A nano-magnetic bead mediated method for transgenic pollen tube pathway of puccinellia distans
The pollen tube pathway transgenic method mediated by nanomagnetic beads has solved the problem of tissue culture dependence in the genetic engineering breeding of Napier grass, realizing an efficient and simple transgenic technology, improving pollen viability and transfection efficiency, and providing a way to obtain transgenic plants that do not rely on tissue culture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2025-03-10
- Publication Date
- 2026-07-21
AI Technical Summary
Existing genetic engineering breeding methods for Napier grass rely on tissue culture systems, which are cumbersome and inefficient, limiting their application and development in ornamental grass breeding.
The pollen tube pathway transgenic method mediated by nanomagnetic beads involves magnetic transfection of pollen culture medium by mixing magnetic beads and plasmid DNA complexes with the pollen culture medium, followed by artificial pollination. This method avoids the tissue culture step, improves transformation efficiency, and simplifies operation.
This study achieved efficient transgenicization of Napier grass, simplified the operation process, improved pollen viability and transfection efficiency, provided a method for obtaining transgenic plants without relying on tissue culture, and filled the gap in pollen-mediated transgenic research on Napier grass.
Smart Images

Figure CN119979598B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant transgenic technology, specifically relating to a method for transgenic pollen tube pathways of Pennisetum arvense mediated by nanomagnetic beads. Background Technology
[0002] With the comprehensive development of my country's social economy and the improvement of people's living standards, the existing horticultural varieties can no longer meet people's spiritual needs for beauty, and there is an urgent need to cultivate more novel varieties. Therefore, ornamental plant breeding is becoming increasingly important.
[0003] Pennisetum alopecuroides is a perennial grass belonging to the genus Pennisetum in the family Poaceae. It possesses strong resistance to adverse conditions, tolerance to salinity and alkalinity, and low water consumption, making it suitable for soil and water conservation, windbreak and sand fixation, and landscaping. It is an important ornamental grass. However, for most ornamental grasses, due to their cross-pollination, complex ploidy, and lack of a stable genetic transformation system, conventional hybridization and selective breeding remain the primary methods. The application of genetic engineering breeding in Pennisetum alopecuroides is still in its early stages.
[0004] Research on transgenic technology for Napier grass is still in its early stages compared to other model crops. In 2002, Maram Girgi et al. obtained herbicide-resistant Napier grass using the gene gun method. Wang Pingqing et al. (2007) successfully obtained transgenic regenerated plants by transforming Arabidopsis thaliana CBF1 transcription factor into hybrid Napier grass leaves using Agrobacterium-mediated transformation. Gong Shufang et al. (2010) conducted related research on tissue culture of Napier grass using seeds as explants. Mu Tong et al. (2013) used Napier grass callus tissue as the recipient for genetic transformation and introduced the ryegrass antifreeze protein gene using Agrobacterium-mediated transformation, thus initially establishing a genetic transformation system for Napier grass. However, these traditional methods still have limitations: for example, the gene gun method requires expensive equipment and materials, the Agrobacterium-mediated transformation method has low transformation efficiency, requires a mature genetic transformation system, and the operation steps are cumbersome. These factors limit the application and development of genetic engineering breeding of Napier grass. Therefore, there is an urgent need for a highly efficient DNA introduction method for Napier grass that does not rely on a tissue culture system and is not limited by genotype. Summary of the Invention
[0005] To address the aforementioned problems in the prior art, this invention provides a method for transgenic pollen tube pathways in *Pennisetum comosum*, comprising the following steps:
[0006] Steps for combining magnetic beads and plasmid DNA: Mix magnetic beads and plasmid DNA thoroughly and let stand to obtain magnetic bead-DNA complex;
[0007] Step for combining magnetic bead-DNA complex and pollen culture medium: Mix the magnetic bead-DNA complex with pollen open-cell culture medium to obtain magnetic bead-DNA-pollen culture medium;
[0008] Magnetic transfection step: Mix the Napier grass pollen with the magnetic bead-DNA-pollen culture medium and perform magnetic transfection to obtain transfected pollen;
[0009] Pollination steps: The transfected pollen is dried and then pollinated on the female inflorescences of Pennisetum arvense to obtain pollinated inflorescences.
[0010] Compared with the prior art, the present invention has the following beneficial effects:
[0011] 1. The present invention utilizes a nano-magnetic bead-mediated transformation method, which, compared with traditional transformation methods, does not require tissue culture, has milder transformation conditions, and a shorter transformation time. It is a highly efficient and rapid transformation method, which has great guiding significance for the genetic breeding of Napier grass.
[0012] 2. This invention combines nanomagnetic conversion technology with pollen-mediated transformation, overcoming the difficulties of traditional transgenic technology such as long tissue culture cycles, susceptibility to contamination, and cumbersome procedures. Artificial pollination can yield a large number of seeds, providing more material for subsequent screening of transgenic plants.
