PDRN, gene engineering vector, cell, preparation method and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to PDRN, a gene engineering vector, a cell, a preparation method and application thereof. The polydeoxyribonucleotide (PDRN) provided by the invention comprises a nucleotide sequence as shown in SEQ ID NO. 1; 1 or a partial fragment containing a nucleotide sequence shown in SEQ ID NO. 1; 1 or a sequence having 80% or more of homology with the nucleotide sequence as shown in SEQ ID NO. 1. The PDRN provided by the invention can effectively reduce and inhibit the expression level of inflammatory factors TNF-alpha and IL-6 and increase the wound healing rate of HUVEC cells, and is concentration-dependent. The PDRN provided by the invention has a good application prospect in preparation of anti-inflammatory or healing-promoting products.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a PDRN, a genetic engineering vector, a cell, a preparation method and an application thereof. Background Art

[0002] Polydeoxyribonudeotide (PDRN) is an active polynucleotide mixture with a molecular weight range of 50-1500kDa, without antigenic properties and systemic toxicity. PDRN is a reliable cell growth active substance and a mixture of deoxyribonucleic acids. It is extracted from salmon sperm DNA and derived from a controlled purification and sterilization process. It has the function of promoting tissue regeneration and effectively relieving inflammation, and has a significant effect on the regeneration and repair of human skin, ligaments and tendons.

[0003] The main methods for preparing polydeoxyribonucleotides are extraction, chemical synthesis and biosynthesis. The extraction method uses fish testes or semen as raw materials and obtains products through multiple steps of complex treatment, but the raw materials are easily affected by the environment, and there are problems such as protein residues and high costs; chemical synthesis methods such as phosphodiester method and phosphate method are synthesized through specific chemical reactions, but their synthesis process is complicated, the conditions are strict, the cost is high, and it is not suitable for long-chain synthesis; the biosynthesis method uses multiple displacement amplification technology to amplify genomic DNA as a template, and then undergoes ultrasound and enzyme digestion, but the DNA extraction rate of the kit is low and the cost is high, and ultrasound or enzyme digestion also has many shortcomings.

[0004] Chinese patent application CN113105515A discloses a method for separating deoxynucleotides from salmon sperm, the deoxynucleotides separated by the method have high purity and are easy to operate, but the final product yield is low; Chinese patent application CN107287186A discloses a method for separating PDRN from fish sperm, but the product purity obtained by the method is low, and in actual operation, the yield is not high, and there is room for further optimization; Chinese patent application CN112315836A discloses a method for preparing an efficient external PDRN and its application, although the Maillard reaction is avoided, the reaction time is long, and the molecular weight of PDRN is large. Providing a high-purity PDRN that can effectively inhibit inflammatory factors and increase wound healing rate is still a current research hotspot. Summary of the invention

[0005] In view of the above-mentioned deficiencies, the present invention provides a PDRN, its genetic engineering vector, cells, preparation method and application.

[0006] The technical solution of the present invention is: In a first aspect, the present invention provides a polydeoxyribonucleotide comprising a nucleotide sequence as shown in SEQ ID NO.1; or a partial fragment of the nucleotide sequence as shown in SEQ ID NO.1; or a sequence having more than 80% homology with the nucleotide sequence as shown in SEQ ID NO.1.

[0007] SEQ ID NO.1: TTTAGAAGAATATCAGATATGAATAAGATAAAATCATTAAAACATATTTTATTTTTCGACATTTGTTTTATTTACTTCTCTGCCGATTTAAAGAGACTTACTCATGAGAAAATGAAGGAAATGGACGAGCTAAAAAGAAAAAGGGAGCATCCTGAGGCAGAAAAGTACAGGAACGTTTTGCAGAAGGGTCAATCTCACCTGGAAAAATACCAAAAAATGGCAACTATCACACAAAACGTCTTGCGAGTTAACTGTAC TCTGTCTTTAAGAATCCAATTGTTTATTCTGCGAGTCTGCCCAAATAATATTCTTGACTTGTCCGCCGCTTTTGACACGGTCAATCATCAAATACTATTGTCAACTCTGTCCGAATTGGGAATTAGTG GAGCTGCACATGCATGGATAGCTAGTTACCTGACTGGTAGGTCTTATCAAGTTGCATGGAGAGAGTGTTTCTTCTCCACGTGCCTTAACAACTGGAGTACCACAGGGAAGTGTTTTGGGTCCTCTA.

