Construction of Ebola virus recombinant vaccine based on recombinant measles virus vector, reverse genetic system and application thereof

Abstract

The invention relates to the field of vaccine research and development, in particular to construction of an Ebola virus recombinant vaccine based on a recombinant measles virus vector, a reverse genetic system and application of the Ebola virus recombinant vaccine. Specifically, a measles virus is used as a vector, and a recombinant vaccine of an Ebola virus related antigen is constructed and expressed through a reverse genetic technology. The vaccine can be used for preventing Ebola virus infection and has a wide application prospect. In addition, the invention also discloses a recombinant measles virus vector, a nucleic acid molecule, a reverse genetic system, a recombinant measles virus particle and application thereof. The measles virus vector is characterized in that a negative strand RNA coding sequence of Ebola virus glycoproteins GP and VP40 is inserted into the measles virus vector. The measles virus vector-based Ebola virus vaccine provided by the invention has high immunogenicity and broad spectrum, and a new idea is provided for the development of novel Ebola virus vaccines. The vaccine provided by the invention is simple in preparation method and can be produced on a large scale in a short time.

Description

Technical Field

[0001] The present invention relates to the field of vaccine research and development, and in particular to the construction of a recombinant Ebola virus vaccine based on a recombinant measles virus vector, a reverse genetics system and applications thereof. Background Art

[0002] The Filoviridae family includes the genera Cuevavirus, Marburgvirus, and Ebolavirus. The Ebolavirus genus includes six viruses: Zaire, Bundibugyo, Sudan, Tai Forest, Reston, and Bombali. Among them, the Zaire ebolavirus has a mortality rate of up to 90%, making it the most deadly virus. In addition, Sudan virus and Bundibugyo virus cause a mortality rate of about 50% and 30%, respectively. Tai Forest virus is relatively rare.

[0003] Vaccines that prevent some types of Ebola virus disease have been used to control the spread of Ebola outbreaks, but they are not effective against different strains of Ebola virus.

[0004] Measles virus belongs to the genus Morbillivirus and is a member of the family Paramyxoviridae. It is an enveloped, non-segmented, single-stranded negative-sense RNA virus with a genome of approximately 16 kilobases. The genome encodes six structural proteins: nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin protein (H), and large protein (L). In addition, the P gene encodes two non-structural proteins: V protein and C protein. H and F proteins form heterodimers and play a key role in viral invasion and syncytium formation. Recombinant vaccines using measles virus as a vector can provide a wider range of protection during the immunization process. Measles virus has become an ideal viral vector for the development of recombinant vaccines due to its good immunogenicity and safety. As a vector, measles virus can carry antigen genes of other pathogens and induce the host to produce an immune response against these antigens. Since the measles virus itself can effectively infect and activate the host's immune system, the recombinant vaccine can produce strong cellular and humoral immune responses.

[0005] Schwarz, Edmonston-Zagreb, AIK-C and other strains are currently the safest and most effective measles live vaccines and are widely used in immunization programs around the world. Since Radecke et al. established the measles virus reverse genetics platform in 1995, measles virus has shown great potential as a vaccine vector. This vector system is highly flexible and can be modified and expressed in a variety of protective antigens for the prevention of emerging infectious diseases. For example, measles virus vectors are used to express antigens of West Nile virus, Chikungunya virus, HIV-1 and Lassa virus, and some vaccines have entered clinical trials. The measles virus vector vaccine platform has several key advantages. First, measles virus vaccines have been widely used since the 1960s and have extremely high safety and mature production processes. Second, even if the vaccine recipient is already immune to measles, the vaccine can still effectively induce a strong immune response and can express heterologous antigens. In addition, the platform can flexibly insert exogenous transcription units of up to 6 kilobases to adapt to the antigen design of different pathogens. Most importantly, measles virus can directly deliver antigens to dendritic cells, macrophages, and B cells, inducing potent and long-lasting immune responses.

[0006] Ebola virus belongs to the Filoviridae family. Its genome is about 19Kb and contains seven genes, encoding nucleoprotein (NP), glycoprotein (GP), four small viral proteins (VP24, VP30, VP35, VP40) and RNA-dependent RNA polymerase (L protein). All genes are located on a negative-strand RNA. GP is the only surface protein of Ebola virus and has two reading frames, encoding the secreted small protein sGP and the full-length transmembrane GP. GP plays a key role in the pathogenicity of Ebola virus. It promotes viral invasion by binding to host cell receptors and can destroy the integrity of microvessels, causing vascular leakage. At the same time, GP is also the main target for inducing protective immune responses. Most Ebola virus vaccine studies use GP as the target antigen. Traditional inactivated vaccines and subunit vaccines are ineffective against Ebola virus, while vaccines based on live virus vectors use GP as the target antigen and show good animal protection effects. VP40 is the most abundant protein in viral particles and plays a key role in the life cycle of Ebola virus, affecting viral replication, budding and pathogenicity. VP40 promotes the budding of the virus from the host cell surface to form new viral particles by interacting with related proteins of the host cell (such as Nedd4E3 and Tsg101). Chikungunya virus vaccine candidates combine virus-like particle units while expressing the main antigen and have entered the clinical trial stage.

[0007] Current Ebola virus vaccines have certain limitations in their preventive effects. Some vaccines can only target a specific type of Ebola virus (Zaire type), but cannot provide extensive protection against other virus strains or variants. Therefore, when dealing with a variety of different subtypes and mutants of Ebola virus, the vaccine effect is not satisfactory. In view of this, the present invention is specifically proposed. Summary of the invention

[0008] The object of the present invention is to provide a recombinant measles virus vector, a nucleic acid molecule, a reverse genetics system, a recombinant measles virus particle and applications thereof to solve the above technical problems.

[0009] The present invention is achieved in that:

[0010] In a first aspect, the present invention provides a recombinant measles virus vector expressing Ebola virus protein, comprising: a coding sequence of negative-strand RNA of Ebola virus glycoprotein GP is inserted into the measles virus vector.

[0011] In a second aspect, the present invention also provides a nucleic acid molecule, which comprises: the coding sequence of the Ebola virus glycoprotein GP negative-strand RNA in the above-mentioned recombinant measles virus vector is operably linked to the cDNA sequence encoding the measles virus antigenome.

[0012] In a third aspect, the present invention also provides a reverse genetics system for rescuing a recombinant measles virus vector expressing Ebola virus protein, which comprises: a) an antigen expression plasmid, which comprises a coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP in the above-mentioned recombinant measles virus vector operably linked to a cDNA sequence encoding the measles virus antigenome; b) an auxiliary plasmid 1 comprising a measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising a measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising a measles virus RNA polymerase coding sequence.

[0013] In a fourth aspect, the present invention further provides a method for preparing recombinant measles virus particles, comprising any one of the following methods:

[0014] Method 1: co-transfect the plasmids in the above reverse genetics system into the first cell line;

[0015] Method 2: Transfect the antigen expression plasmid in the above-mentioned reverse genetics system into the helper cell line.