[0013] 3. This invention is the first to be successfully applied to the transformation of Napier grass, which can improve pollen viability and transfection efficiency, and provides a method for obtaining transgenic plants without relying on tissue culture technology.
[0014] 4. This invention establishes a nano-magnetic bead transformation system for Napier grass, filling the gap in pollen-mediated transgenic research on Napier grass. In subsequent research, gene editing technology can be comprehensively applied to provide a foundation for subsequent transgenic breeding.
[0015] 5. The method of the present invention is simple to operate and saves resources; the synergistic effect between the various operation steps achieves excellent results. Attached Figure Description
[0016] Figure 1 This is a map of the pMDC85 plasmid.
[0017] Figure 2 The image shows the electrophoresis result of the PCR test in Example 1.
[0018] Figure 3 This is a laser confocal imaging image of Example 1.
[0019] Figure 4 The image shows the electrophoresis results of the magnetic bead-plasmid complex detection in Experiment Example 1 (A is before enzyme digestion, B is after enzyme digestion).
[0020] Figure 5 This is a scanning electron microscope image of the pollen morphology in Experiment Example 1.
[0021] Figure 6 Electron micrographs (A) of pollen morphology and bar graphs (B) of pollen germination rate at different temperatures in Experiment Example 1.
[0022] Figure 7 Electron micrographs (A) of pollen morphology at different transfection times in Experiment Example 1, bar graph of pollen porosity (B), and bar graph of pollen viability (C).
[0023] Figure 8 The images show the growth of seeds from untransfected and transfected pMDC85 plasmid inflorescences of Experiment 1 on a medium containing 80 mg / L hygromycin. Detailed Implementation
[0024] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0025] This invention provides a method for transgenic pollen tube pathways of Pennisetum arvense mediated by magnetic nanobeads, the method comprising the following steps:
[0026] Steps for combining magnetic beads and plasmid DNA:
[0027] The magnetic beads and plasmid DNA were mixed and allowed to stand to obtain the magnetic bead-DNA complex.
[0028] As a preferred embodiment, the magnetic beads are nano-magnetic beads with an average particle size of 50-200 nanometers, preferably 100 nanometers; the storage concentration of the magnetic beads is 1 μg / μL, preferably using POLYMAG 100 magnetic transfer reagent from Chemcell, Germany.
[0029] The plasmids mentioned above can be any plasmids currently available in the field of plant genetic engineering, any commercially available plasmids, or plasmids constructed by introducing other DNA fragments. As a preferred embodiment, the plasmid DNA is either the pMDC85 plasmid or the pYBA1132 plasmid.
[0030] In a preferred embodiment, the mass ratio of the magnetic beads to plasmid DNA is 1:(3-5), for example, any one or a range between two of 1:3, 1:3.5, 1:4, 1:4.5 and 1:5, for example, 1:(3-4), 1:(3.5-4.5), 1:(4-5); preferably 1:4.
[0031] In a preferred embodiment, the temperature for mixing and settling the magnetic beads and plasmid is 20–30°C, for example, any one or two of the following ranges: 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, and 30°C, for example, 24-26°C, 23-27°C, 22-28°C, 21-29°C, or 21-26°C, preferably 25°C; the mixing and settling time is 20–40 minutes, for example, 20 minutes, 21 minutes, 24-30°C, 25-27°C, 22-28°C, 21-29°C, or 21-26°C. The time is within any one or two of the following: 2 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, and 40 minutes, for example, 28-32 minutes, 26-34 minutes, 24-36 minutes, 22-38 minutes, 25-35 minutes, and 23-37 minutes, preferably 30 minutes.
[0032] Steps for combining magnetic bead-DNA complexes with pollen culture medium:
[0033] The above magnetic bead-DNA complex was mixed with pollen open-cell culture medium to obtain magnetic bead-DNA-pollen culture medium.
[0034] In a preferred embodiment, the mass-to-volume ratio (w / v) of magnetic beads to pollen open-cell culture medium is (5–20):10000, for example 5:10000, 6:10000, 7:10000, 8:10000, 9:10000, 10:10000, 11:10000, 12:10000, 13:10000, 14:10000, 15:10000, 16:1000. The range is any one or two of 0, 17:10000, 18:10000, 19:10000, and 20:10000, for example, (10-14):10000, (8-16):10000, (6-18):10000, (7-15):10000, (9-17):10000, and (11-19):10000, preferably 12:10000.
[0035] In a preferred embodiment, the above-mentioned pollen open-cell culture medium includes:
[0036] Sucrose 150-200 g / L, MgSO4·7H2O 200-300 mg / L, H3BO3 30-100 mg / L, KNO3 50-150 mg / L, Ca(NO3)2·4H2O 180-300 mg / L, MnSO4·H2O 100-200 mg / L, GA3 20-30 mg / L.