[0008] In a second aspect, the present invention provides a genetic engineering vector, wherein the genetic engineering vector comprises the above-mentioned polydeoxyribonucleotide.

[0009] Specifically, the vectors used in the genetic engineering vector include but are not limited to one or more of pPIC9, pHIL-S1, pPICZα, pYAM75P, pPIC9K, pPIC3.5K, pGAPZ, pPIC3, pPICZ, pPSC3K, and pHIL-D2.

[0010] Preferably, the vector used in the genetic engineering vector is pPIC9.

[0011] In a third aspect, the present invention provides a genetically engineered cell, wherein the genetically engineered cell comprises the genetically engineered vector described above.

[0012] Specifically, the host cells of the genetically engineered cells include one or more of Escherichia coli, Pichia pastoris, and Bacillus subtilis.

[0013] Preferably, the host cell of the genetically engineered cell is Pichia pastoris GS115.

[0014] In a fourth aspect, the present invention provides a method for preparing a polydeoxyribonucleotide, the preparation method comprising constructing a genetically engineered cell that overexpresses the polydeoxyribonucleotide, wherein the polydeoxyribonucleotide comprises the nucleotide sequence shown in SEQ ID NO.1; or a partial fragment of the nucleotide sequence shown in SEQ ID NO.1; or a sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.1.

[0015] Specifically, the preparation method comprises transducing expression cells through a genetic engineering vector and expressing polydeoxyribonucleotides.

[0016] Specifically, the preparation method comprises the following steps: S1, amplify the gene fragment shown in SEQ ID NO.1 to obtain the PDRN amplified fragment; S2, cloning and constructing the PDRN amplified fragment and the vector fragment recovered by enzyme digestion; S3, transform competent cells, screen positive clones, and obtain pPIC9-PDRN recombinant plasmid; S4, pPIC9-PDRN recombinant plasmid was digested and transformed into host cells, positive clones were screened, and genetically engineered cells expressing PDRN were obtained; S5. Ferment and culture the genetically engineered cells, collect the supernatant, and obtain PDRN.

[0017] In a fifth aspect, the present invention provides the use of the above-mentioned polydeoxyribonucleotides, genetic engineering vectors, genetic engineering cells or polydeoxyribonucleotides obtained by the preparation method in the preparation of anti-inflammatory or healing-promoting products.

[0018] Specifically, the products include medicines, cosmetics or medical devices.

[0019] Furthermore, the dosage form of the drug includes a parenteral dosage form or a parenteral dosage form.

[0020] Preferably, the dosage forms for administration via the gastrointestinal tract include, but are not limited to, tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0021] Preferably, the non-gastrointestinal dosage forms include, but are not limited to, injection dosage forms, respiratory tract dosage forms, skin dosage forms, mucosal dosage forms and cavity dosage forms.

[0022] Specifically, the medicine also includes pharmaceutically acceptable excipients.

[0023] Preferably, the pharmaceutically acceptable excipients include, but are not limited to: one or more of solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, adhesives, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, and antioxidants.

[0024] Preferably, the cosmetics include cleansers, toners, lotions, creams, essences, masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foams, patches, makeup powders, cotton pads, eye essences, eye masks, eye shadows, eye gels or eye creams.

[0025] Furthermore, the cosmetic also includes cosmetically acceptable additives.

[0026] Preferably, the additives include, but are not limited to: one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, and buffers.