[0016] In a fifth aspect, the present invention also provides a recombinant measles virus particle obtained by the above method.

[0017] In a sixth aspect, the present invention further provides a host cell obtained by transfecting cells with the above-mentioned nucleic acid molecule or the above-mentioned recombinant measles virus vector.

[0018] In a seventh aspect, the present invention further provides a composition comprising the above-mentioned recombinant measles virus particles and a pharmaceutically acceptable carrier;

[0019] In a preferred embodiment of the present invention, the composition is a vaccine composition.

[0020] In an eighth aspect, the present invention also provides the use of the recombinant measles virus particles or the above-mentioned composition in the preparation of a drug or vaccine for preventing and / or treating Ebola virus infection.

[0021] The present invention has the following beneficial effects:

[0022] The present invention combines the advantages of both viral vector vaccines and protein nanoparticle vaccines, and uses viral vectors to deliver encoded viral antigens to host cells of the body, so that exogenous glycoproteins (GP) can be expressed on the surface of host cells, and can trigger glycoprotein budding, releasing VLPs presenting glycoproteins on the surface. Based on this, the present invention constructs and designs a broad-spectrum Ebola virus vaccine based on measles virus vectors, develops a novel virus-like particle (VLP) production technology, and combines it with the measles virus vector vaccine platform, which can significantly improve the immunogenicity and broad spectrum of the vaccine, and provide new ideas for the development of new Ebola virus vaccines. Through this innovative vaccine design, not only can the preventive effect of Ebola virus be improved, but also new solutions can be provided for future response to emerging virus threats. After recombinant measles virus is used as an Ebola virus disease vaccine to immunize animals, it can induce the body to produce strong cellular and humoral immune responses in a short period of time, and has high efficiency. The vaccine preparation method provided by the present invention is simple, can be mass-produced in a short period of time, and is used to respond to sudden Ebola epidemics, which helps to improve global public health security. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 strategies for genome segmentation;

[0025] Figure 2 pGFMV schwarz Plasmid map;

[0026] Figure 3 T-F1 plasmid map;

[0027] Figure 4 pGF-MVEBOVGP ;

[0028] Figure 5 pGF-MEBOV GP+VP40 ;

[0029] Figure 6 Plasmid enzyme digestion identification diagram;

[0030] Figure 7 Schematic diagram of virus rescue;

[0031] Figure 8 Stability identification of measles virus and recombinant measles virus;

[0032] Fig. 9 WB identification of recombinant measles virus;

[0033] Fig.10 Recombinant measles virus MV-EBOV GP+VP40 Negative staining, ultrathin sections of infected cells were observed by electron microscopy;

[0034] Fig.11 Schematic diagram of serum antibody levels;

[0035] Fig.12 Schematic diagram of pseudovirus neutralization;

[0036] Fig.13 IFN-γ cytokine secretion was detected by flow cytometry;

[0037] Fig.14 ELISPOT for cytokines;

[0038] Fig.15 Weight change curve and survival curve of mice after rVSV-EBOV challenge;

[0039] Fig.16 Weight change curve and survival curve of mice after MA-EBOV challenge;

[0040] Fig.17 is the plasmid map of pBlunt-F1;

[0041] Fig.18 This is the vector map of T-F2. DETAILED DESCRIPTION

[0042] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0043] In the present invention, "glycoprotein GP", "EBOV GP protein" and "GP protein" are synonymous.

[0044] As used herein, the term "negative strand RNA", such as the negative strand RNA of the measles virus genome, refers to RNA that cannot function as mRNA and must first synthesize a complementary strand (positive strand RNA) as mRNA before protein translation. Accordingly, its complementary sequence is called a positive strand RNA sequence. The positive strand RNA corresponding to the negative strand RNA of the measles virus genome is also called the antigenomic positive strand RNA.

[0045] The attenuated strain of measles virus refers to a strain that has been serially passaged on selected cells and, possibly, adapted to other cells to produce a seed strain suitable for preparing a vaccine strain, and has a stable genome that does not allow reversion to pathogenicity nor integration into the host chromosome. As a specific "attenuated strain", the strain confirmed for vaccine is an attenuated strain suitable for the present invention, that is, after a rigorous review of laboratory and clinical data, it meets the safety, efficacy, quality and repeatability rules.

[0046] In a first aspect, the present invention provides a recombinant measles virus vector expressing Ebola virus protein, comprising: a negative-strand RNA coding sequence of Ebola virus glycoprotein GP is inserted into the measles virus vector.

[0047] The present invention uses measles virus as a vector to provide a vector for expressing Ebola virus glycoprotein GP. Through the delivery of measles virus vector, host cells express EBOV GP protein, which promotes host cells to efficiently assemble and release VLP.

[0048] In a preferred embodiment of the present invention, the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is also inserted into the measles virus vector.

[0049] After inserting the negative-strand RNA coding sequences of Ebola virus GP protein and VP40 protein into the measles virus vector, the recombinant measles virus particles prepared as Ebola virus disease vaccine can induce strong cellular and humoral immune responses in the body in a short period of time. GP+VP40 Compared with the recombinant vaccine strain MV-EBOV GP It can stimulate host cells to produce higher levels of specific antibodies in a shorter time. In addition, recombinant measles virus MV-EBOV GP+VP40 Compared with the recombinant vaccine strain MV-EBOV GP The study showed that the recombinant measles virus MV-EBOV GP+VP40 and recombinant vaccine strain MV-EBOVGP All can achieve 100% effective protection, especially MV-EBOV GP+VP40 The vaccine strain showed better protection and the protective effect was more stable.

[0050] In a preferred embodiment of the present invention, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP is located in the non-coding region before the 5' end of the N gene on the measles virus vector, the non-coding region between the P gene and the M gene, or between the H gene and the L gene.

[0051] In a preferred embodiment of the present invention, the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is located in the non-coding region before the 5' end of the N gene on the measles virus vector, the non-coding region between the P gene and the M gene, or between the H gene and the L gene.

[0052] In a preferred embodiment of the present invention, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP is located in the non-coding region between the P gene and the M gene on the measles virus vector, and the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is located in the non-coding region before the 5' end of the N gene on the measles virus vector. At the above insertion position, a higher protein expression level is achieved.

[0053] In a preferred embodiment of the present invention, the Ebola virus glycoprotein GP and VP40 protein are both from the Zaire type Ebola virus Mayinga strain, Genebank number: AF086833.2.

[0054] In a preferred embodiment of the present invention, the coding sequences of the Ebola virus glycoprotein GP and VP40 protein are shown in SEQ ID NO: 9 and SEQ ID NO: 10.

[0055] In a preferred embodiment of the present invention, the measles virus vector includes the measles virus N gene, P gene, M gene, F gene, H gene and L gene.