[0037] The preferred composition is: sucrose 171 g / L, MgSO4·7H2O 246 mg / L, H3BO3 63 mg / L, KNO3 100 mg / L, Ca(NO3)2·4H2O 236 mg / L, MnSO4·H2O 169 mg / L, GA3 25 mg / L.
[0038] Magnetic transfer steps:
[0039] The above-mentioned Napier grass pollen and magnetic bead-DNA-pollen culture medium were mixed and magnetically transfected to obtain transfected pollen.
[0040] As a preferred embodiment, the above-mentioned pampas grass pollen is freshly released pollen; the pollen is collected on a sunny morning between 9 and 12 o'clock, when pampas grass releases a large amount of pollen, and a large amount of fresh pollen can be obtained for the experiment.
[0041] The above-mentioned Napier grass can be selected from all existing varieties, with "Liqiu" Napier grass being the preferred choice.
[0042] As a preferred embodiment, the above-mentioned magnetic bead-DNA-pollen culture medium has been pre-cooled to a temperature of 4-10°C, preferably 8°C.
[0043] As a preferred embodiment, the mass-to-volume ratio of the above-mentioned Napier grass pollen and magnetic bead-DNA-pollen culture medium is 1:(3-5), for example, any one or a range between two of 1:3, 1:3.5, 1:4, 1:4.5 and 1:5, for example, 1:(3-4), 1:(3.5-4.5), 1:(4-5), preferably 1:4.
[0044] In a preferred embodiment, the magnetic transfection time is 10 to 50 minutes, preferably 30 minutes, and the transfection temperature is 4 to 10°C, for example, any one or two of 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, and 10°C, for example, 4 to 8°C, 6 to 10°C, 7 to 9°C, 5 to 8°C, preferably 8°C; during the magnetic transfection process, the container is shaken every 5 to 15 minutes to ensure that the Napier grass pollen is fully immersed in the magnetic bead-DNA complex solution.
[0045] Compared with transfection at room temperature, the viability of Pennisetum pollen is better when transfected at a low temperature of 4-10℃, meaning that more surviving pollen can complete the opening and subsequent transfection experiments, thus improving the transfection efficiency.
[0046] Pollination steps:
[0047] The transfected pollen was dried and then used to pollinate the female inflorescences of Pennisetum arvense to obtain pollinated inflorescences.
[0048] The above drying method can be as follows: take a 500-mesh nylon cloth and lay it evenly, place two layers of absorbent filter paper underneath, transfer the transdyed pollen onto the nylon cloth to absorb the moisture, and obtain the dried pollen.
[0049] The female flowers of the aforementioned Pennisetum arvense underwent reproductive isolation before pollination; the inflorescences after pollination also underwent reproductive isolation.
[0050] The female inflorescence of the aforementioned Pennisetum has a pistil stigma that protrudes 1-4 mm, while the stamens have not yet emerged from the lemma.
[0051] This invention employs a method of first preparing the magnetic bead-DNA complex, then mixing it with pollen culture medium, and finally adding pollen. Compared to the method of first mixing pollen and pollen complex solution and then adding the magnetic bead-DNA complex, this method increases the contact time between pollen and the magnetic bead-DNA complex within the same transfection time. It also increases the time for the pollen pores to open, facilitating the entry of the magnetic bead-DNA complex into the pollen pores, and makes the operation more convenient.
[0052] The above mass-to-volume ratio (w / v) is the ratio between the mass of the solid added to the liquid (or suspension) and the volume of the liquid (or suspension); for example, a w / v of 1:4 means that 1 g of solid is added to 4 mL of liquid (or suspension).
[0053] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.
[0054] Example 1
[0055] This embodiment illustrates a method for transgenic pollen tube pathways of *Phaseolus pentaphyllum* mediated by magnetic nanobeads. The method includes the following steps:
[0056] S1: Constructing magnetic bead-DNA complexes
[0057] Magnetic nanoparticles polyMAG100 (i.e., magnetic nanobeads with an average particle size of 100 nm, a storage concentration of 1 μg / μL, and POLYMAG 100 magnetic transfection reagent from Chemical, Germany) were used as gene vectors, along with extracted pMDC85 plasmid. The nanobeads and plasmid were mixed at a mass ratio of 1:4, with 4.8 μg of magnetic nanobeads and 19.2 μg of pMDC85 plasmid. The mixture was incubated at 25 °C for 30 min to construct a magnetic bead-DNA complex (i.e., nanocarrier-gene complex).
[0058] S2: Preparation of magnetic bead-DNA-pollen culture medium
[0059] The magnetic bead-DNA complex obtained in step S1 above is mixed evenly with 4 mL of pollen culture medium to obtain magnetic bead-DNA-pollen culture medium.