[0027] Furthermore, the medical devices include, but are not limited to: wound dressing medical devices, functional dressing medical devices, wound healing auxiliary device medical devices or suture material medical devices.

[0028] Preferably, the wound dressing medical devices include, but are not limited to: gauze dressings, medical cotton pads, hydrogel dressings, alginate dressings, and foam dressings.

[0029] Preferably, the functional dressing medical devices include but are not limited to: silver ion dressings, growth factor dressings, and nanocrystalline collagen-based dressings.

[0030] Preferably, the wound healing auxiliary medical device includes but is not limited to: negative pressure wound therapy equipment, low frequency pulse therapy device, infrared therapy device or ultraviolet therapy device.

[0031] Preferably, the suture material medical device includes but is not limited to: absorbable sutures or non-absorbable sutures.

[0032] In a sixth aspect, the present invention provides a medicine comprising the above-mentioned polydeoxyribonucleotide, genetic engineering vector, genetic engineering cell or polydeoxyribonucleotide obtained by the preparation method.

[0033] In a seventh aspect, the present invention provides a cosmetic comprising the above-mentioned polydeoxyribonucleotide, genetic engineering vector, genetic engineering cell or polydeoxyribonucleotide obtained by the preparation method.

[0034] In an eighth aspect, the present invention provides a medical device, comprising the above-mentioned polydeoxyribonucleotide, genetic engineering vector, genetic engineering cell or polydeoxyribonucleotide obtained by the preparation method.

[0035] The beneficial effects of the present invention are: The PDRN provided by the present invention can effectively reduce the expression levels of inflammatory factors TNF-α and IL-6, increase the wound healing rate of HUVEC cells, and is concentration-dependent. The PDRN provided by the present invention has good application prospects in the preparation of anti-inflammatory or healing products. DETAILED DESCRIPTION

[0036] The present invention will be further explained clearly and completely by examples below. The following examples are only part of the present invention and are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are all routine experiments unless otherwise specified, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0037] Example 1 A polydeoxyribonucleotide and its genetic engineering vector and cell 1. A polydeoxyribonucleotide The complete genome sequence data of salmon Oncorhynchusketa was downloaded from the GenBank database of NCBI (National Center for Biotechnology Information). The salmon genome was comprehensively analyzed using BLAST. The target PDRN length was set to 500-1000 bases, candidate sequences were screened in the salmon genome, and the sequences were optimized to obtain the polydeoxyribonucleotide (PDRN) of the present invention having the nucleotide sequence shown in SEQ ID NO.1.

[0038] The above optimized sequence was commissioned to a gene synthesis unit for gene synthesis, and PCR amplification was performed using a primer pair (PDRN-F, PDRN-R) to obtain a PDRN amplified fragment. The sequence information of the primer pair (PDRN-F, PDRN-R) is shown in Table 1: Table 1 Primer pair sequence information

[0039] Note: In the table, "F" indicates forward primer and "R" indicates reverse primer.

[0040] 2. A genetic engineering vector 1) After pPIC9 plasmid extraction, take 50 μL of plasmid and add 30 μL of water, add 10 μL of enzyme (NcoI:XhoI = 1:1 v / v) and 10 μL of 10X buffer, mix well, incubate at 37°C for 3 hours, and then recover the vector to obtain the pPIC9 vector fragment recovered by enzyme digestion.

[0041] 2) Use GBclonart seamless cloning kit (Suzhou Shenzhou Gene Co., Ltd.) to construct the pPIC9-PDRN recombinant plasmid. The specific steps are as follows: Prepare the cloning reaction solution according to the reaction system in Table 2: Table 2 Reaction system

[0042] After the cloning reaction solution is mixed evenly, it is placed in a 45°C water bath for 30 minutes and then transferred to ice. DH-5α competent cells are added to 5 μL of the cloning reaction solution, placed on ice for 5 minutes, then placed in a 42°C water bath for 1 minute, and placed on ice for 2 minutes. 400 μL of LB medium is added, and the culture is revived at 37°C for 60 minutes, then centrifuged and evenly spread on an LB plate containing 100 mg / L Zeocin. The next day, clones are picked and cultured overnight, and plasmids are extracted to obtain pPIC9-PDRN recombinant plasmids. After the construction of the pPIC9-PDRN recombinant plasmid is completed, the gene synthesis unit performs full gene sequencing to verify the integrity of the recombinant plasmid.

