Bacterial cellulose production strain as well as construction method and application thereof

Abstract

The invention discloses a bacterial cellulose production strain, a construction method thereof and application of the bacterial cellulose production strain in fermentation production of bacterial cellulose. A xylose metabolic pathway key gene xylA is overexpressed in acetobacter xylosus. Key genes in a xylose metabolic pathway are overexpressed in the acetobacter xylosus, so that the bacterial cellulose yield and the xylose utilization amount of the acetobacter xylosus are increased, and the bacterial cellulose yield of the obtained genetically engineered acetobacter xylosus can reach 10.3 g / L at most and is increased by 71.7% compared with that of an original strain; when pure xylose is used as a substrate for fermentation, the xylose consumption can reach up to 11.61 g / L.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a bacterial cellulose production strain and a construction method and application thereof. Background Art

[0002] Bacterial cellulose (BC) is a highly purified cellulose that does not contain impurities and contaminants such as lignin, pectin, and hemicellulose compared to plant cellulose. BC has the characteristics of high crystallinity, strong thermal stability, high mechanical strength, high water absorption capacity in the form of hydrogels, moderate biocompatibility, and partial degradability, and can form composite materials with polymers. Both pure and composite forms of BC have many practical applications and have been successfully used in wound dressings, burn treatment, medical devices, tissue regeneration, biosensor materials, electronic paper, and other fields.

[0003] The selection of microorganisms that can synthesize BC is an important factor in optimizing the production of BC. The genera that can synthesize BC include Gluconobacter (formerly known as Agrobacterium, Aerobacter or Acetobacter), Achromobacter, Azotobacter, Rhizobium, Sachina and Salmonella. Xylinacetobacter is one of the best bacterial species for large-scale production of bacterial cellulose. Xylinacetobacter can be obtained from a variety of natural and artificial environments such as flowers, fruits, wine, vinegar, soil, beehives and bioreactors. In order to increase the production of BC, Xylinacetobacter can be genetically modified. At present, researchers have obtained excellent cellulose production strains by knocking out the glucose dehydrogenase gene in Xylinacetobacter. Fermentation conditions can also affect the production efficiency of cellulose. The yield of cellulose synthesized by Xylinacetobacter is affected by the type and concentration of substrate sugars, nitrogen source, oxygen and pH. In addition, the yield of bacterial cellulose produced by Xylinacetobacter can also be increased by changing the culture medium, culture time, strain inoculation amount, BC surface area and culture medium volume. During the fermentation process, the addition of some enzymes and compounds can also affect the production efficiency of bacterial cellulose.

[0004] At present, the main bottleneck of the industrial production of bacterial cellulose is the low productivity and slow growth rate of the production strains, which to some extent limits the wide application of bacterial cellulose production strains. In particular, Xylacetobacter, as one of the earliest discovered cellulose synthesis strains, has shown strong ability in the synthesis of bacterial cellulose, but its production speed and yield still need to be improved. Therefore, improving the yield and production efficiency of bacterial cellulose has become a key issue in current research. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a bacterial cellulose production strain to solve the problems of low xylose utilization, low bacterial cellulose yield and long fermentation time in the existing bacterial cellulose production technology.

[0006] The technical problem that the present invention also solves is to provide a method for constructing the above-mentioned bacterial cellulose production strain.

[0007] The final technical problem to be solved by the present invention is to provide the application of the bacterial cellulose production strain.

[0008] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0009] A bacterial cellulose production strain overexpresses the key gene xylA in the xylose metabolic pathway in xylacetobacter. The xylose isomerase encoded by xylA is mainly involved in the process of xylose metabolism and utilization by xylacetobacter.

[0010] The nucleotide sequence of the key gene xylA in the xylose metabolic pathway is shown in SEQ ID NO.1.

[0011] Wherein, the xylinacetobacter is a mutant strain obtained by mutagenizing xylinacetobacter ATCC700178.

[0012] Among them, the xylose acetobacter is classified and named as Gluconacetobacter xylinus (Gluconacetobacterxylinus), the strain number is P2-A1, and it was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on December 4, 2024. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.32895.

