 1. Q143* The plasmid was transformed into B. subtilis A5 strain and wild-type B. subtilis 168 strain, and the strains with nonsense mutation at position 143 of glutamine obtained by screening were named B. subtilis A0102 and B. subtilis A0103.

[0050] The gene sequence encoding glycine oxidase in Bacillus subtilis is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4.

[0051] Example 4: Construction of thiO knockout strain in Bacillus subtilis

[0052] The primer pairs A5-DthiO-1f / A5-DthiO-1r, A5-DthiO-2f / A5-DthiO-2r, and 168 strain genome were used as templates to amplify and fuse the left homologous arm A5-DthiO-L and A5-DthiO-R fragments. The full-length fragment of A5-DthiO was obtained. The pKSU-A5-DthiO plasmid was constructed according to the construction method of the plasmid in Example 1, and transformed into B. subtilis A5 and wild-type B. subtilis 168 strains, and the thiO knockout strains were screened and named B. subtilis A0104 and B. subtilis A0105.

[0053] Example 5: Real-time quantitative fluorescence PCR verification of ThiO expression level in modified bacteria

[0054] The engineered bacteria B.a8502-8505 and its control bacteria B.a836 / DSM7, as well as B.subtilis A0102-0105 and its control strain B.subtilis A5 / B.subtilis168 were cultured in LB medium until the logarithmic growth phase. 1 mL of bacterial solution was treated with an appropriate amount of lysozyme to extract total RNA for reverse transcription, and real-time quantitative PCR reaction was performed using cDNA as a template. Reaction conditions: 95℃ pre-denaturation for 10 min; 95℃ for 15 s, 60℃ for 1 min, 40 cycles. After the reaction, the transcription level of the relevant genes was calculated using the bacterial 16S rRNA as a reference according to the 2-ΔΔCT method. The results showed that the expression level of ThiO in the engineered strain B.a8502 was 15 times lower than that in B.a836, the expression level of B.a8504 was 10 times lower than that in DSM7, and ThiO expression was not detected in B.a8503 and B.a8505 strains; the expression level of the engineered strain B.subtilis A0102 was 7.8 times lower than that in the control strain B.subtilis A5, the expression level of A0104 was 6 times lower than that in the control strain B.subtilis 168, and ThiO expression was not detected in B.subtilis A0103 and B.subtilisA0105. This shows that the above Examples 1-4 reduce the expression level of ThiO or even completely eliminate its expression.

[0055] Example 6: Verification of glycoside production performance of engineered strains

[0056] 1. Culture the bacteria stored in glycerol overnight at 37°C and isolate a single colony.

[0057] 2. Pick a single colony and inoculate it into 30 mL of seed culture medium (20 g / L glucose, 5 g / L yeast powder, 5 g / L corn steep liquor powder, 3 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.02 g / L ferrous sulfate, 0.01 g / L manganese sulfate, pH 7.0-7.2), and culture at 110 rpm and 37°C for 7-8 h.

[0058] 3. Transfer the inoculum to 30 ml fermentation medium (120 g / L glucose, 3.5 g / L yeast powder, 3 g / L potassium dihydrogen phosphate, 25 g / L ammonium sulfate, 0.01 g / L manganese sulfate, 5 g / L magnesium sulfate, 10 g / L sodium glutamate, 15 g / L corn steep liquor powder, 25 g / L calcium carbonate, pH 7.0-7.2) at a 10% (v / v) inoculum volume, shake at 130 rpm, and culture at 35 °C for 72 or 48 h (B. a8502-8505 strain fermentation for 72 h; B. subtilis A0102-0105 strain fermentation for 48 h).

[0059] 4. Use liquid chromatography to detect the glycosides produced in the fermentation broth (Table 2).

[0060] Table 2 Evaluation results of guanosine and inosine production by shake flask fermentation of mutant strains (mean of three replicates)

[0061]

[0062] From the above results, it can be seen that mutating the lysine or glutamine at position 143 of ThiO to a stop codon or knocking out the gene can improve the ability to produce nucleosides in wild-type Bacillus subtilis / Bacillus amyloliquefaciens or in Bacillus subtilis / Bacillus amyloliquefaciens with the ability to produce nucleosides.

[0063] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A modified microorganism, characterized in that The microorganism has reduced or lost glycine oxidase activity compared to an unmodified microorganism, and the microorganism has enhanced nucleoside production capacity compared to an unmodified microorganism; The reference sequence number of the glycine oxidase in NCBI is CAB13024.

1.

2. The microorganism according to claim 1, characterized in that The reduction or loss of glycine oxidase activity in the microorganism is achieved by selecting from the following 1)-3), or an optional combination: 1) reducing or losing the glycine oxidase by changing the amino acid sequence of the glycine oxidase; 2) reducing or losing the glycine oxidase by changing the nucleotide sequence encoding the glycine oxidase; 3) Loss by knocking out the coding sequence of the glycine oxidase.

3. The microorganism according to claim 2, characterized in that The method of mutagenesis, site-directed mutagenesis or homologous recombination is used to reduce the expression of the gene encoding the glycine oxidase or knock out the gene encoding the glycine oxidase.

4. The microorganism according to claim 1, characterized in that The reduction or loss of glycine oxidase activity is achieved by mutating the base encoding the 143rd amino acid of glycine oxidase into a terminator.

5. The microorganism according to any one of claims 1 to 4, characterized in that The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

6. A method for constructing a glycine oxidase mutant strain, characterized in that: The method comprises: using genetic engineering means to inactivate or weaken the coding gene of glycine oxidase in the microorganism; The weakening is achieved by selecting from the following a) to c), or any combination thereof: a) reducing or losing the glycine oxidase by changing the amino acid sequence of the glycine oxidase; b) reducing or losing the glycine oxidase by changing the nucleotide sequence encoding the glycine oxidase; c) lost by knocking out the coding sequence of the glycine oxidase; The reference sequence number of the glycine oxidase in NCBI is CAB13024.

1.

7. The method according to claim 6, characterized in that The weakening method is selected from at least one of mutagenesis, site-directed mutagenesis, and homologous recombination; Preferably, the weakening is achieved by: mutating the base encoding the 143rd amino acid of glycine oxidase into a terminator; The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

8. A glycine oxidase mutant strain constructed according to the method of claim 6 or 7.

9. Use of the microorganism according to any one of claims 1 to 5 or the glycine oxidase mutant strain according to claim 8 in the fermentation production of nucleosides or nucleoside derivatives or in increasing the fermentation yield of nucleosides or nucleoside derivatives; The nucleosides or nucleoside derivatives include inosine, guanosine, adenosine, hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, adenosine triphosphate, adenine, adenylic acid, and vidarabine.

10. A method for producing nucleosides, characterized in that: The method comprises the following steps: i) culturing the microorganism according to any one of claims 1 to 5 or the glycine oxidase mutant strain according to claim 8 to obtain a culture; ii) collecting the produced nucleosides from the culture obtained in step i).

Images