Medical application of phellinus linteus in medicine for inhibiting activity of cryptosporidium parvum FBA

Abstract

The invention discloses a medical application of phellinus igniarius in a medicine for inhibiting the activity of cryptosporidium parvum FBA, provides a medical application of phellinus igniarius in a medicine for inhibiting the activity of cryptosporidium parvum FBA, and discloses that phellinus igniarius can inhibit the activity of rC.pFBA, destroy the normal form of sporozoites, reduce the glycolysis level of sporozoites and relieve the infection of cryptosporidium parvum. The composition can relieve intestinal pathologic symptoms including intestinal villus shortening and erosion, recover the expression quantity of intestinal barrier related proteins and inflammatory factor level, reduce oocyst discharge and the like, and can be prepared into medicines for resisting cryptosporidium parvum.

Description

Technical Field

[0001] The invention discloses the medical use of Morin in a drug for inhibiting the FBA activity of Cryptosporidium parvum, relates to a new medical use of the natural flavonoid compound Morin, and belongs to the technical field of anti-parasitic infection drugs. Background Art

[0002] Cryptosporidium parvum ( Cryptosporidium parvum ) is a protozoan parasite that is common to humans and animals worldwide. It parasitizes in intestinal epithelial cells, causing symptoms such as diarrhea and poor nutrient absorption, and ultimately leading to growth retardation or even death. Currently, only one drug, nitazoxanide, is approved by the FDA for the treatment of cryptosporidiosis, but the drug is ineffective for patients with low or defective immunity. Apart from this, there is no safe and effective drug or vaccine to prevent and treat cryptosporidiosis. Therefore, finding effective drug targets is very important for screening or developing drugs to prevent and treat cryptosporidiosis.

[0003] Cryptosporidium parvum is an obligate intracellular parasite with highly ablated mitochondria. It cannot rely on the classic tricarboxylic acid cycle to generate ATP. Its main energy source comes from the transport and utilization of host nutrients and the glycolysis pathway. Cryptosporidium parvum encodes all genes in the glycolysis pathway. Among them, inhibitors of pyruvate kinase and lactate dehydrogenase show good anti-Cryptosporidium effects, indicating that targeting enzymes in the glycolysis pathway may be of guiding significance for the development of Cryptosporidium drugs. However, fructose 1,6-bisphosphate aldolase (FBA), as an important enzyme in the glycolysis pathway of Cryptosporidium parvum, has not yet been characterized. Previous studies have attempted to knock out FBA in Cryptosporidium parvum, but multiple attempts have failed, indicating that FBA is essential for glycolysis and growth and development of Cryptosporidium parvum. In addition, fructose 1,6-bisphosphate aldolase has also been widely studied as a drug target in the fields of anticancer drugs, antibacterial drugs, and antimalarial drugs.

[0004] Morinol is a natural flavonoid compound, a new natural dietary bioactive compound with multiple biological and pharmacological potentials, and is reported to have anti-inflammatory, antibacterial, and antioxidant stress activation properties. Morinol affects the progression of diseases such as vascular inflammation, Parkinson's disease, and liver cancer through signaling pathways such as AMPK, NF-κB, Nrf2 / HO-1, Bax / Bcl2 / Caspase-3, etc. Summary of the invention

[0005] The present invention discloses the medical use of mulberry flavonoids in drugs for inhibiting the FBA activity of Cryptosporidium parvum, explores the anti-insect effect of mulberry flavonoids on the FBA activity of Cryptosporidium parvum, seeks reliable targets for preventing and treating cryptosporidiosis, and seeks new highly effective, safe and drug-resistant drugs.

[0006] Through in vitro and in vivo experiments, the present invention found that Morin affects the glycolysis level of Cryptosporidium parvum in vitro, damages the normal morphology, and inhibits the proliferation and pathogenicity of Cryptosporidium parvum in HCT-8 cells, including reducing the load of worms, restoring the expression of intestinal barrier-related proteins and the level of inflammatory factors. Morin can alleviate the decline in weight growth rate caused by Cryptosporidium parvum infection, reduce the amount of oocysts in feces, reduce intestinal pathological damage, and restore the expression of intestinal barrier-related proteins and the level of inflammatory factors in vivo. The drug is a natural flavonoid compound Morin, and the half-inhibitory concentration for the activity of recombinant Cryptosporidium parvum FBA is 20.12μM (IC50=20.12μM).