[0056] In a preferred embodiment of the present invention, the measles virus vector includes the N gene, P gene, M gene, F gene, H gene and L gene of the attenuated measles virus strain, and the attenuated measles virus strain is Schwarz, with a Genebank number of AF266291.1.

[0057] In a preferred embodiment of the present invention, the measles virus vector includes a sequence complementary to the negative-strand RNA sequence of the measles virus strain, and the negative-strand RNA sequence includes: N gene, P gene, M gene, F gene, H gene and L gene.

[0058] The coding sequence of the negative-strand RNA of the N gene on the measles virus vector is shown in SEQ ID NO:6, the coding sequence of the negative-strand RNA of the P gene is shown in SEQ ID NO:7, and the coding sequence of the negative-strand RNA of the L gene is shown in SEQ ID NO:8.

[0059] In a preferred embodiment of the present invention, the measles virus vector includes: measles virus gene fragments as shown in SEQ ID NO: 1-5. The measles virus gene fragments shown in SEQ ID NO: 1-5 are fragments of about 3 kb divided into the full-length antigenome sequence of the attenuated measles vaccine strain according to the present invention, and SEQ ID NO: 1-5 are F1 (2451 bp), F2 (3905 bp), F3 (3020 bp), F4 (3359 bp), and F5 (3337 bp), respectively. In other embodiments, those skilled in the art may also group the full-length antigenome sequence of the attenuated measles vaccine strain into fragments of other lengths as needed, and are not limited to the above-mentioned grouping situations.

[0060] In a preferred embodiment of the present invention, the measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer and other cis-acting elements. The above regulatory elements may be homologous or heterologous to the measles virus strain used.

[0061] In a preferred embodiment of the present invention, the measles virus vector comprises DNA sequences corresponding to the following gene transcription units in sequence (5' to 3'): a polynucleotide encoding the N protein of MV, a polynucleotide encoding the P protein of MV, a polynucleotide encoding the GP protein of Ebola virus, a polynucleotide encoding the M protein of MV, a polynucleotide encoding the F protein of MV, a polynucleotide encoding the H protein of MV, and a polynucleotide encoding the L protein of MV.

[0062] In a preferred embodiment of the present invention, the measles virus vector comprises DNA sequences corresponding to the following gene transcription units in sequence (5' to 3'): a polynucleotide encoding the Ebola virus VP40 protein, a polynucleotide encoding the MV N protein, a polynucleotide encoding the MV P protein, a polynucleotide encoding the Ebola virus GP protein, a polynucleotide encoding the MV M protein, a polynucleotide encoding the MV F protein, a polynucleotide encoding the MV H protein, and a polynucleotide encoding the MV L protein.

[0063] In a second aspect, the present invention also provides a nucleic acid molecule, which includes: the coding sequence of the Ebola virus glycoprotein GP negative-chain RNA in the above-mentioned recombinant measles virus vector and the cDNA sequence of the measles virus antigenome; and the coding sequence of the Ebola virus glycoprotein GP negative-chain RNA is operably connected to the cDNA sequence encoding the measles virus antigenome.

[0064] For example, it is inserted into the intergenic region. For example, it can be located between the N and P genes, between the P and M genes, between the M and F genes, between the F and H genes, or between the H and L genes. In some embodiments, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP and the coding sequence of the negative-strand RNA of the VP40 protein can each be inserted into different sites of the measles virus vector, if the coding sequence of the Ebola virus glycoprotein GP is located between the P and M genes, and the other coding sequence of the VP40 protein is located between the H and L genes. In some preferred embodiments, the coding sequence of the Ebola virus glycoprotein GP is located in the non-coding region between the P gene and the M gene on the measles virus vector, and the coding sequence of the Ebola virus VP40 protein is located in the non-coding region before the 5' end of the N gene on the measles virus vector.

[0065] In some cases, the recombinant measles virus vector may further comprise a negative-strand RNA sequence corresponding to a plurality of elements for controlling expression, including but not limited to a promoter sequence, a transcription initiation sequence, an enhancer sequence, an intron, a kozak sequence, a polyA sequence, a selection element, and a reporter gene. These regulatory elements may be homologous or heterologous to the measles virus coding sequence.

[0066] As used herein, the term "operably linked" in the present invention refers to the presence of a functional connection between different polynucleotides in the vector, whereby the different polynucleotides and nucleic acid constructs are effectively transcribed and, where appropriate, translated, particularly in a cell or cell line, particularly in a cell or cell line or host cell used as part of a rescue system to produce the recombinant infectious measles virus particles of the present invention.

[0067] In a preferred embodiment of the present invention, the above-mentioned nucleic acid molecule also includes: a coding sequence of Ebola virus VP40 protein negative-strand RNA, and the coding sequence of Ebola virus VP40 protein negative-strand RNA is operably connected to a cDNA sequence encoding the measles virus antigenome.

[0068] In a preferred embodiment of the present invention, the above-mentioned nucleic acid molecule includes, from 5' to 3', the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein, the DNA coding sequence of the measles virus N gene, the DNA coding sequence of the P gene, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP, ​​the DNA coding sequence of the M gene, the DNA coding sequence of the F gene, the DNA coding sequence of the H gene and the DNA coding sequence of the L gene.

[0069] In a third aspect, the present invention also provides a reverse genetics system for rescuing a recombinant measles virus vector expressing Ebola virus protein, which comprises: a) an antigen expression plasmid, which comprises a coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP in the above-mentioned recombinant measles virus vector operably linked to a cDNA sequence encoding the positive-strand RNA of the measles virus antigenome; b) an auxiliary plasmid 1 comprising a measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising a measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising a measles virus RNA polymerase coding sequence.

[0070] Reverse genetics is a genetic research method that determines the function of a gene by site-directed mutation of a gene and studying its phenotype. When studying viruses, reverse genetics can express and manipulate viruses containing specific mutations in cell culture through DNA recombination, thereby evaluating the effects of mutations on viral replication and transcription, pathogenicity, virus-host interaction, inhibition of host cell responses, and host range or transmissibility. Various reverse genetic methods have been used to recover recombinant viruses of various virus families, including positive-strand RNA viruses such as tubular viruses, picornaviruses, and flaviviruses; negative-strand RNA viruses such as influenza viruses and arenaviruses. Reverse genetics has also been used to develop vaccines based on attenuated forms of viruses and to produce recombinant viruses carrying reporter genes to track viral infections. Due to the many advantages of reverse genetics, such as rapid production and mutation of viruses (including rearrangements), it is an effective tool for virology and vaccine manufacturing.

[0071] In a preferred embodiment of the present invention, the antigen expression plasmid is a eukaryotic expression plasmid.