[0043] 3. A genetically engineered cell The prepared recombinant plasmid pPIC9-PDRN 10μg was linearized with SacⅠ enzyme, precipitated and recovered with 2 times volume of anhydrous ethanol, and dissolved in 30μL ddH2O. Take 100μL Pichia pastaris GS115 competent cells and add 30μL linearized plasmid, mix and transfer to an electroporation cup, place on ice for a few minutes, put in an electroporator for electroporation (voltage 1680V, ​​electroporation time 5mS), add 1ml D-sorbitol (IM) immediately after electroporation, place on ice for a few minutes, and then spread the bacterial solution on a 100μg / mL G418 YPD plate and place it in a 28℃ incubator for culture. After antibiotic screening and PCR verification, the genetically engineered bacteria P.pastaris-pPIC9-PDRN were obtained.

[0044] Example 2 Fermentation of a PDRN genetically engineered strain and product purity verification The genetically engineered strain P.pastaris-pPIC9-PDRN was inoculated on a YPD plate at 30°C for 48 hours, and then a single colony was picked and inoculated into a 250mL shake flask containing 50mL YPD medium, and cultured at 30°C and 220r / min until OD600=7. The fermentation broth was centrifuged at 5000r / min for 5 minutes, and after removing the supernatant, the bacterial precipitate was washed twice with sterile saline. The bacterial cells were resuspended in 50mL BMMY medium with a pH of 6.0, and fermentation was continued at 30°C and 220r / min. 1% methanol was added every 24 hours to obtain PDRN. After fermentation for 72 hours, the fermentation supernatant was taken to determine the purity of the PDRN product.

[0045] The PDRN product was dissolved in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0), and the absorbance at 260nm and 280nm was detected by a spectrophotometer. The ratio of A260nm / A280nm was the purity of the polydeoxyribonucleotide (when the ratio of A260nm / A280nm was between 1.8-2.0, it indicated that the purity of PDRN was good). The results showed that the ratio of A260nm / A280nm of PDRN was 1.94, indicating that the PDRN prepared by the present invention had good purity.

[0046] Example 3 Anti-inflammatory effect of PDRN 1. Adjust the THP-1 cell density to 3×10 cells / mL using complete culture medium (RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin). 6 / ml, take 1ml and add it to the well plate, add 1ml 20ng / ml PMA to each well, and incubate in a 37℃ incubator for 24 hours; 2. Collect THP-1 cells and adjust the cell density to 0.5×10 6 / ml; add 200μLTHP-1 cells to a 96-well flat-bottom plate and incubate in a 37°C incubator overnight; 3. Discard 100 μL of cell supernatant and add 100 μL of 0.15 μg / mL LPS. The experimental group was added with 100 μL of PDRN prepared in Example 2 (25, 50, 100, 200, 500 μg / mL) diluted with complete medium at different concentrations, and the LPS group was added with 100 μL of complete medium as a control, and incubated in a 37°C incubator for 24 hours; 4. Collect 100 μL of cell supernatant and measure the expression levels of TNF-α and IL-6 according to the instructions of the ELISA kit. The results are shown in Table 3.

[0047] Table 3 Expression levels of TNF-α and IL-6

[0048] The results showed that the PDRN provided by the present invention can significantly inhibit the expression levels of inflammatory factors TNF-α and IL-6 in a dose-dependent manner, indicating that the PDRN of the present invention has a good anti-inflammatory effect.