[0007] The present invention provides a technical solution for inhibiting the FBA activity of Cryptosporidium parvum with mulberry flavonoids and detecting its anti-insect effect in vivo and in vitro: To prepare the recombinant Cryptosporidium parvum FBA protein rC.pFBA, the prokaryotic expression plasmid pGEX-4T-FBA was first constructed, and then pGEX-4T-FBA was transferred into the expression host BL21 (DE3) using the heat shock method. After that, the strain was induced to express and the recombinant protein was purified. After purification, the purification effect was detected by SDS-PAGE. Finally, the enzyme activity was determined to show that the recombinant rC.pFBA had fructose 1,6-bisphosphate aldolase activity. The enzymatic reaction system contained 200 ng rC.pFBA, 0.2 mM FBP, 0.3 mM NADH, 0.2 mg / mL BSA, 1U / mL triphosphate isomerase, and 1U / mL α-glycerophosphate dehydrogenase, and the absorbance change of the reaction system at 340nM was measured. GST-tagged protein was used as a control. The inhibitory effect of mulberry flavonoids on enzyme activity was determined by measuring the effect of different concentrations of mulberry flavonoids (3.9, 7.8, 15.6, 31.2, 62.5, 125 μM) on the enzymatic reaction rate of recombinant rC.pFBA in vitro. The effect of mulberry flavonoids on the morphology of Cryptosporidium parvum sporozoites was observed by scanning electron microscopy. Sporozoites of Cryptosporidium parvum were incubated with different concentrations of mulberry flavonoids, and glycolysis indicators such as glucose uptake and ATP content were detected. The in vitro anti-Cryptosporidium effect of mulberry flavonoids was explored in HCT-8 cells. Sporozoites of Cryptosporidium parvum were incubated with different concentrations of mulberry flavonoids for 3 h and a control group was set up. Then, they were added to HCT-8 cells, and the non-invaded sporozoites were washed away for 3 h and continued to be cultured for 48 h. After that, cell samples were collected for qRT-PCR to detect the load of worms, Western blot to detect the expression of intestinal barrier-related proteins, and qRT-PCR to detect the transcription level of inflammatory factors. The in vivo anti-Cryptosporidium effect of mulberry flavonoids was investigated in suckling mice. 7-day-old suckling mice were selected, and the mice were attacked and dosed according to the grouping and procedure on days 1-5. The body weight of the suckling mice was recorded every day during the experiment. Fecal and intestinal samples were collected on the 6th day to detect the number of oocysts in the feces, intestinal pathological damage, intestinal mucin content, intestinal barrier protein expression and inflammatory factor transcription levels.

[0008] The method of inhibiting the FBA activity of Cryptosporidium parvum by the mulberry flavonoids of the present invention and detecting its insect-resistant effect in vivo and in vitro comprises the following steps: (1) Construction of prokaryotic expression vector pGEX-4T-FBA Primers were designed to amplify the C.pFBA gene of Cryptosporidium parvum by PCR. The sequence is as follows: F: CGGATCCATGTCAATCTGTCAAGAAAGAGC; R: CCGCTCGAGGTAAACATAAGACTTGACGAATAATC; The genomic DNA of Cryptosporidium parvum oocysts was extracted and used as a template for PCR amplification of C.pFBA. Then, C.pFBA was inserted between the BamH I and Xho I restriction sites of the pGEX-4T-1 vector using the double restriction enzyme method to construct the prokaryotic expression vector pGEX-4T-FBA. The construction of the recombinant plasmid was verified by double restriction enzyme digestion.

[0009] (2) Expression and purification of recombinant rC.pFBA The pGEX-4T-FBA recombinant plasmid was transferred into the expression host BL21 (DE3) using the heat shock method, and the expression was induced using the conditions of 16°C, 140rpm / min, and 0.1mM IPTG for 20 h. The bacteria were broken and SDS-PAGE was used to detect the expression of the recombinant protein in the supernatant and precipitate. After confirming the expression of the supernatant, large-scale shaking was performed and the recombinant protein (rC.pFBA) was purified using an affinity chromatography column containing a GST-tag purification resin filler. The components at each stage were collected and the purification was detected by SDS-PAGE.

[0010] (3) Detection of recombinant rC.pFBA enzyme activity After rC.pFBA purification, the recombinant protein was concentrated and ultrafiltered using an ultrafiltration tube, and the glutathione eluent was replaced with PBS to measure the protein concentration. FBA catalyzes fructose-1,6-bisphosphate (FBP) to produce dihydroxyacetone phosphate and glyceraldehyde 3phosphate during glycolysis. Under the action of 3-phosphoglycerate dehydrogenase (GDH) and triosephosphate isomerase (TPI), the above substances are catalyzed to produce 3-phosphoglycerate, and NADH is converted into NAD + , the catalytic reaction continues. The substrate NADH in the reaction has light absorption at 340nm, so the rate of change of NADH content is used to represent the rate of enzymatic reaction. Use different concentrations of NADH solution (25, 50, 100, 200, 400, 600, 800μM), measure its light absorbance at 340nm, and establish an absorbance (340nm)-NADH concentration standard curve. Enzyme activity determination: The enzymatic reaction system contains 200 ng rC.pFBA, 0.2 mM FBP, 0.3mM NADH, 0.2 mg / mL BSA, 1U / mL triphosphate isomerase, and 1U / mL α-glycerophosphate dehydrogenase. The control group uses an equal amount of GST-tagged protein.