[0060] The pollen culture medium contained: 171 g / L sucrose, 246 mg / L MgSO4·7H2O, 63 mg / L H3BO3, 100 mg / L KNO3, 236 mg / L Ca(NO3)2·4H2O, 169 mg / L MnSO4·H2O, and 25 mg / L GA3.
[0061] S3: Collect foxtail grass pollen
[0062] Collect fresh pollen from newly opened 'Liqiu' pampas grass between 9 and 12 a.m. on a sunny morning. Then sift the pollen (1mm aperture) and collect the clean, fresh pollen.
[0063] The "Liqiu" Napier grass variety was purchased from Beijing Academy of Agricultural Sciences Seed Technology Co., Ltd., with product number "Guo S-BV-PA-007-2021". This "Liqiu" Napier grass is also preserved at the National Grass Germplasm Resource Bank of the National Animal Husbandry Service, with the contact number 010-59194608. Anyone may freely obtain "Liqiu" Napier grass to achieve the purposes of this invention.
[0064] S4: Magnetic transfer dyeing
[0065] Weigh approximately 1g of sieved pollen and carefully transfer it to a centrifuge tube. Add 4mL of pre-cooled magnetic bead-DNA-pollen culture medium obtained in step S2 above at 8°C to fully submerge the pollen. Cover the culture dish and place it on a magnetic plate (MagnetoFACTOR 96 plate (catalog number 9008 96, Chemical GmbH, Germany)). Incubate at 8°C for 30 minutes, gently shaking the centrifuge tube every 15 minutes to ensure the pollen is fully submerged in the pollen culture medium. This yields the magnetically converted pollen (i.e., the transfected pollen).
[0066] S5: Pollination
[0067] Spread a 500-mesh nylon cloth evenly, and place two layers of absorbent filter paper underneath. Transfer the magnetically converted pollen obtained in step S4 onto the nylon cloth and absorb the moisture. Take the dried pollen and select inflorescences for reproductive isolation. Pollinate the inflorescences where the stigma of the pistil is 1-4 mm above the lemma and the stamens have not yet emerged from the lemma. After pollination, isolate the inflorescences by bagging them.
[0068] Detection Example 1
[0069] This test example describes the screening and testing of seeds produced from pollinated inflorescences in Example 1.
[0070] After harvesting the seeds from the pollinated inflorescence in Example 1, 150 seeds were randomly selected.
[0071] 1. Hygromycin resistance screening
[0072] Since the pMDC85 plasmid contains a hygromycin resistance gene, it can be initially screened using hygromycin culture medium.
[0073] Prepare a 1 / 2 MS resistance medium with a concentration of 80 mg / L hygromycin. Disinfect the transfected Napier grass seeds with a 1% sodium hypochlorite solution for 10 min, rinse twice with water, and inoculate them into the resistance medium in a clean bench. Observe the root development of the seedlings after 10 days, and select seedlings with good root growth to transplant into seedling trays.
[0074] 2. PCR detection
[0075] Plants that could survive on hygromycin-resistant medium were transferred into pots, and PCR was performed on the surviving plants. Primers designed using the hygromycin resistance gene sequence were used for PCR, and plants with the introduced plasmid showed the target band.
[0076] When the plants grew to approximately 10–15 cm, a total of 13 surviving transfected seedlings were formed. DNA was extracted from these 13 seedlings using the CTAB method. PCR identification was performed using standard PCR and primers specific to the hygromycin resistance gene. Wild-type plants and H2O were used as negative controls, and the PMDC85 plasmid was used as a positive control. The PCR products were subjected to agarose gel electrophoresis, and the size of the target band was observed to ensure it met expectations. The target band was 232 bp, and plants matching the target band size were considered positive.
[0077] The coding sequence of the hygromycin resistance gene is as follows:
[0078] ATGAAAAAGCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTG
[0079] ATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGC
[0080] GAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCC
[0081] TGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTAT
[0082] CGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACATTG
[0083] GGGAGTTTAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGG
[0084] GTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTAC
[0085] AACCGGTCGCGGAGGCTATGGATGCGATCGCTGCGGCCGATCTTAGCC
[0086] AGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACA
[0087] CTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCAC
[0088] TGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCT
[0089] CTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCAC
[0090] CTCGTGCACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGC
[0091] CGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCC
[0092] CAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTA
[0093] TGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAG
[0094] GATCGCCACGACTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACT
[0095] CTATCAGAGCTTGGTTGACGGCAATTTCGATGATCAGCTTGGGCGCAG
[0096] GGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGT
[0097] ACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTA
[0098] GAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGG
[0099] GCAAAGAAATA.