[0072] In a preferred embodiment of the present invention, the antigen expression plasmid is an animal-animal shuttle plasmid;

[0073] In a preferred embodiment of the present invention, the antigen expression plasmid and the auxiliary plasmids 1-3 are plasmids containing a T7 promoter;

[0074] In a preferred embodiment of the present invention, the attenuated measles virus strain is Schwarz, with a Genebank number of AF266291.1.

[0075] In a fourth aspect, the present invention further provides a method for preparing recombinant measles virus particles, comprising any one of the following methods:

[0076] Method 1: co-transfect the plasmids in the above reverse genetics system into the first cell line;

[0077] Method 2: Transfect the antigen expression plasmid in the above-mentioned reverse genetics system into the helper cell line.

[0078] In a preferred embodiment of the present invention, the method further comprises: collecting the cell supernatant after transfection, infecting a second cell line and culturing it;

[0079] In a preferred embodiment of the present invention, the cell supernatant is collected and purified to obtain recombinant measles virus particles expressing Ebola virus protein;

[0080] In a preferred embodiment of the present invention, the mass ratio of the added amount of antigen expression plasmid to auxiliary plasmid 1, auxiliary plasmid 2 and auxiliary plasmid 3 is: 4-4.1:2.5-2.6:2.5-2.6:0.8-1; in a preferred embodiment of the present invention, the first cell line is a cell line that stably expresses T7 RNA polymerase, and the second cell line is a Vero cell line.

[0081] In a fifth aspect, the present invention also provides a recombinant measles virus particle obtained by the above method.

[0082] In a sixth aspect, the present invention further provides a host cell obtained by transfecting cells with the above-mentioned nucleic acid molecule or the above-mentioned recombinant measles virus vector.

[0083] In a seventh aspect, the present invention further provides a composition comprising the above-mentioned recombinant measles virus particles and a pharmaceutically acceptable carrier.

[0084] These compositions induce an immune response against Ebola virus, particularly a protective immune response, and particularly induce the production of antibodies against Ebola virus antigenic proteins and / or induce a cellular immune response against Ebola virus infection. These compositions may accordingly include a suitable carrier for administration to a host, particularly a human host, such as a pharmaceutically acceptable carrier, and may further include, but not necessarily, an adjuvant to enhance the immune response in the host.

[0085] The term "pharmaceutically acceptable" refers to a pharmaceutical composition or a vaccine composition (e.g., an immunogenic or vaccine formulation) that is listed as being available for animals, especially humans, as approved by regulatory agencies or listed in the pharmacopoeias of various countries or other generally recognized pharmacopoeias. The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which a pharmaceutical composition or vaccine composition (e.g., an immunogenic or vaccine formulation) is administered. Saline solutions, as well as aqueous glucose solutions and glycerol solutions can also be used as liquid carriers, particularly for injection solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene, ethylene glycol, water, ethanol, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EWMartin. The preparation should be suitable for the mode of administration.

[0086] In the preferred embodiment of the present invention, the composition is an immunogenic composition, particularly a vaccine composition. The composition or vaccine is used to prevent Ebola virus infection in preventive therapy, and optionally, to prevent Ebola virus infection at the same time. The vaccine composition advantageously comprises recombinant measles virus particles rescued from a reverse genetics system.

[0087] In an eighth aspect, the present invention also provides the use of the recombinant measles virus particles or the above-mentioned composition in the preparation of a drug or vaccine for preventing and / or treating Ebola virus infection;

[0088] In a preferred embodiment of the present invention, the subject is a human.

[0089] The vaccine can be administered to mammalian subjects, such as monkeys, apes, chimpanzees, cats, dogs, cows, horses, mice, rats, rabbits and humans (including adults and children).

[0090] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0091] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0092] The construction method of recombinant measles virus is summarized as follows:

[0093] Reverse genetics systems used to rescue measles viruses include:

[0094] (1) Helper plasmid 1 (pCAGGS-N) containing the gene encoding the nucleocapsid protein of measles virus;

[0095] (2) Helper plasmid 2 (pCAGGS-P) containing the gene encoding the phosphoprotein of measles virus;

[0096] (3) Helper plasmid 3 (pCAGGS-L) containing the gene encoding measles virus RNA polymerase;

[0097] (4) Recombinant measles virus plasmid;

[0098] The measles virus is the attenuated measles vaccine strain Schwarz, and the transcription plasmid containing the full-length measles antigenome is the plasmid pGFMV containing the full-length measles antigenome schwarz Among them, pGFMV schwarz The nucleotide sequence is shown in SEQ ID NO.1.

[0099] S1, Construction of the full-length measles virus antigenome plasmid pGFMV schwarz The strategy is briefly described as follows: the full-length antigenome sequence is divided into fragments of about 3 kb in length, namely F1 (2451 bp), F2 (3905 bp), F3 (3020 bp), F4 (3359 bp), and F5 (3337 bp). The genome segmentation strategy is as follows Figure 1 As shown, after artificially synthesizing 5 fragments, the reaction was carried out according to the seamless cloning method to finally obtain the correct plasmid. The steps include:

[0100] (1) Design primers: Using the plasmid containing the target fragment measles virus genome as a template, PCR was used to amplify the DNA F1, F2, F3, F4, and F5 fragments containing A. The amplified F1 overlapped with the 3' end of the linearized vector and the 5' part of the amplified F2 fragment; the amplified F2 fragment overlapped with the 3' end of the F1 fragment and the 5' end of the F3 fragment; the amplified F3 fragment overlapped with the 3' end of the F2 fragment and the 5' end of the F4 fragment; the amplified F4 fragment overlapped with the 3' end of the F3 fragment and the 5' end of the F5 fragment; the amplified F5 overlapped with the 3' end of the F4 fragment and the 5' end of the linearized vector; and the corresponding five fragments were obtained by PCR amplification.

[0101] (2) Design primers and use plasmid PGF as a template to obtain linearized vector fragments PGF-1 and PGF-2 by PCR amplification.

[0102] The five fragments described in (1) and the two fragments described in (2) were connected by seamless cloning technology to construct a plasmid containing the full-length antigenome of measles virus. The recombinant plasmid was named pGFMV schwarz .

[0103] S2: Insert the target protein coding gene into pGFMV schwarz :

[0104] The present invention selects to insert Ebola virus VP40 in the non-coding region before the 5' end of the N gene, and inserts Ebola virus GP protein between the non-coding regions between the P gene and the M gene. Therefore, a repeated non-coding region is first inserted between the P gene and the M gene to reduce the impact of the insertion of foreign genes on the measles virus itself, and includes the following steps:

[0105] (1) Designing primers: Using the plasmid containing the repetitive sequence fragment A as a template, PCR amplification was performed to obtain fragments I and II, wherein the fragment I contained the 3' end partial bases of the measles P gene, all the non-coding regions, and the Pac1 restriction site; the fragment II contained the 5' end partial bases of the measles M gene, all the non-coding regions, and the Mul1 restriction site;

[0106] (2) Design primers, use fragments I and II as templates, and obtain fragment III by overlap PCR amplification. This fragment contains the non-coding region sequence of all bases at the 3' end of the P gene, the repeated non-coding region sequence of the Pac1 and Mul1 restriction sites, and part of the bases at the 5' end of the M gene;

[0107] (3) Using plasmid T-F2 as a template, primers were designed and a linearized vector was obtained by PCR amplification. The two ends of the vector sequence were the 3' end of the P gene and the 5' end of the M gene;

[0108] (4) The fragments obtained by the methods described in (2) and (3) are used to construct a shuttle vector with a repeated spacer sequence by seamless cloning. Subsequent cloning will be constructed based on this vector.