[0011] (4) Determination of the inhibitory effect of mulberry flavonoids on rC.pFBA enzyme activity The inhibitory effect of mulberry flavonoids on the enzyme activity was determined by in vitro determination of the effect of different concentrations of mulberry flavonoids (3.9, 7.8, 15.6, 31.2, 62.5, 125 μM) on the enzymatic reaction rate of recombinant rC.pFBA. The components and determination steps of the enzymatic reaction system were the same as above. Graphpad pism9.5 was used to process and analyze the data, fit the curve and calculate the IC50 of the inhibitory concentration of mulberry flavonoids on the enzyme activity of rC.pFBA.

[0012] (5) Determination of the effects of mulberry flavonoids on the morphology and glycolysis level of Cryptosporidium parvum Morinol (50 μM) was used to incubate Cryptosporidium parvum sporozoites, and its effect on the normal morphology of sporozoites was observed under a scanning electron microscope. Different concentrations of Morinol (12.5, 25, 50 μM) were used to incubate Cryptosporidium parvum sporozoites for 3 hours, and the glucose uptake and ATP content were detected according to the kit instructions to reflect the changes in the glycolysis level. The above experiments were all set up as controls for sporozoites that were not incubated with Morinol.

[0013] (6) Determination of the anti-Cryptosporidium effect of mulberry flavonoids in vitro Effect of mulberry flavonoids on the proliferation of Cryptosporidium parvum: Cryptosporidium parvum sporozoites were incubated with different concentrations of mulberry flavonoids (12.5, 25, 50 μM) for 3 h, and then 2*10 6 / well Cryptosporidium parvum sporozoites were inoculated into 12-well plates and grown to 80% of HCT-8 cells. After 3 hours, the uninvaded sporozoites were washed with PBS and cultured for 48 hours. Samples were collected using Trizol, and total RNA was extracted and reverse transcribed into cDNA for qRT-PCR detection. C. parvum 18S rRNA and Hs 18S rRNA The relative level of —△△CT relative insect load Effect of mulberry flavonoids on the pathogenicity of Cryptosporidium parvum: Cell culture, parasite inoculation and drug treatment were the same as above, and the groups were set as control group (control), Cryptosporidium parvum infection group (Cp), 12.5μM mulberry flavonoids incubation infection group (M12.5+Cp), 25μM mulberry flavonoids incubation infection group (M25+Cp), 50μM mulberry flavonoids incubation infection group (M50+Cp). After 48h, RIPA lysed cells and collected protein samples for Western blot detection of intestinal barrier-related proteins Claudin3, Occludin, and ZO-1 expression, Trizol collected samples, extracted total RNA and reverse transcribed into cDNA for qRT-PCR detection of inflammatory factors TNF-α, IL-6, and IL-12 transcription levels.

[0014] (7) Determination of the anti-Cryptosporidium effect of mulberry flavonoids in vivo Animal grouping, parasite infection and drug treatment: 7-day-old suckling mice were divided into control group (control), Cryptosporidium parvum infection group (Cp), infection + low-dose mulberry flavonoids group (M20+Cp), infection + medium-dose mulberry flavonoids group (M40+Cp), infection + high-dose mulberry flavonoids group (M60+Cp), high-dose mulberry flavonoids group (M60), and infection + solvent control group (DMSO+Cp). 5 The mice were inoculated with oocysts / mouse by oral gavage. On days 2-5 after infection, the mice were given drugs. The control group was gavaged with PBS, the DMSO+Cp group was gavaged with 5% DMSO, and the other groups were gavaged with mulberry flavonoids stored in DMSO at a dose of 20 mg / kg / day, 40 mg / kg / day, and 60 mg / kg / day, respectively. On day 6, samples were collected for testing.

[0015] Effect of mulberry flavonoids on weight gain rate of suckling mice infected with Cryptosporidium parvum: The weight of the suckling mice was recorded every day from the start of drug administration until the last day, (final weight - initial weight) / initial weight = weight gain rate.

[0016] Effect of mulberry flavonoids on Cryptosporidium parvum load in feces of suckling mice infected with Cryptosporidium parvum: On the 6th day, the feces of suckling mice were collected, and the genomic DNA was extracted using the fecal genome extraction kit according to the instructions, and the concentration was determined. When determining the number of oocysts in feces, 1×10 7 The genome extracted from the oocysts was used as a standard and diluted 10-fold to 1 × 10 0 Each well of the assay sample contained: 200 ng of fecal genomic DNA, 1 μL of C. parvum 18S rRNA-F, 1 μL of C. parvum 18S rRNA-R, 10 μL of BlasTaq 2× qPCR MasterMix, and 20 μL of ddH2O. The reaction program was 95°C for 3 min, 95°C for 15 s, and 60°C for 1 min. Steps 2 and 3 were repeated for 40 cycles before the reaction was terminated. A standard curve was drawn with the Log value of the number of oocysts in the standard as the horizontal axis and the Ct value as the vertical axis. The Ct value of the sample was substituted into the standard curve equation to calculate the number of oocysts in the feces.