[0100] The following primers were designed upstream and downstream of the hyg gene in the pMDC85 plasmid:
[0101] HYG-F: 5'-CTTCTGCGGGCGATTTGTGT-3';
[0102] HYG-R: 5'-GGCCGTGGTTGGCTTGTATG-3'.
[0103] In the above PCR tests, amplification was performed using a standard PCR enzyme.
[0104] In the above PCR detection, the PCR reaction system (25 μ5) was as follows:
[0105] 2×Taq Master Mix (Dye Plus) 12.5 μL, HYG-F 1 μL, HYG-R 1 μL, DNA 1 μL, ddH2O 9.5 μL.
[0106] In the above PCR detection, the PCR reaction procedure is as follows:
[0107] First, 95℃ for 3 minutes; then 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 30 seconds, for a total of 30 cycles; then 72℃ for 5 minutes; then keep warm at 12℃.
[0108] The results are as follows Figure 2 As shown, the results revealed that a clear 232bp target band could be amplified in 7 plants, and the sequencing results were correct, proving that 7 positive plants were obtained. Figure 2 In the diagram, each lane is labeled: M: Marker; Blank control: H2O; Positive control: pMDC85; Each number represents the number of the strain that was verified as positive.
[0109] The validation results show that the positive line rate reached 4.66% (7 / 150) among all seeds. The results indicate that the nano-magnetic bead-mediated pollen tube pathway method for *Pennisetum alopecuroides* significantly improves the success rate of transgenic *Pennisetum alopecuroides*, demonstrating it as a simple and highly effective transgenic technology.
[0110] 3. Observe positive plants using a confocal microscope
[0111] Seven positive plants validated by PCR were subjected to laser confocal microscopy. Plants inoculated with the target plasmid possessed the eGFP gene and exhibited green fluorescence. Subcellular localization of the pMDC85 plasmid was performed to facilitate subsequent observation of GFP localization in the positive plants.
[0112] GFP fluorescence verification was performed on positive plants that had been validated by PCR. Specifically, the root tip of the plant was taken, cut into segments of approximately 0.5-1 cm, placed on a glass slide, a drop of water was added, the slide was pressed, and observed and photographed under a laser confocal microscope. Figure 3 As shown, using the root system of wild-type *Pennisetum purpureum* as a control, it was found that the cell membrane of plants transfected with the pMDC85 plasmid showed green fluorescence under a confocal microscope.
[0113] Experimental Example
[0114] This experimental example is used to describe the effects of various reaction conditions and parameters on the conversion method in the pollination method of Example 1 and the detection method of Detection Example 1.
[0115] 1. Nanomagnetic bead load detection.
[0116] (1) Using the magnetic nanoparticles polyMAG100 and pMDC85 plasmid from Example 1, nanocarrier-gene complexes with different mass ratios were constructed by incubating at 25°C for 30 min at the following gradient mass ratios: 1:2, 1:4 (the ratio in Example 1), 1:10, 1:20, 1:50, and 1:100. In all nanocarrier-gene complexes (i.e., MNP / DNA complexes), the amount of DNA was fixed at 1 μg.
[0117] A portion of the above MNP / DNA complex was stored for later use; the other portion was subjected to the following enzyme digestion treatment (5 μL): 1 μL of Xho I was used to digest the complex at 37 °C for 16 h to obtain the digestion product.
[0118] (2) The binding ability of pure plasmid DNA, MNP / DNA complex, and enzyme digestion products to DNA was analyzed by agarose gel electrophoresis retardation experiment.
[0119] The above nanocarrier-gene complex and enzyme digestion products were subjected to electrophoresis: in 0.6% agarose gel and TAE buffer (200mM Tris, 200mM acetic acid, 5mM EDTA), at 150V for 15min.
[0120] The results are as follows Figure 4 As shown in Part A, the results demonstrate that the magnetic nanoparticles possess excellent DNA loading and binding capacity. The maximum loading capacity is achieved when the mass ratio of the magnetic nanoparticles polyMAG100 to the pMDC85 plasmid is 1:4. Part B shows that the MNP / DNA complex effectively resists nuclease digestion. MNP / DNA complexes (green) with mass ratios of 1:2, 1:4, and 1:10 remain in the wells, and no diffuse bands from enzyme digestion appear in the lanes. Correspondingly, as the proportion of MNP in the MNP / DNA complex decreases, in lanes with ratios of 1:20, 1:50, and 1:100, excess DNA migrates with the electric field and is cleaved by the restriction endonuclease Xho I, forming a linear plasmid band. This indicates that magnetic nanoparticles not only possess excellent DNA loading and binding capacity but also protect DNA from enzymatic degradation. Figure 4 In the process, the electrophoretic bands were observed using a Bio-Rad imaging system after electrophoresis. Part A is the agarose gel electrophoresis analysis of the MNP / DNA complex; Part B is the agarose gel electrophoresis analysis of the MNP / DNA complex enzyme digestion products.