[0109] Example 1

[0110] This example provides a method for preparing an Ebola virus disease vaccine using the attenuated measles virus vaccine strain Schwarz as a vector.

[0111] The measles virus is the attenuated measles vaccine strain Schwarz, the transcription plasmid containing the full-length measles antigenome is the plasmid pGFMVschwarz containing the full-length measles antigenome; the recombinant measles virus is a recombinant virus expressing filovirus antigens, which are named as follows: recombinant virus pGFMV-EBOVGP expressing Ebola glycoprotein, and recombinant virus pGFMV-EBOV expressing Ebola glycoprotein and matrix protein GP+VP40 .

[0112] Part 1: Synthesis of measles virus genome and Ebola GP+VP40 gene.

[0113] The measles virus was the attenuated measles vaccine strain Schwarz (Genebank No. AF266291.1), and the full-length sequence of the measles antigenome was synthesized. The full-length antigenome sequence was divided into fragments of about 3 kb in length, namely F1 (2451 bp), F2 (3905 bp), F3 (3020 bp), F4 (3359 bp), and F5 (3337 bp). The genome segmentation strategy is as follows Figure 1 As shown, 5 fragments were artificially synthesized, and the sequences are shown in SEQ ID NOs: 1-5. Auxiliary plasmid 1: PCAGGS-N, which contains the gene encoding the nucleocapsid protein of measles virus (SEQ ID NO: 6); auxiliary plasmid 2: PCAGGS-P, which contains the gene encoding the phosphoprotein of measles virus (SEQ ID NO: 7); auxiliary plasmid 3: PCAGGS-L, which contains the gene encoding the RNA polymerase of measles virus (SEQ ID NO: 8).

[0114] Ebola GP and VP40 are from the Zaire type Ebola virus Mayinga strain (Genebank number: AF086833.2).

[0115] The optimized coding sequence of the negative-strand RNA of the Ebola GP gene is shown in SEQ ID NO:9, and the optimized coding sequence of the negative-strand RNA of the Ebola VP40 gene is shown in SEQ ID NO:10.

[0116] The second part is vector construction.

[0117] 1. Construction of measles virus rescue-related vectors

[0118] Construction of full-length measles virus antigenome plasmid

[0119] Design primers: Using the plasmids containing the target fragments, pBlunt-F1 / F2 / F3 / F4 / F5 as templates, use PCR to amplify the DNA fragments containing F1, F2, F3, F4, and F5; use F1-BAC-F and F1-BAC-R to amplify the DNA F1 fragment; use F2-BAC-F and F2-BAC-R to amplify the DNA F2 fragment; use F3-BAC-F and F3-BAC-R to amplify the DNA F3 fragment; use F4-BAC-F and F4-BAC-R to amplify the DNA F4 fragment; use F5-BAC-F and F5-BAC-R to amplify the DNA F5 fragment.

[0120] The amplified F1 partially overlaps with the 3' end of the linearized vector pGF, and the amplified F2 fragment partially overlaps with the 5' end; the amplified F2 fragment partially overlaps with the 3' end of the F1 fragment and the 5' end base sequence of the F3 fragment; the amplified F3 fragment partially overlaps with the 3' end of the F2 fragment and the 5' end base sequence of the F4 fragment; the amplified F4 fragment partially overlaps with the 3' end of the F3 fragment and the 5' end base sequence of the F5 fragment; the amplified F5 partially overlaps with the 3' end of the F4 fragment and the 5' end base sequence of the linearized vector pGF; and the corresponding 5 fragments are obtained by PCR amplification.

[0121] Primers were designed, and the plasmid PGF was used as a template (the plasmid was donated by Dr. Wang Yun from Wuhan Institute of Virology, Chinese Academy of Sciences), and linearized vector fragments PGF-1 and PGF-2 were obtained by PCR amplification. Specifically, pGF-F and pGF-R were used to amplify plasmid PGF to obtain linearized vector fragment PGF-1, and PGF-VECTOR-F and PGF-VECTOR-R were used to amplify plasmid PGF to obtain linearized vector fragment PGF-2.

[0122] The five fragments grouped in step 1 and two fragments (PGF-1 and PGF-2) were connected using seamless cloning technology to construct a plasmid containing the full-length antigenome of measles virus. The recombinant plasmid was named pGFMVschwarz. The plasmid map is shown in Figure 2 The primers involved are shown in Table 1.

[0123] Table 1 List of primers for constructing full-length measles virus plasmid

[0124]

[0125] 2. Construction of recombinant virus vaccine strain-related vectors

[0126] Using measles virus as a vector, insert the target gene into the non-coding region before the 5' end of the N gene of the measles virus, the non-coding region between the P gene and the M gene, or between the H gene and the L gene. This study chose to insert the target protein between the non-coding region before the 5' end of the N gene and the non-coding region between the P gene and the M gene. In order to reduce the possibility of mutations in the measles virus genome during the construction of the recombinant measles virus plasmid and eliminate the impact of the insertion of exogenous sequences in the non-coding region on the life cycle of measles, a shuttle plasmid was constructed. Inserting a repeated non-coding region between the P gene and the M gene includes the following steps:

[0127] 2.1 Construction of shuttle vector

[0128] (1) Primer design: The plasmid containing the repetitive sequence fragment pBlunt-F1 (plasmid map reference Fig.17 ) was used as a template, and fragments I and II were obtained by PCR amplification. Fragment I carried the 3' end part of the bases of the measles virus P gene, all the non-coding regions and the Pac1 restriction site; fragment II carried the 5' end part of the bases of the measles virus M gene, all the non-coding regions and the Mul1 restriction site;

[0129] (2) Design primers, use fragments I and II as templates, and obtain fragment III by overlap PCR amplification. This fragment contains the non-coding region sequence of all bases at the 3' end of the P gene, the repeated non-coding region sequence of the Pac1 and Mul1 restriction sites, and part of the bases at the 5' end of the M gene;

[0130] (3) Plasmid T-F2 (plasmid map reference) Fig.18 As shown in the figure, primers were designed and linearized vectors were obtained by PCR amplification. The two ends of the vector sequence were the 3' end of the P gene and the 5' end of the M gene respectively.