[0017] Effects of mulberry flavonoids on intestinal pathological changes, intestinal barrier-related proteins and inflammatory factor expression levels in suckling mice infected with Cryptosporidium parvum: On the last day, the intestines of the suckling mice were collected and fixed with 4% paraformaldehyde and sent to the company for slicing and grinding of tissues to extract proteins and RNA. After slicing, the tissues were stained with HE to observe intestinal pathological damage, AB-PAS staining to observe mucin expression, and immunofluorescence to observe the expression of intestinal barrier-related proteins such as Occludin and ZO-1. The protein extracted from the ground tissue was used for Western blot to detect the expression of intestinal related proteins Claudin3, Occludin, and ZO-1. RNA was extracted from the ground tissue and reverse transcribed into cDNA for qRT-PCR to detect the transcription levels of inflammatory factors TNF-α, IL-6, and IL-12.

[0018] The positive effects of the present invention are: providing the medical use of mulberry flavonoids in drugs for inhibiting the FBA activity of Cryptosporidium parvum, disclosing that mulberry flavonoids can inhibit the activity of rC.pFBA, destroy the normal morphology of sporozoites, reduce the glycolysis level of sporozoites, alleviate Cryptosporidium parvum infection, alleviate intestinal pathological symptoms including shortening and erosion of intestinal villi, restore the expression of intestinal barrier-related proteins and the level of inflammatory factors, reduce the amount of oocyst excretion, etc., and can be prepared into drugs against Cryptosporidium parvum. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of PCR amplification of C.pFBA and double enzyme digestion of pGEX-4T-FBA; Figure 2 For the expression and purification of recombinant rC.pFBA; Figure 3 For rC.pFBA enzyme activity assay; Figure 4 The inhibitory effect of mulberry flavonoids on the enzyme activity of rC.pFBA; Figure 5 The effect of mulberry flavonoids on the sporozoite morphology and glycolysis indexes of Cryptosporidium parvum; Figure 6 To explore the in vitro anti-Cryptosporidium effect of Morinda tinctoria; Figure 7 To explore the anti-Cryptosporidium effect of mulberry flavonoids in vivo. DETAILED DESCRIPTION

[0020] To further illustrate the technology and effects of the present invention, the present invention is further described through the following embodiments and drawings. However, the described embodiments are only part of the embodiments of the present invention, and the present invention is not limited to the described embodiments. The specific implementation methods are as follows: Base Materials: 1. Reagents and Instruments Restriction endonucleases and PrimeSTAR® Max DNA polymerase were purchased from Takara; Glutathione-Sepharose 4B (GST tag purification resin), glutathione (reduced form), isopropyl-β-D-thiogalactoside (IPTG), and glucose content detection kit were purchased from Solebao Biotechnology; NADH, α-glycerophosphate dehydrogenase, and FBP were purchased from Puxitang Biotechnology Co., Ltd.; BSA, triosephosphate isomerase, and mulberry flavonoids were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; ATP content detection kit was purchased from Biyuntian Biotechnology Co., Ltd. Fluorescence quantitative PCR instrument was purchased from Jena Analytical Instruments (Germany) Co., Ltd.; 4°C centrifuge was purchased from Thermo Fisher Scientific, USA; vertical electrophoresis instrument was purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.

[0021] 2. Insect strains, bacterial strains, plasmids and cell lines Cryptosporidium parvum (IOWA-IIA) oocysts were stored in our laboratory; pGEX-4T-1 plasmid was stored in our laboratory; HCT-8 cells were stored in our laboratory; BL21 (DE3) competent cells were purchased from Tiangen Biotechnology Co., Ltd.

[0022] 3. Experimental Animals 8-week-old C57 mice were purchased from Changchun Changsheng Biotechnology Co., Ltd. and allowed to breed freely to produce suckling mice. The experiment was carried out at 7 days of age. They were kept in an SPF animal room and received normal light, normal food and water. Example 1