[0121] 2. Morphological observation of Pennisetum pollen.
[0122] (1) Before the *Pennisetum oleraceum* began to shed pollen, it was bagged using a white, semi-transparent, breathable plastic bag. Once pollen shedding was observed, the bag was gently tapped to release pollen from the stamens into the bag. The bag was then placed in a sealed bag and stored at 4°C. The collected pollen was sieved (1 mm pore size), and 1 g of fresh, clean pollen was placed in 4 mL of open-cell pollen culture medium (same composition as in Example 1) and cultured for 10 min.
[0123] (2) Place 20 sheets of absorbent paper at the bottom and 300 mesh nylon cloth on top. After gently mixing the pollen culture solution, pour it onto the nylon cloth. Fold the nylon cloth and absorbent paper in half and gently press the paper towel to absorb the moisture to obtain the dried pollen.
[0124] (3) Observe the morphology of the dried pollen under a scanning electron microscope. For example... Figure 5As shown, after 10 minutes of culture in pollen medium, the germination pores of *Pennisetum oleraceum* pollen opened, facilitating the entry of exogenous substances; while the germination pores of pollen not cultured in pollen medium did not open, preventing the entry of exogenous substances. This demonstrates that the pollen culture medium environment is crucial for the transfer of MNP / DNA complexes into pollen. The pollen culture medium primarily promotes pore opening, while the low-temperature environment helps maintain pollen viability.
[0125] 3. Screening for the optimal temperature for Pennisetum transfection.
[0126] (1) Using Reeves's grass as material, the young spikelet of Reeves's grass was bagged with a semi-transparent breathable bag. After the spikelet finished dispersing pollen, the bag was gently shaken to disperse the pollen in the bag for collection.
[0127] (2) After pollen collection and sieving, 5 mg of pollen was weighed and 20 μL of pollen culture medium was added. After opening the wells for 30 min at 4℃, 8℃, 12℃, 16℃ and room temperature, 180 μL of pollen in vitro liquid culture medium (50 mg / L sucrose + 0.08 mg / L boric acid + 0.04 mg / L calcium chloride) was added and cultured in the dark for 3 h at 4℃, 8℃, 12℃, 16℃ and room temperature.
[0128] (4) Observe the pollen state under an electron microscope, count the pollen using a cell counting plate, and consider germination as successful when the pollen tube elongation is greater than half of its own length. Calculate the germination rate (number of germinated pollen grains / total number of pollen grains) to determine the optimal pollen transfection temperature.
[0129] like Figure 6 As shown in Part B, statistical analysis of pollen germination rates indicates that at 4℃ and 8℃, the germination rates of pollen are not significantly different from those of pollen without magnetic transfection at room temperature, thus maximizing pollen viability. Figure 6 In the diagram, RT in Part A indicates magnetic transfection performed at room temperature (25°C), and untransfected indicates that the pollen was not treated with pollen transfection solution at room temperature; Part A represents the germination state of pollen after magnetic transfection at different temperatures.
[0130] 4. Screening for the optimal time for Pennisetum transfection.
[0131] (1) Plasmid DNA and magnetic nanobeads were placed at 25°C for 30 min at the optimal ratio (1:4) and then added to pollen open-cell culture medium (transfection medium pre-cooled at 8°C). 2 g of pollen was weighed and fully immersed in 8 ml of pollen open-cell culture medium. Three different transfection times were set: 0.5 h, 1 h, 2 h, and 5 h. The magnetic nanogene vector was used to adsorb plasmid DNA and, under the action of a magnetic field, the constructed vector was introduced into the pollen.
[0132] (2) After drying the pollen that has been transfected and opened for a certain period of time, observe it under a scanning electron microscope to study its morphology and structure, and explore the opening rate of pollen under different transfection conditions.
[0133] like Figure 7 As shown, the pollen porosity was observed using electron microscopy at four different transfection times: 0.5h, 1h, 2h, and 5h. The porosity was highest at 5h (48.6%), while it was 27.9% after 0.5h (p<0.05). Figure 7 B). Pollen viability analysis revealed no significant difference in viability due to pollen transfection time. Figure 7 C). When selecting the optimal opening time, considering the peak pollen shedding and stigma viability at noon, and taking into account factors such as pollen viability and opening rate of *Pennisetum 'Liqiu'*, as well as the pollination environment, 0.5 h was chosen as the transfection time for the opening solution. The opening rate mentioned above is calculated by dividing the number of open pollen pores in the figure by the number of visible pollen pores. Pollen viability is determined by staining the transfected pollen with a 1% iodine-potassium iodide solution and then dividing the number of viable pollen pores by the total number of pollen pores. Figure 7 In the image, Part A shows SEM images of pollen pretreated with transfection buffer at different times at 8℃, Part B shows a bar chart of pollen porosity, and Part C shows a bar chart of pollen viability.