[0131] (4) The fragments obtained by the methods described in (2) and (3) were used to construct a shuttle vector T-F1 with a repeated spacer sequence by seamless cloning. Figure 3 Subsequent cloning will be constructed based on this vector, and the primer list involved is shown in Table 2.

[0132] Table 2: List of primers for shuttle plasmid construction

[0133]

[0134] 2.2 Construction of recombinant viral plasmid

[0135] (1) Primer design: Using the plasmid containing the target gene EBOV-GP / EBOV-VP40 as a template, PCR was used to amplify the target DNA fragments I and II. DNA fragment I contained partial bases of the non-coding region at the 3' end of PacI, partial bases of the Ebola virus glycoprotein EBOV-GP and the 5' non-coding region of MluI, and DNA fragment II contained partial non-coding bases at the front end of the measles virus N gene, the Ebola matrix protein EBOV-VP40 gene sequence and partial bases of the front end sequence of the measles virus N gene.

[0136] (2) Design primers (Reapeat-enzyme-F and Reapeat-enzyme-R), use T-F1 plasmid as template, and linearize the vector by PCR amplification. The two ends of the linearized vector are PacI 3' end and MluI 5' end respectively;

[0137] (3) The DNA fragment I of step (1) and the linearized vector described in step (2) are cloned using seamless cloning technology to obtain the intermediate plasmid T-EBOV GP The list of primers involved is shown in Table 3.

[0138] (4) Design primers. The specific sequences are shown in Table 3. Schawarz The plasmid was linearized into three fragments using PCR as a template, namely pGFMV Schawarz -1(AaTII-F and PGF-R), pGFMV Schawarz -2 (PGF-F and LR), pGFMV Schawarz -3(LF and PflFI--R).

[0139] (5) Design primers (refer to EBOV-PACI-F and EBOV-GP-MluI-R shown in Table 3) to obtain the intermediate plasmid T-EBOV GP Using PCR amplification technology as a template, a DNA fragment containing the target EBOV-GP is obtained, and the DNA fragment includes partial nucleotides of the measles virus N gene, EBOV-GP and partial genes of the measles virus P gene.

[0140] (6) Recombining the four fragments of the DNA fragments of step (4) and (5) by seamless cloning technology to obtain the measles recombinant virus plasmid pGFMV-EBOV GP， Plasmid map Figure 4 As shown, the primers involved are shown in Table 4.

[0141] (7) Design primers. The primer sequences are shown in Tables 3 and 5. GP The plasmid was linearized into three fragments by PCR, namely pGFMV-EBOV GP -1(N-circle-F and PGF-R), pGFMV-EBOV GP -2 (PGF-F and LR), pGFMV-EBOV GP -3(LF and N-circle-R).

[0142] (8) The DNA fragment II described in (1) and the three DNA fragments described in (7) were recombined into four fragments by seamless cloning technology to obtain the recombinant measles virus pGFMV-EBOV GP+VP40 , plasmid map such as Figure 5 As shown, the primers involved are shown in Table 5.

[0143] (9) The measles virus plasmid and the recombinant measles virus plasmid constructed based on the above description were identified by enzyme digestion. The XhoI restriction endonuclease was selected and 0.5 μg of the plasmid was digested and identified. The band sizes were consistent, such as Figure 6 shown.

[0144] Rescue and identification of measles virus and recombinant virus vaccine strains

[0145] Table 3: Primers list for constructing intermediate plasmids of recombinant measles virus

[0146]

[0147]

[0148] Table 4 List of primers for constructing intermediate plasmids of recombinant measles virus

[0149]

[0150] Table 5MV-EBOV GP+VP40 Construction of primer list

[0151]

[0152] Part III: Transfection, preparation of viral particles

[0153] The three auxiliary plasmids constructed above and pGFMV schwarz / pGFMV-EBOV GP / pGFMV-EBOV GP+VP40 , and transfected into BSR-T7 cells using Lipofectamine2000. Figure 7 The specific experimental method is as follows:

[0154] Transfection: Helper BSR-T7 cells were seeded in six-well plates, with 5×10 5 The cells were cultured in DMEM + 10% FBS at 37°C in a cell culture incubator containing 5% CO2 overnight. On the day of transfection, the medium was changed and culture was continued with fresh DMEM medium containing 10% FBS. When the cell confluence reached 70-80%, each transfection well was given a measles virus plasmid pGFMV. schwarz / pGFMV-EBOV GP / pGFMV-EBOV GP+VP40 4μg, auxiliary plasmid 1 2.5μg, auxiliary plasmid 2 1.5μg, auxiliary plasmid 3 0.8μg, all added to 300μl OPTI-MEM, mixed evenly, and placed at room temperature for 5min. Take 14μL liposomes and dilute them with 300μL OPTI-MEM culture medium, and place at room temperature for 5min. Mix the two evenly and place at room temperature for 20min. Then add the mixture evenly to the cells.

[0155] After three days of continuous culture at 37°C, the cells showed pathological changes, and the supernatant was collected for WB detection, during which the expression of measles virus N protein was detected, proving that the measles virus was successfully rescued.

[0156] The cell culture flask was placed in an ultra-low temperature freezer at -80°C and repeatedly frozen and thawed for 3 times. The culture medium and cell mixture were collected, and then the cell and supernatant mixture was added to Vero-E6 cells for passage and expansion culture to rescue the obtained measles virus and recombinant measles virus vaccine strain. The rescued measles virus or recombinant virus vaccine strain was observed to show obvious measles-induced specific cell lesions in Vero-E6 cells. The frozen and thawed cells were collected from the cell culture flask and placed in a low-temperature high-speed centrifuge for centrifugation at 3000g for 10-15 minutes. The supernatant of the cell lysate was collected, and a portion was taken to continue to infect the Vero cells that filled the culture flask for continued passage, and a portion of the supernatant was frozen in a -80 degree ultra-low temperature refrigerator for storage.

[0157] Example 2

[0158] In this example, purified samples of the recombinant measles virus vector Ebola vaccine were identified and titered.

[0159] 1. Stability evaluation of recombinant measles virus

[0160] Measles virus and recombinant measles virus were propagated for 10 generations, and viruses were collected in each generation. RNA was extracted from cell lysates using a nucleic acid extractor according to the instructions of the DNA / RNA extraction kit of Novezan. RT-PCR detection: RNA extracted in the above steps was used as a template, and the reverse transcription kit HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Novezan was used to reverse transcribe the genomic RNA into cDNA using random primers according to the instructions.

[0161] Primers were designed, and the primer sequences were shown in Table 6. The cDNA in the step was used as a template to obtain fragments I, II, and III by PCR amplification. DNA fragment I amplified the nucleotides of the measles virus N gene (MNF and MNR); DNA fragment II amplified the nucleotides of the EBOV-GP gene of the EBOV glycoprotein (EBOV-GP-F and EBOV-GP-R); DNA fragment III amplified the nucleotides of the EBOV-VP40 gene of the EBOV matrix protein (EVP40-F and EVP40-R) (the results refer to Figure 8 shown).