[0023] Construction and identification of prokaryotic expression vector pGEX-4T-FBA Using SnapGene software, specific primers were designed according to the C.pFBA gene sequence (GenBank: XP_628118.1) to amplify the C.pFBA gene by PCR. The sequence is as follows: F: CGGATCCATGTCAATCTGTCAAGAAAGAGC; R: CCGCTCGAGGTAAACATAAGACTTGACGAATAATC; The genomic DNA of Cryptosporidium parvum oocysts was extracted and used as a template for PCR amplification of C.pFBA. Figure 1 The figure shows the results of PCR amplification of C.pFBA and double enzyme digestion identification of pGEX-4T-FBA, where: A: PCR amplification results of C.pFBA (M: DL 2000 DNA Marker; 1: PCR amplification product of C.pFBA); B: Double enzyme digestion results of pGEX-4T-FBA (M: DL 10000 DNA Marker; 1: pGEX-4T-FBA not digested; 2: pGEX-4T-FBA double enzyme digestion product); Figure 1 As shown in A, the size is 1 074 bp, which is consistent with the expected size. Then, C.pFBA was inserted between the BamH I and Xho I restriction sites of the pGEX-4T-1 vector using the double restriction method to construct the prokaryotic expression vector pGEX-4T-FBA. The recombinant expression vector was verified by endonuclease. The results are shown in Figure 1 As shown in B, two bands appeared after double enzyme digestion, which were pGEX-4T-1 vector and target gene C.pFBA, indicating that the prokaryotic expression vector was successfully constructed. Example 2

[0024] Expression and purification of rC.pFBA The prokaryotic expression vector pGEX-4T-FBA was transformed into BL21 (DE3) competent cells by heat shock method, and induced expression was carried out under the conditions of 16°C, 140 rpm / min, and 0.1 mM IPTG for 20 h. The cells were broken and SDS-PAGE was used to detect the expression of the recombinant protein in the supernatant and precipitate. Figure 2 For the expression and purification of recombinant rC.pFBA; A: SDS-PAGE of recombinant rC.pFBA expression (M: 0-150 kDa protein marker; 1: pGEX-4T-1 empty load; 2: pGEX-4T-FBA uninduced; 3: bacterial lysate after pGEX-4T-FBA induction; 4: supernatant of bacterial lysate after pGEX-4T-FBA induction; 5: precipitate of bacterial lysate after pGEX-4T-FBA induction); B. SDS-PAGE of purified recombinant rC.pFBA (M: 0-150kDa protein marker; 1: supernatant of bacterial cell disruption; 2: flow-through; 3: washing solution; 4: eluent 1; 5: eluent 2); like Figure 2 A, it can be observed that the recombinant strain in lane 3 expresses rC.pFBA at 65.8 kDa after IPTG induction, and lanes 4 and 5 show that rC.pFBA exists in both the supernatant and the precipitate of the bacterial lysate after induction. After confirming that rC.pFBA can be expressed in the supernatant, large-scale shaking of the bacteria and purification of the recombinant protein (rC.pFBA) using an affinity chromatography column containing a GST-tagged purification resin filler are performed, and the components at each stage are collected for SDS-PAGE to detect the purification status. Figure 2 B, Lanes 4 and 5 show that relatively single rC.pFBA can be obtained after purification. Example 3

[0025] rC.pFBA enzyme activity assay During glycolysis, FBA catalyzes fructose-1,6-bisphosphate (FBP) to generate dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. Under the action of glycerol 3-phosphate dehydrogenase (GDH) and triosephosphate isomerase (TPI), FBA catalyzes the above substances to generate glycerol 3-phosphate and converts NADH into NAD + , the catalytic reaction continues. The substrate NADH in the reaction has light absorption at 340nm, so the rate of change of NADH content is used to represent the rate of enzymatic reaction. Use NADH solutions of different concentrations (25, 50, 100, 200, 400, 600, 800μM), measure their light absorbance at 340nm, and establish an absorbance (340nm)-NADH concentration standard curve. Figure 3 For rC.pFBA enzyme activity assay; A: Establishment of absorbance (340nm)-NADH concentration standard curve; B: rC.pFBA enzyme activity measurement (GST-tagged protein as control); like Figure 3 As shown in A, the standard curve R 2 =0.9997, indicating that the absorbance (340 nm) and NADH concentration have a reliable and obvious linear relationship.

[0026] Enzyme activity determination: Prepare the reaction system and add it to the ELISA plate for absorbance determination. Each enzymatic reaction system contains 200 ng rC.pFBA, 0.2 mM FBP, 0.3 mM NADH, 0.2 mg / mL BSA, 1U / mL triphosphate isomerase, and 1U / mL α-glycerophosphate dehydrogenase. The control group uses an equal amount of GST-tagged protein. Measure the absorbance at 340nM, and measure it every 1min until the absorbance no longer changes. Figure 3 As shown in B, relative to the GST-tagged protein, the absorbance of the reaction system containing rC.pFBA decreased continuously, indicating that the enzymatic reaction catalyzed by rC.pFBA proceeded and rC.pFBA had fructose 1,6-bisphosphate aldolase activity. Example 4