[0013] The present invention also discloses a method for constructing the bacterial cellulose production strain, comprising the following steps:

[0014] (1) cloning the key gene xylA of the xylose metabolic pathway into an expression plasmid to obtain a recombinant plasmid;

[0015] (2) The recombinant plasmid in step (1) is transformed into the xylinacetobacter.

[0016] In step (1), the expression plasmid is pSEVA331, which can be purchased from the market.

[0017] The invention also discloses the application of the bacterial cellulose production strain in fermentation to produce bacterial cellulose.

[0018] Wherein, when carrying out the fermentation, the fermentation substrate used is any one of glucose and xylose or a combination of both.

[0019] The fermentation conditions are static culture at 30°C to 35°C for 6 to 8 days, preferably static culture at 30°C for 8 days.

[0020] Wherein, when the fermentation is carried out, the seed liquid of the bacterial cellulose production strain is inoculated into the fermentation medium, the inoculation amount of the seed liquid is 10% to 20% of the volume of the fermentation medium, and the OD value of the seed liquid is 0.6 to 1.

[0021] Beneficial effects:

[0022] The invention improves the bacterial cellulose production and xylose consumption of xylacetobacter by overexpressing a key gene xylA in a xylose metabolic pathway in xylacetobacter. The invention only needs to introduce the xylA gene into the xylacetobacter, and does not need to introduce other genes or perform other metabolic engineering transformation methods on the xylacetobacter. The obtained recombinant xylacetobacter is fermented in a fermentation medium containing 10 g / L of glucose and 10 g / L of xylose, and the bacterial cellulose production can reach up to 10.3 g / L, which is 71.7% higher than that of the original strain; and the xylose consumption can reach up to 11.61 g / L when fermented in a fermentation medium containing 20 g / L of xylose. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0024] Figure 1 This is the gel electrophoresis diagram of the colony PCR verification in Example 3; wherein, lanes 1 to 6 are recombinant xylacetobacter, lane 7 is the recombinant plasmid pSEVA331-xylA, lane 8 is the negative control, and lane M is a 1000 bp DNA marker.

[0025] Figure 2 This is a comparison chart of the cellulose production of the recombinant xylinacetobacter and the original xylinacetobacter in Example 4 in five fermentation media.

[0026] Figure 3 This is a comparison chart of the remaining xylose content in the fermentation medium after the fermentation of the recombinant xylinacetobacter and the original xylinacetobacter in Example 4. DETAILED DESCRIPTION

[0027] The present invention is further described below based on the following examples. It should be understood that the following embodiments are only used to illustrate the present invention, but not to limit the present invention.

[0028] If the specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased through regular channels.

[0029] Example 1 Cloning of the key gene xylA in the xylose metabolic pathway of Acetobacter xylosus

[0030] (1) First, the key gene xylA in the xylose metabolic pathway was amplified and sequenced. The genome of Xylinacetobacter CGMCC NO.32895 was extracted, and the extracted genome of Xylinacetobacter CGMCC NO.32895 was used as a template and primers xylA-FA and xylA-RC were used for PCR amplification.

[0031] PCR reaction system: 5× PrimeSTAR buffer (Mg 2+ )20.0μL, dNTP Mixture (2mM)10.0μL, xylA-FA1.0μL, xylA-RC 1.0μL, PrimeSTAR 1.0μL, template 0.5μL; add sterile water to 100.0μL, and then divide it into 25.0μL / tube.

[0032] Reaction conditions: 95°C, 5 min; 95°C, 10 sec; 60°C, 30 sec; 72°C, 3 min; 72°C, 10 min; 35 cycles, and the amplified PCR product was purified using a gel recovery kit.

[0033] The nucleotide sequences of primers xylA-FA and xylA-RC are as follows:

[0034] xylA-FA: atgcaagcctattttgaccagctc;

[0035] xylA-RC:gatcctgaagtcttcagctgggc.