[0162] Table 6 Virus stability detection primers

[0163] MNF ATGGCCACACTTTTAAGGAG MNR CTAGTCTAGAAGATTTCTGTC EBOV-GP-F atgggcgttacaggaatattg EBOV-GP-R TTAaaagacaaatttgcatatacag EVP40-F atgaggcgggttatattgc EVP40-R ttacttctcaatcacagctgg

[0164] 2.WB detection

[0165] Vero-E6 cells were infected with measles virus and recombinant measles virus at MOI=1. Cells were collected 48 hours after infection for Western blot detection. The detected proteins included measles virus N protein, Ebola glycoprotein EBOV-G, and internal reference protein GAPDH.

[0166] The results are as follows Fig. 9 As shown, NC is a blank cell sample; MV-EBOV GP It is a recombinant measles virus MV-EBOV GP Infected cell samples; MV-EBOV GP+VP40 It is a recombinant measles virus MV-EBOV GP+VP40 Infected cell samples;

[0167] The results showed that the expression of measles virus N protein could be detected in all recombinant measles virus infected samples. GP , MV-EBOV GP+VP40 The expression of Ebola virus protective antigen EBOV-GP can be detected in all infected cells.

[0168] 3. Titer Determination

[0169] IFA was used to determine the titer of recombinant measles virus. The specific method is as follows:

[0170] Here are the steps:

[0171] 1) Vero-E6 cells were seeded in a 24-well plate at a density of 2*10^5 / ml, and titers were measured when the cells grew into a monolayer and the cell confluence reached 80%-90%, so as to ensure that the cells fully grew the monolayer when measuring the titer.

[0172] 2) The obtained measles virus sample or recombinant measles virus sample was diluted 10 times in a gradient, with a total of 8 dilution gradients. The cell supernatant was aspirated and 500ul of the virus dilution solution was added to the cells. Two duplicate wells were made for each dilution. After two hours of infection, the virus liquid was discarded and added to DMEM containing 5% FBS and 1% methylcellulose, and cultured at 32°C for 6 days.

[0173] 3) Add 4% paraformaldehyde to the cells at a dose of 500ul per well and fix at room temperature for 30 minutes. Wash the cells three times with PBS, add 500ul 2% Triton-X100 to each well, place on ice for 15 minutes for permeabilization, and then wash the cells three times with PBS.

[0174] 4) Antibody Measles-N (abcam, ab106292) was diluted with 1% BSA in PBS at a dilution ratio of 1:500, and 200ul of the diluted antibody was added to each well and incubated at 37°C for 1 hour;

[0175] 5) Aspirate and discard the antibody, wash the cells three times with PBS, add 0.25 mL of Alex-488 labeled Rat Anti-Mouse Antibody (Invitrogen, A-11001 1:100 dilution) to each well, and incubate at 37°C for 1 hour;

[0176] 6) Aspirate the Rat Anti-Mouse Antibody dilution solution, wash the cells three times with PBS, and count the green fluorophore under a fluorescence microscope.

[0177] The titer determination results showed that the infection titer reached 5*10 5 FFU / mL, calculated as follows: number of green fluorescent groups per well / virus inoculum per well (ml)*virus dilution.

[0178] 4. Electron microscopy morphology

[0179] 4.1 Negative staining

[0180] In order to visually verify the recombinant measles virus MV-EBOV from a morphological perspective GP+VP40 Can secrete Ebola VLP into the supernatant and collect recombinant measles virus MV-EBOV GP+VP40 The cell supernatant 48 hours after infection was negatively stained for observation. The steps are as follows: After standing for 5-10 minutes, use filter paper to absorb the excess liquid on the edge of the grid. When the grid is not completely dry, drop sodium phosphotungstate staining solution on it, stain for 3-5 minutes, use filter paper to absorb the excess liquid on the edge of the grid, dry naturally, and observe under a transmission electron microscope. The morphology of Ebola's filamentous virus-like particles can be observed from the supernatant sample. The results are as follows Fig.10 The shape of the recombinant measles virus vector Ebola vaccine is consistent with the measles virus.

[0181] 4.4.2 Cryosectioning

[0182] Further verification from morphology showed that after virus infection, the recombinant virus could secrete Ebola virus VLPs outside the cells while proliferating in the cells. In situ ultrathin sections were selected to restore the cell infection process. The steps are as follows:

[0183] 1) Glutaraldehyde fixation: Prepare a monolayer of cell samples in a dish in advance. Multilayer cells will affect the subsequent fixation and penetration, thus affecting the slice effect. For iron wall cells, remove the cell culture supernatant and add 2.5% glutaraldehyde to cover the monolayer of cells for fixation (37°C for 2h, at least 0.5h, or 4°C overnight)

[0184] 2) Osmium acid fixation: rinse with PBS three times, 15 minutes each time, and then fix with 1% osmium acid precooled at 4°C at room temperature (20°C) for 2-3 hours (the time is adjusted according to different samples), and then rinse with 0.1M phosphate buffer (PH7.4) three times, 15 minutes each time.

[0185] 3) Dehydration: The samples were dehydrated with gradient alcohol (30%, 50%, 70%, 80%, 85%, 90%, 95%, 100% twice), where the dehydration time from 30% to 80% was 5 min, the dehydration time from 85% to 100% was 3 min, and the dehydration time was 100% alcohol twice (the time can be appropriately extended for samples with high water content and thick cell membrane).

[0186] 4) Infiltration: Preheat the epoxy resin at 37°C in advance, add it to the dehydrated cells after the epoxy resin melts, and infiltrate at 37°C. After 2 hours of infiltration, prepare the capsule for embedding. The capsule is processed in advance, and the epoxy resin is added after adding the label to the capsule. It is polymerized at 60°C together with the sample. After the polymerization reaches the appropriate degree, the capsule is turned upside down into the sample and further polymerized at 60°C (24-48 hours). After the polymerization is completed, the sample is placed in liquid nitrogen, and the epoxy resin is detached through repeated freezing and thawing to complete the sample preparation.

[0187] 5) Ultra-thin sections: The section thickness is generally 80-100nm.

[0188] 6) Double staining: lead and uranium double staining (2% saturated aqueous solution of uranyl acetate, lead citrate, staining at room temperature for 15 minutes), drying at room temperature overnight, and observation under an electron microscope.

[0189] Observation results such as Fig.10 As shown in the middle figure, measles virus particles and typical Ebola virus virus-like particles can be observed in infected cells. The above electron microscopy results show that the recombinant measles virus MV-EBOVGP+VP40 can express the protective antigen EBOV-GP in infected cells and secrete EBOV-VLP.