[0027] Determination of the inhibitory effect of mulberry flavonoids on rC.pFBA enzyme activity The enzymatic reaction system contained 200 ng rC.pFBA, 0.2 mM FBP, 0.3 mM NADH, 0.2 mg / mL BSA, 1U / mL triphosphate isomerase, 1U / mL α-glycerophosphate dehydrogenase, and different concentrations of mulberry flavonoids (3.9, 7.8, 15.6, 31.2, 62.5, 125 μM) were added to determine the inhibitory effect of mulberry flavonoids on the enzyme activity of recombinant rC.pFBA. Graphpad pism9.5 was used to process and analyze the data, fit the curve and calculate the IC50 of the inhibitory concentration of mulberry flavonoids on the enzyme activity of rC.pFBA. Figure 4 As shown, with the increase of the concentration of mulberry flavonoids, its inhibition on rC.pFBA also continued to increase, and the half inhibition concentration of mulberry flavonoids on rC.pFBA was 20.12μM (IC50=20.12μM). Example 5

[0028] Determination of the effects of mulberry flavonoids on the morphology and glycolysis level of Cryptosporidium parvum Take 2*10 7 Cryptosporidium parvum oocysts were excysted, and the excysted sporozoites were divided into two equal parts. One part was incubated with 50 μM mulberry flavonoids for 3 h, and the other part was incubated with a culture medium without mulberry flavonoids as a control group. The effect of mulberry flavonoids on the normal morphology of sporozoites was observed under a scanning electron microscope. Figure 5 The effect of mulberry flavonoids on the sporozoite morphology and glycolysis indexes of Cryptosporidium parvum; A: Scanning electron microscopy observation of the damage of Cryptosporidium parvum sporozoites to the morphology of Morin flavonoids (Control: Cryptosporidium parvum sporozoites incubated without Morin flavonoids; Morin treatment: Cryptosporidium parvum sporozoites incubated with 50μM Morin flavonoids); B: Effect of mulberry flavonoids incubation on glucose uptake of Cryptosporidium parvum sporozoites (Cp: Cryptosporidium parvum sporozoites not incubated with mulberry flavonoids; M12.5+Cp, M25+Cp, M50+Cp: Cryptosporidium parvum sporozoites incubated with 12.5, 25, 50 μM mulberry flavonoids, respectively); C: Effect of incubation with mulberry flavonoids on ATP content of Cryptosporidium parvum sporozoites (Cp: Cryptosporidium parvum sporozoites not incubated with mulberry flavonoids; M12.5+Cp, M25+Cp, M50+Cp: Cryptosporidium parvum sporozoites incubated with 12.5, 25, 50 μM mulberry flavonoids, respectively); like Figure 5 As shown in A, compared with the control group, the normal morphology of sporozoites in the Morin treatment group was damaged. The sporozoites in the control group were rod-shaped or crescent-shaped with a smoother surface membrane, while the sporozoites in the Morin treatment group were swollen and deformed, with depressions and bubbles on the surface membrane.

[0029] Take 4*10 7 The Cryptosporidium parvum oocysts were excysted, and the excysted sporozoites were divided into four equal parts. The Cryptosporidium parvum sporozoites were incubated with different concentrations of mulberry flavonoids (12.5, 25, 50 μM) for 3 h. The control group was incubated with a medium without mulberry flavonoids. The glucose uptake of the sporozoites was detected according to the instructions of the kit. Figure 5 As shown in B, incubation of Cryptosporidium parvum sporozoites with different concentrations of mulberry flavonoids (12.5, 25, 50 μM) reduced sporozoite glucose uptake compared to sporozoites incubated in medium without mulberry flavonoids.

[0030] The steps of parasite treatment and drug incubation for ATP content detection test were the same as those for glucose uptake test described above, and the test was performed according to the instructions of the ATP content detection kit. Figure 5 As shown in C, compared with the sporozoites incubated in the medium without mulberry flavonoids, incubation of Cryptosporidium parvum sporozoites with 25 and 50 μM mulberry flavonoids reduced the ATP content of the sporozoites.

[0031] (Graphs were generated using Graphpad pism9.5 software, and statistical software was used to perform one-way ANOVA and difference significance analysis to determine the statistical differences between groups. ns represents no significant difference, *; **; ***; **** represent significant differences between the results of the two groups) Example 6

[0032] Determination of the anti-Cryptosporidium effect of Morinda tinctoria in vitro The Cryptosporidium parvum oocysts were collected and excysted. After excystation, the Cryptosporidium parvum sporozoites were incubated with different concentrations of mulberry flavonoids (12.5, 25, 50 μM) for 3 h. A group of Cryptosporidium parvum sporozoites not incubated with mulberry flavonoids was set up. Then, 2*10 6 / well Cryptosporidium parvum sporozoites were inoculated into HCT-8 cells grown to 80% in a 12-well plate. After 3 hours, the uninvaded sporozoites were washed with PBS and the co-culture was continued for 48 hours. Cell samples were collected for detection. Figure 6 To explore the in vitro anti-Cryptosporidium effect of Morinda tinctoria; A: qRT-PCR detection of relative worm load in HCT-8; B: Western blot detection of the expression of intestinal barrier-related proteins Claudin3, Occludin, and ZO-1 in HCT-8 cells; C: qRT-PCR detection of transcriptional levels of inflammatory factors TNF-α, IL-6, and IL-12 in HCT-8 cells; (control: uninfected group; Cp: infected group; M12.5 / 25 / 50+Cp: infected group after sporozoites were incubated with 12.5 / 25 / 50 μM Morinol); qRT-PCR detection of cell load Figure 6 A, Compared with the Cryptosporidium parvum sporozoite infection group not incubated with mulberry flavonoids, incubation with 25 and 50 μM mulberry flavonoids can significantly reduce the proliferation of sporozoites in HCT-8 cells.