[0049] Example 4 Study on the effect of PDRN on HUVEC wound healing 1. Adjust the HUVEC cell density to 1.25×10 5 / ml; add 200μL 1.25×10 5 Cells / ml were placed in a 37°C incubator and incubated overnight; 2. Discard all cell supernatants, add 200 μL of EBM2 medium containing 0.5% FBS, and incubate in a 37°C incubator for 24 hours; 3. Discard 100 μL of cell supernatant, use a scratcher to create wounds on HUVEC cells, and wash twice with serum-free EBM2 medium; 4. Place the cells in a living cell studio, add different concentrations of PDRN (25, 50, 100, 200, 500 μg / mL) prepared in Example 2 diluted with complete culture medium (EBM2 cell culture medium containing 0.5% FBS and 1% penicillin / streptomycin), and use complete culture medium as a control group. Take photos and record them at 24 hours, analyze the cell migration area with ImageJ, and calculate the cell migration rate. The results are shown in Table 4.

[0050] Table 4 Cell migration rate

[0051] The results showed that after 24 hours of treatment of HUVEC cells, compared with the untreated group, all concentrations of PDRN could increase the wound healing rate of HUVEC cells in a concentration-dependent manner. The higher the PDRN concentration, the stronger the wound healing effect of HUVEC cells. A higher wound healing rate means that HUVEC has a stronger angiogenesis ability, which can bring more oxygen and nutrients to the wound, remove metabolic waste, create a good microenvironment for wound healing, promote fibroblast proliferation, collagen synthesis, etc., and accelerate wound healing.

Claims

1. A polydeoxyribonucleotide, characterized in that: The polydeoxyribonucleotide comprises the nucleotide sequence shown in SEQ ID NO.1; or a partial fragment of the nucleotide sequence shown in SEQ ID NO.1; or a sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.

1.

2. A genetic engineering vector, characterized in that: The genetic engineering vector comprises the polydeoxyribonucleotide according to claim 1.

3. A genetically engineered cell, characterized in that: The genetically engineered cell comprises the genetically engineered vector according to claim 2.

4. The method for preparing the polydeoxyribonucleotide according to claim 1, characterized in that: The preparation method comprises constructing a genetically engineered cell that overexpresses a polydeoxyribonucleotide, wherein the polydeoxyribonucleotide comprises a nucleotide sequence shown in SEQ ID NO.1; or a partial fragment of the nucleotide sequence shown in SEQ ID NO.1; or a sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.

1.

5. The preparation method according to claim 4, characterized in that: The preparation method comprises transducing expression cells through a genetic engineering vector and expressing polydeoxyribonucleotides.

6. Use of the polydeoxyribonucleotide according to claim 1, the genetic engineering vector according to claim 2, the genetic engineering cell according to claim 3 or the polydeoxyribonucleotide obtained by the preparation method according to any one of claims 4 to 5 in the preparation of anti-inflammatory or healing-promoting products.

7. The use according to claim 6, characterized in that: The products mentioned include medicines, cosmetics or medical devices.

8. The use according to claim 7, characterized in that: The medicine also includes pharmaceutically acceptable excipients; the cosmetics also include cosmetically acceptable additives.

9. A medicine, characterized in that: The medicine comprises the polydeoxyribonucleotide according to claim 1, the genetic engineering vector according to claim 2, the genetic engineering cell according to claim 3 or the polydeoxyribonucleotide obtained by the preparation method according to any one of claims 4-5.

10. A cosmetic, characterized in that: The cosmetic comprises the polydeoxyribonucleotide according to claim 1, the genetic engineering vector according to claim 2, the genetic engineering cell according to claim 3 or the polydeoxyribonucleotide obtained by the preparation method according to any one of claims 4-5.

11. A medical device, characterized in that: The medical device comprises the polydeoxyribonucleotide according to claim 1, the genetic engineering vector according to claim 2, the genetic engineering cell according to claim 3 or the polydeoxyribonucleotide obtained by the preparation method according to any one of claims 4-5.

Images