[0036] Example 2 Construction of recombinant plasmid pSEVA331-xylA

[0037] The amplified PCR product was cloned into the EcoRV site of the linearized pUC57 plasmid using GenBuilder to obtain the recombinant plasmid xylA-2P. The recombinant plasmid xylA-2P was transformed into competent cells TOP10 by heat shock method, and the transformed cells were evenly spread on LB plate culture medium containing ampicillin, and the plate was inverted in a 37°C incubator to culture until a single colony appeared. A single clone was picked and cultured overnight, and the bacteria were collected by centrifugation to extract the plasmid.

[0038] The pSEVA331 vector (commercially available) was double-digested with endonucleases NaeI-NcoI to form a linearized vector. Using xylA-2P as a template, primers with homology arms were used to amplify the xylA fragment with homology arms, which was then homologously recombined with the linearized vector pSEVA331 to obtain the recombinant plasmid pSEVA331-xylA.

[0039] The above work was commissioned to Nanjing GenScript Biotech Co., Ltd.

[0040] The recombinant plasmid pSEVA331-xylA was transformed into competent cells Stbl3 and TOP10 by heat shock method, and the transformed cells were evenly spread on LB plate culture medium containing 34 μg / mL chloramphenicol. The plates were inverted and cultured in a 37°C incubator until single colonies appeared. Single clones were selected for overnight culture, the bacteria were collected by centrifugation, the plasmids were extracted, and sequencing and enzyme digestion verification were performed.

[0041] Example 3 Construction of recombinant Acetobacter xylosaminidase

[0042] (1) Preparation of Xylacetobacter CGMCC NO.32895 competent cells

[0043] Xylella fastidiosa CGMCC NO.32895 was inoculated into 100 mL YPD liquid culture medium (formula: peptone 20 g / L, glucose 20 g / L, yeast powder 10 g / L), and cellulase that had been filtered and sterilized was added to the YPD liquid culture medium, so that the cellulase concentration in the YPD liquid culture medium was 0.5 U / mL, 30°C, 150 rpm, and cultured for 18 hours, so that the OD value of the bacterial liquid was between 0.6 and 0.8.

[0044] The cultured bacterial solution was centrifuged at 5000 rpm for 5 min, the supernatant was discarded and the cells were collected, and then washed twice with 5 mL of EPB solution (mixed with 284 mmol of sterilized sucrose solution and 100 mmol of phosphate buffer, pH = 7.4, in a ratio of 1:19). Finally, 3.3 mL of EPB solution was added to resuspend and dispensed into 560 μL per tube.

[0045] (2) Electroconversion

[0046] Take 20 μL of recombinant plasmid pSEVA331-xylA (concentration is about 100 ng / μL) and add it to the above-packaged competent cells. After ice bathing for 10 minutes, transfer it to a 2 mm electroporation cup and add it to the electroporator for electroporation. The electroporation conditions are: voltage 3000 V, resistance 200 Ω, capacitance 25 μF.

[0047] 1 mL of the YPD liquid medium from step (1) was added to the electro-transformed bacteria, and the culture was revived at 30°C and 150 rpm for 3 h. After the recovery was completed, 100 μL of the bacterial solution was spread on a selection medium containing 34 μg / mL chloramphenicol (formula: 20 g / L glucose, 5 g / L yeast extract, 5 g / L peptone, 20 g / L agar, 34 μg / mL chloramphenicol) and cultured at 30°C for 3 to 4 days until a single colony appeared. The single colony grown on the selection medium was further picked and streaked on a YPD solid medium containing chloramphenicol (formula: 20 g / L agar, 20 g / L peptone, 20 g / L glucose, 10 g / L yeast powder, 34 μg / mL chloramphenicol). The colonies grown on the YPD solid medium were verified by colony PCR using primers yz-B-1 and yz-B-2, positive transformants were screened and gene sequencing was performed, and finally a genetically stable recombinant xylacetobacter CGMCC NO.32895-xylA was obtained. At the same time, a control group was set up to perform the same electroporation (without adding the recombinant plasmid pSEVA331-xylA), recovery and plate coating operations as a competent cell growth detection and negative control.

[0048] The nucleotide sequences of primers yz-B-1 and yz-B-2 are as follows:

[0049] yz-B-1:actatgtcctgtggggcggt

[0050] yz-B-2:ttcttcgcccccgttttcac

[0051] The gel electrophoresis diagram of the colony PCR verification results is shown in Figure 1 shown.