[0134] 5. Screening of the optimal working concentration for hygromycin resistance in Napier grass seeds.
[0135] Because the pMDC85 plasmid contains a hygromycin resistance gene, hygromycin-resistant plants can be preliminarily screened using hygromycin-containing medium. Plants not transfected with the plasmid do not have hygromycin resistance; in 80 mg / mL hygromycin medium, most seeds have difficulty rooting or develop poor root tips after rooting, gradually turning yellow. Transfected seeds, however, can grow normally.
[0136] (1) In order to establish a hygromycin resistance screening system for “Liqiu” Napier grass, 1 / 2 MS medium with hygromycin concentrations of 0 mg / L, 60 mg / L, 70 mg / L and 80 mg / L (the same as in test example 1) was prepared.
[0137] (2) Disinfect the 'Liqiu' Napier seeds that have not undergone magnetic transfection, inoculate them into hygromycin culture media with different working concentrations, observe the development of seedling roots, and screen the optimal working concentration of hygromycin.
[0138] (3) Results: It was found that all seeds grew normally on a medium with 0 mg / L hygromycin; however, some seeds were inhibited on mediums with 60 mg / L and 70 mg / L hygromycin. Figure 8As shown, the growth of untransfected WT seeds was inhibited on a medium containing 80 mg / L hygromycin, while the transfected seeds grew normally. Therefore, 80 mg / L hygromycin can be used to screen for magnetically transfected Napier grass seeds.
[0139] Example 2
[0140] This embodiment illustrates a method for transgenic pollen tube pathways of *Phaseolus pentaphyllum* mediated by magnetic nanobeads. The method includes the following steps:
[0141] S1: The magnetic nanoparticles polyMAG100 and pMDC85 plasmid described in Example 1 were mixed at a mass ratio of 1:3, wherein the magnetic nanoparticles were 4.8 μg and the pMDC85 plasmid was 14.4 μg. The mixture was incubated at 20°C for 20 min to construct the magnetic bead-DNA complex.
[0142] S2: Mix the above magnetic bead-DNA complex with 9.6 mL of the pollen culture medium described in Example 1 to obtain magnetic bead-DNA-pollen culture medium.
[0143] S3: Same operation as in Example 1.
[0144] S4: Similar to the operation in Example 1, except that: 1g of sieved pollen is weighed and 3mL of the above magnetic bead-DNA-pollen culture medium that has been pre-cooled to 4°C is added; the magnetic transfection time is 10min and the temperature is 4°C, and the centrifuge tube is shaken every 5min.
[0145] S5: Same operation as in Example 1.
[0146] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Five positive plants were detected.
[0147] Example 3
[0148] This embodiment illustrates a method for transgenic pollen tube pathways of *Phaseolus pentaphyllum* mediated by magnetic nanobeads. The method includes the following steps:
[0149] S1: The magnetic nanoparticles polyMAG100 and pMDC85 plasmid described in Example 1 were mixed at a mass ratio of 1:5, wherein the magnetic nanoparticles were 4.8 μg and the pMDC85 plasmid was 24 μg. The mixture was incubated at 40°C for 30 min to construct a magnetic bead-DNA complex.
[0150] S2: Mix the above magnetic bead-DNA complex with 2.4 ml of the pollen culture medium described in Example 1 to obtain magnetic bead-DNA-pollen culture medium.
[0151] S3: Same operation as in Example 1.
[0152] S4: Similar to the operation in Example 1, except that: 1g of sieved pollen is weighed and 5mL of the above magnetic bead-DNA-pollen culture medium that has been pre-cooled at 10°C is added; the magnetic transfection time is 50min and the temperature is 10°C, and the centrifuge tube is shaken every 15min.
[0153] S5: Same operation as in Example 1.
[0154] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Five positive plants were detected.
[0155] Example 4
[0156] This embodiment describes a method for transgenic pollen tube pathways of *Phaseolus philippinensis* mediated by nanomagnetic beads, which includes the following steps.
[0157] S1: The quality and amount of the magnetic nanoparticles polyMAG100 and pMDC85 plasmid are the same as in Example 1. They are mixed and placed at 22°C for 28 min to construct a magnetic bead-DNA complex.
[0158] S2: Same operation as in Example 1.
[0159] S3: Same operation as in Example 1.
[0160] S4: The operation is similar to that in Example 1, except that the pre-cooling temperature of the magnetic bead-DNA-pollen culture medium is 9°C; the magnetic transfection time is 12 min at 9°C, and the centrifuge tube is shaken every 5 min.
[0161] S5: Same operation as in Example 1.
[0162] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Five positive plants were detected.
[0163] Comparative Example 1
[0164] Except for the following operations and parameters, this comparative example is the same as Example 1:
[0165] The settling time for step S1 is 18 minutes.