[0033] Western blot was used to detect the expression of intestinal barrier-related proteins, such as Figure 6 As shown in B, incubation with 25 and 50 μM mulberry flavonoids can significantly alleviate the decrease in the expression of intestinal barrier-related proteins in HCT-8 cells caused by sporozoite infection.

[0034] qRT-PCR was used to detect the transcriptional levels of inflammatory factors, such as Figure 6 As shown in C, incubation with mulberry flavonoids can significantly alleviate the increased transcription levels of inflammatory factors TNF-α, IL-6, and IL-12 in HCT-8 cells caused by sporozoite infection.

[0035] (Graphs were generated using Graphpad pism9.5 software, and statistical software was used to perform one-way ANOVA and difference significance analysis to determine the statistical differences between groups. ns represents no significant difference, *; **; ***; **** represent significant differences between the results of the two groups) Example 7

[0036] Determination of the anti-Cryptosporidium effect of Morinda tinctoria in vivo 1. Animal grouping, parasite infection, and drug treatment C57 mice reproduced normally without human interference and produced suckling mice. When the suckling mice were grown to 7 days old, they were divided into control group (control), Cryptosporidium parvum infection group (Cp), infection + low-dose mulberry flavonoids group (M20+Cp), infection + medium-dose mulberry flavonoids group (M40+Cp), infection + high-dose mulberry flavonoids group (M60+Cp), infection + solvent control group DMSO+Cp, and high-dose mulberry flavonoids group (M60). Except for the control and M60 groups, all the mice were treated with 2*10 5The mice were inoculated and infected by oral gavage at a dose of oocysts / mouse. On the 2nd to 5th day after infection, the mice were given drugs. The control group was gavaged with PBS, the DMSO+Cp group was gavaged with 5% DMSO, and the other groups were gavaged with mulberry flavonoids stored in DMSO at a dose of 20 mg / kg / day, 40 mg / kg / day, and 60 mg / kg / day. On the 6th day, samples were collected for testing. The weight gain rate of the mice, the amount of oocysts excreted in the feces, the pathological damage of the intestine, the intestinal mucin content, the expression of intestinal barrier-related proteins, the transcription level of intestinal inflammatory factors and other indicators were measured to evaluate the anti-Cryptosporidium effect of mulberry flavonoids in vivo.

[0037] Figure 7 To explore the anti-Cryptosporidium effect of Morinda tinctoria in vivo; A: Weight gain rate of each group of suckling mice; B: qRT-PCR detection of the number of oocysts in the feces of suckling mice; C: HE observation of intestinal pathological damage in suckling mice; D: AB-PAS staining detection of intestinal mucin content; E: Western blot detection of intestinal barrier-related proteins Claudin3, Occludin, and ZO-1 in suckling mice; F: Immunofluorescence observation of the expression of Occludin and ZO-1 in the intestine of suckling mice; G: qRT-PCR detection of the transcription levels of intestinal inflammatory factors TNF-α, IL-6, and IL-12 in suckling mice.

[0038] (control: uninfected group; Cp: infected group; M20 / 40 / 60+Cp: infected group + 20 / 40 / 60mg / kg / day mulberry flavonoids administration group; M60: uninfected group and 60mg / kg / day mulberry flavonoids administration group; DMSO+Cp: infected group + 5% DMSO gavage group) 2. Observation on the anti-Cryptosporidium effect of Morinda tinctoria in vivo 2.1 Weight growth rate of suckling mice Record the weight of the suckling mice every day from the start of drug administration until the last day, (final weight - initial weight) / initial weight = weight gain rate. Figure 7 As shown in A, compared with the infection group (Cp), the body weight growth rate of the infection + high-dose mulberry flavonoids administration group (M60 + Cp) increased, while there was no significant difference between the infection + solvent control group and the infection group.