[0052] Example 4 Fermentation of recombinant xylacetobacter CGMCC NO.32895-xylA to produce bacterial cellulose

[0053] Recombinant xylinacetobacter CGMCC NO.32895-xylA and xylinacetobacter CGMCC NO.32895 (original xylinacetobacter) were activated respectively, and then inoculated into YPD medium (formula: peptone 20g / L, glucose 20g / L, yeast powder 10g / L) respectively, and cultured on a shaking table at 30°C, 150rpm for 18-20h, and then the seed liquid (OD was 0.6) of the two strains was inoculated into 100mL of five different fermentation mediums according to an inoculum amount of 10%, and 1mL of anhydrous ethanol was added to the fermentation medium at the same time. The carbon source ratios in the above five different fermentation mediums are different, and the specific components of the five fermentation mediums are shown in Table 1. After the inoculated culture medium was cultured at 30°C for 8 days, a layer of cellulose membrane grew in the culture medium. The cellulose membrane was rinsed with distilled water overnight to remove the culture medium and impurities on the membrane surface. The cellulose membrane was then immersed in a 0.5M sodium hydroxide aqueous solution and boiled for 1 hour until it became milky white and translucent to remove the attached bacteria. The treated cellulose membrane was drained on filter paper and dried in an oven at 65°C to constant weight and weighed (i.e., cellulose dry weight). The cellulose yields of the recombinant xylinacetobacter and the original xylinacetobacter in the five culture media were as follows: Figure 2 After the fermentation was completed, the residual sugar content of xylose in each fermentation medium was measured. The results were as follows Figure 3 shown.

[0054] Table 1 Formulas of five fermentation media

[0055]

[0056] Depend on Figure 2 It can be seen that in the fermentation medium of experimental group 3, the fermentation effect of the recombinant xylacetobacter CGMCC NO.32895-xylA was the best, and the bacterial cellulose yield was the highest, which was 10.3 g / L, an increase of 71.7% over the original xylacetobacter. Figure 3 It can be seen that in the fermentation medium of experimental group 3, the glucose consumption of the recombinant xylacetobacter is 8.25 g / L and the xylose consumption is 6 g / L; in the fermentation medium of experimental group 5, the xylose consumption of the recombinant xylacetobacter can be as high as 11.61 g / L.

[0057] The present invention provides a bacterial cellulose production strain and its construction ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A bacterial cellulose production strain, characterized in that Overexpression of xylA, a key gene in the xylose metabolic pathway, in Acetobacter xylosus.

2. The bacterial cellulose producing strain according to claim 1, characterized in that The nucleotide sequence of the key gene xylA in the xylose metabolic pathway is shown in SEQ ID NO.

1.

3. The bacterial cellulose producing strain according to claim 1, characterized in that The xylinacetobacter is a mutant strain obtained by mutagenizing xylinacetobacter ATCC700178.

4. The bacterial cellulose producing strain according to claim 3, characterized in that The preservation number of the xylinacetobacter is CGMCC No.32895.

5. The method for constructing a bacterial cellulose producing strain according to any one of claims 1 to 4, characterized in that: The steps include: (1) cloning the key gene xylA of the xylose metabolic pathway into an expression plasmid to obtain a recombinant plasmid; (2) The recombinant plasmid in step (1) is transformed into the xylinacetobacter to obtain.

6. The construction method according to claim 5, characterized in that: In step (1), the expression plasmid is pSEVA331.

7. Use of the bacterial cellulose producing strain according to any one of claims 1 to 4 in fermentation to produce bacterial cellulose.

8. The use according to claim 7, characterized in that: When the fermentation is carried out, the fermentation substrate used is any one of glucose and xylose or a combination of the two.

9. The use according to claim 7, characterized in that: The fermentation condition is static culture at 30°C to 35°C for 6 to 8 days.

10. The use according to claim 7, characterized in that: During the fermentation, the seed liquid of the bacterial cellulose production strain is inoculated into the fermentation medium. The inoculation amount of the seed liquid is 10% to 20% of the volume of the fermentation medium. The OD value of the seed liquid is 0.6 to 1.

Images