[0166] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Two positive plants were detected.
[0167] Comparative Example 2
[0168] Except for the following operations and parameters, this comparative example is the same as Example 1:
[0169] The settling time for step S1 is 42 minutes.
[0170] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Two positive plants were detected.
[0171] Comparative Example 3
[0172] Except for the following operations and parameters, this comparative example is the same as Example 1:
[0173] The settling temperature in step S1 is 18°C.
[0174] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Two positive plants were detected.
[0175] Comparative Example 4
[0176] Except for the following operations and parameters, this comparative example is the same as Example 1:
[0177] The settling temperature in step S1 is 42℃.
[0178] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Two positive plants were detected.
[0179] Comparative Example 5
[0180] Except for the following operations and parameters, this comparative example is the same as Example 1:
[0181] In step S3, collect fresh flower pollen from newly opened pampas grass between 13:00 and 15:00 on a sunny afternoon.
[0182] After harvesting seeds from the pollinated inflorescences, 150 seeds were randomly selected and screened for hygromycin resistance using the method described in Example 1, and PCR detection was performed. Three positive plants were detected.
[0183] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A method for transgenic pollen tube pathways in *Pennisetum comosum*, characterized in that: The method includes the following steps: Steps for combining magnetic beads and plasmid DNA: Mix magnetic beads and plasmid DNA thoroughly and allow to stand to obtain a magnetic bead-DNA complex; wherein, the magnetic beads are nano-magnetic beads with an average particle size of 50-200 nm; the plasmid DNA is pMDC85 plasmid; the mass ratio of magnetic beads to plasmid DNA is 1:(3-5); the temperature at which the magnetic beads and plasmid are allowed to stand is 20-30℃; the time is 20-40 minutes; Steps for combining magnetic bead-DNA complex and pollen culture medium: Mix the magnetic bead-DNA complex with pollen open-cell culture medium to obtain magnetic bead-DNA-pollen culture medium; wherein, the mass-volume ratio of the magnetic beads and the pollen open-cell culture medium is (5~20):10000. Magnetic transfection procedure: The *Phaseolus pennisetum* pollen and the magnetic bead-DNA-pollen culture medium are mixed and magnetic transfection is performed to obtain transfected pollen; the temperature of the magnetic bead-DNA-pollen culture medium is 4~10℃, and the temperature of the magnetic transfection is 4~10℃; the magnetic transfection time is 30 minutes, with the transfection system shaken every 15 minutes; wherein, the mass-to-volume ratio of *Phaseolus pennisetum* pollen to the magnetic bead-DNA-pollen culture medium is 1:(3~5). The method for collecting the pollen of the foxtail grass is as follows: before the foxtail grass begins to shed pollen, it is bagged; after observing that the foxtail grass begins to shed pollen, the paper bag is gently tapped to allow the pollen to fall from the stamens into the paper bag, and the paper bag is placed in a sealed bag and stored at 4°C. Pollination steps: The transfected pollen is dried and then pollinated on the female inflorescences of Pennisetum arvense to obtain pollinated inflorescences.
2. The method according to claim 1, characterized in that: The average particle size of the magnetic nanobeads is 100 nanometers.
3. The method according to claim 2, characterized in that: The mass ratio of the magnetic beads to the plasmid DNA is 1:
4.
4. The method according to claim 3, characterized in that: The magnetic beads and plasmids were left to stand at 25°C for 30 minutes.
5. The method according to claim 4, characterized in that: The mass-to-volume ratio of the magnetic beads to the pollen open-cell culture medium is 12:10000.
6. The method according to claim 1 or 5, characterized in that: In the step of combining the magnetic bead-DNA complex and the pollen culture medium, the pollen open-cell culture medium includes: Sucrose 150~200g / L, MgSO4·7H2O 200~300mg / L, H3BO3 30~100mg / L, KNO3 50~150mg / L, Ca(NO3)2·4H2O 180~300mg / L, MnSO4·H2O 100~200mg / L, GA3 20~30mg / L.
7. The method according to claim 1, characterized in that: In the magnetic transfection step, the collection time for the Napier grass pollen is between 9 am and 12 pm on a sunny day.
8. The method according to claim 7, characterized in that: The mass-to-volume ratio of the Napier grass pollen to the magnetic bead-DNA-pollen culture medium is 1:
4.
9. The method according to claim 1 or 8, characterized in that: In the magnetic transfection step, the temperature of the magnetic bead-DNA-pollen culture medium is 8°C.
10. The method according to claim 9, characterized in that: The magnetic transfer temperature is 8°C.
Citation Information
Patent Citations
Chrysanthemum transgenosis method and application
CN112626108A
Improved corn pollen magnetic transfection method
CN114085866A
Non-tissue culture genetic transformation method for gramineous pennisetum plants
CN116042694A