[0039] 2.2 Worm load in suckling mouse feces On the 6th day after infection with Cryptosporidium parvum, feces of suckling mice in each group were collected, and genomic DNA was extracted using a fecal genome extraction kit according to the instructions, and the concentration was determined. When qRT-PCR was used to determine the number of oocysts in feces, 1×10 7 The genome extracted from the oocysts was used as a standard and diluted 10-fold to 1 × 10 0. Each well of the assay sample contained: 200ng fecal genomic DNA, 1 μL C. parvum 18S rRNA-F, 1 μL C. parvum 18S rRNA-R, 10μL BlasTaq 2× qPCR MasterMix, and 20 μL ddH2O. The reaction program was 95℃ 3min, 95℃ 15 s, 60℃ 1min, 40 cycles of steps 2 and 3, and then the reaction was terminated. A standard curve was drawn with the Log value of the number of oocysts in the standard as the horizontal axis and the Ct value as the vertical axis. The sample Ct value was substituted into the standard curve equation to calculate the number of oocysts in the feces. The results were analyzed and plotted using Graphpad pism9.5 software, as shown in the figure. Figure 7 As shown in B, compared with the infection group (Cp), the number of oocysts in the feces of the infection + medium and high doses of mulberry flavone administration groups (M40+Cp, M60+Cp) decreased, and the excretion of oocysts in the M60+Cp group decreased by about 80% compared with the Cp group.

[0040] 2.3 HE staining to observe pathological damage in intestinal sections On the 6th day after infection with Cryptosporidium parvum, the intestines of suckling mice were collected and fixed with 4% paraformaldehyde and sent to the company for sectioning. HE staining was performed to observe intestinal pathological damage, including villus length, crypt depth, and intestinal villus integrity. Figure 7 As shown in C, compared with the infection group (Cp), the intestinal villus length and integrity of the infection + medium and high doses of mulberry flavone administration groups (M40+Cp, M60+Cp) increased, and the intestinal villus erosion phenomenon was alleviated or even returned to the level of the uninfected group.

[0041] 2.4 AB-PAS staining to observe intestinal mucin content When inflammation occurs in the intestine, the content of mucin in the intestine decreases. After dewaxing and hydration, the sections of the suckling mouse intestine were stained according to the instructions of the AB-PAS staining kit. After staining, hematoxylin was used to stain the nucleus, and the sections were dehydrated and sealed with neutral gum. After drying, they were observed under a microscope. Figure 7 As shown in D, compared with the infection group (Cp), the mucin content in the infection + medium and high doses of mulberry flavonoids administration groups (M40+Cp, M60+Cp) increased, indicating that mulberry flavonoids administration can alleviate intestinal inflammation caused by Cryptosporidium parvum infection in suckling mice.

[0042] 2.5 Western blot detection of intestinal barrier-related protein expression in suckling mice On the 6th day after infection with Cryptosporidium parvum, the intestines of suckling mice were collected and ground to collect proteins for Western blot detection of Claudin3, Occludin, and ZO-1 expression levels, and the expression level of β-actin protein was detected as a control. Figure 7 As shown in E, compared with the infection group (Cp), the expression levels of Claudin3, Occludin, and ZO-1 in the infection + medium and high doses of mulberry flavone administration groups (M40+Cp, M60+Cp) increased.

[0043] 2.6 Immunofluorescence observation of intestinal barrier-related protein expression of occludin and ZO-1 The intestinal tract of the newborn rat was embedded in paraffin and sliced. After dewaxing and hydration, the slices were antigen repaired with citric acid and blocked with 3% BSA (1h). Occludin and ZO-1 antibodies (1:200 dilution) were prepared and the slices were incubated overnight. The next day, fluorescent secondary antibodies of the corresponding species were used for incubation, and the slices were sealed with DAPI-containing sealing solution and observed under a laser confocal microscope. Figure 7 As shown in F, compared with the infection group (Cp), the expression levels of Occludin and ZO-1 in the infection + medium and high doses of Morinda tinctorius administration groups (M40+Cp, M60+Cp) increased.

[0044] 2.7 Detection of transcriptional levels of inflammatory factors in the intestine of suckling mice by qRT-PCR On the 6th day after infection with Cryptosporidium parvum, the intestines of suckling mice were collected and ground with Trizol. The supernatant was collected for qRT-PCR to detect the transcription levels of inflammatory factors such as TNF-α, IL-6, and IL-12. GAPDH was used as the internal reference gene, and 2 —△△CT Methods The relative transcription levels of inflammatory factors such as TNF-α, IL-6, and IL-12 were calculated and the data were analyzed and processed using GraphPad Prism 9 to draw pictures. Figure 7 As shown in G, compared with the infection group (Cp), the relative levels of TNF-α, IL-6, and IL-12 inflammatory factors in the infection high-dose mulberry flavonoids administration group (M60+Cp) decreased.

[0045] The above results show that mulberry flavonoids have a good anti-insect effect in suckling mice.

Claims

1. The medical use of mulberry flavonoids in drugs that inhibit the activity of Cryptosporidium parvum FBA. The half-inhibitory concentration of the activity of recombinant Cryptosporidium parvum FBA is 20.12μM (IC50=20.12μM).

2. Use of mulberry flavonoids in the preparation of drugs against Cryptosporidium parvum FBA.

3. The medicine containing the active ingredient of Morinda tinctoria according to claim 2 is in any medical dosage form.

Images