[0190] Example 3

[0191] This example is an immunological evaluation of the Ebola virus disease vaccine based on measles virus in a mouse model.

[0192] 1. Experimental materials.

[0193] 1.1 Experimental animals

[0194] SPF female BALB / c mice (4-6 weeks old) were purchased from Vital River. Mice were raised at the Animal Center of Wuhan Institute of Virology, Chinese Academy of Sciences.

[0195] 1.2 Experimental Materials

[0196] Fluorescently labeled antibodies FITC Hamster Anti-Mouse CD3e (145-2C11), PerCP-Cy5.5 Rat Anti-Mouse CD8a (53-6.7), BV421 Rat Anti-Mouse CD4 (GK1.5), Rat Anti-Mouse IFN-γ (XMG1.2); fixative Cytofix / Cytoperm TM Fixation andPermeabilizaiton Solution, lotionPerm / Wash TM Buffer, BDTM ELISPOT set, BD TM ELISPOTAEC substrate set and blocking agent were purchased from BD Pharmingen; red blood cell lysate was purchased from Solebol; RPMI1640 culture medium was purchased from Gibco; BSA was purchased from Merck; HRP-labeled anti-mouse IgG antibody was purchased from Proteintec; truncated secretory GP (46aa-364aa) was purified in this laboratory.

[0197] 2. Immunization of mice.

[0198] According to the experimental design, the purified recombinant measles virus Ebola vaccine and the recombinant measles virus vector control vaccine were diluted with saline to an infection titer of 2×10 6 FFU / mL, 50 μL per mouse was injected into the inner muscle of the left hind leg using a 1 mL syringe, and the immunization dose per mouse was 1×10 5 FFU. The mouse immunization grouping is shown in Table 6 below:

[0199] Table 6: List of mouse immunization groups

[0200] Immunization group Immunization dose Number of mice MV-Schwarz <![CDATA[1×10 5 TCID 50 ]]> 5 <![CDATA[MV-EBOV GP ]]> <![CDATA[1×10 5 TCID 50 ]]> 5 <![CDATA[MV-EBOV GP+VP40 ]]> <![CDATA[1×10 5 TCID 50 ]]> 5

[0201] 3. Detection of humoral immunity level.

[0202] 3.1 Blood collection and serum separation

[0203] After the mice are immunized, blood is collected from the tail vein at a specific time point. The blood is left to stand at room temperature for more than 1 hour. After the serum is formed, it is centrifuged at 5000 rpm for 10 minutes, and the serum is transferred to a new centrifuge tube and frozen at -20°C for later use.

[0204] 3.2 ELISA test for serum antibody levels

[0205] One day before the experiment, the ELISA strips were coated with truncated secretory EBOV-GP or SUDV-GP at a concentration of 4 μg / mL and placed overnight at 4° C. On the day of the experiment, the liquid in the wells was discarded and washed three times with ELISA washing solution (PBS+1% Tween 20).

[0206] Discard the washing solution, tap the liquid in the wells on clean absorbent paper, add 120μL 2% BSA to each well, and block at 37°C for 1 hour. Discard the blocking solution, wash the plate 3 times, and add 100μL sample diluent (PBST + 0.2% BSA) to each well. Serum samples are diluted in multiples at a specific initial dilution (the initial dilution is determined by preliminary experiments), and 7 dilutions are set for each sample. After the serum is diluted, it is added to the ELISA plate coated with a specific antigen and incubated at 37°C for 1 hour.

[0207] The ELISA plate was washed 4 times with washing solution, and 100 μL of HRP-conjugated anti-mouse IgG secondary antibody (1:10000) was added to each well and incubated at 37°C for 1 hour. The plate was washed 4 times with washing solution, and the liquid in the wells was shaken off for color development reaction.

[0208] The color development process is to add a single-component TMB color development solution to each well, and stop the reaction with ELISA stop solution after 15 minutes of color development. Finally, the absorbance value at 450nm is detected on an ELISA reader.

[0209] The wells with OD450 in the sample greater than 2.1 times the reading of the blank well were set as positive wells. The dilution multiple of the positive well with the largest dilution in each serum sample was recorded as the antibody titer of this sample.

[0210] Test results such as Fig.11 As shown, the recombinant measles virus MV-EBOV GP+VP40 Compared with the recombinant vaccine strain MV-EBOV GP A higher level of EBOV-GP-specific antibodies can be produced in a shorter time. The activity of SUDV-GP / BDBV-GP binding antibodies in the serum 28 days after immunization was detected by ELISA. The results showed that the trend of binding antibodies against EOV-GP was consistent with that of recombinant measles virus MV-EBOV GP+VP40 Compared with the recombinant vaccine strain MV-EBOV GP Exhibits higher binding antibodies.

[0211] 3.3 Serum neutralizing antibody level detection (pseudovirus neutralization experiment-methods and results)

[0212] 1. One day in advance, subculture Vero cells into 96-well cell culture plates at a cell density of 1*10 5 / ml, and the cells grew into a monolayer on the next day.

[0213] 2. On the day of the experiment, dilute the serum: dilute the sample with serum-free medium at a ratio of 1:10, and then select a 4-fold gradient dilution for a total of 7 concentrations, with 3 replicates for each dilution. Set the cell wells without serum or virus as negative controls, and the cell wells without serum but only virus as positive controls.

[0214] 3. Take out the rVSV-EBOV virus with known titer and melt it according to 1000TCID 50 / well, calculate the total required virus suspension according to the volume of 50ul / well, add the virus dilution to the diluted serum at a dose of 50ul / well, mix evenly and incubate at 37℃ for 1h.

[0215] 4. Take out the mixture of incubated virus and diluted serum. Discard the cell supernatant, wash the cells once with 100ul / well of PBS, and then add the mixture to the cells at a dose of 100ul / well. Mix evenly and incubate at 37℃ for 1h. Discard the supernatant, replace with 2% FBS DMEM cell culture medium, and continue to culture in a 37℃ incubator.

[0216] 5. Incubate at 37℃ for about 24-48 hours until the appropriate fluorescence ratio is achieved and then fix. Discard the supernatant, add twice the volume of 10% formaldehyde per well, and fix at room temperature for 30 minutes.

[0217] 6. Discard formaldehyde, rinse with tap water, add DAPI for staining at room temperature for 15 minutes, then scan the high content to determine the percentage of fluorescence and perform data analysis.

[0218] The results are as follows Fig.12 As shown, the neutralizing antibody titers against rVSV-EBOV / SUDV / BDBV in the serum 28 days after immunization were detected by pseudovirus neutralization experiments. The results showed that MV-EBOVGP+VP40 could produce higher levels of EBOV-GP / SUDV-GP / BDBV-GP-specific neutralizing antibodies compared with the recombinant vaccine strain MV-EBOVGP, showing better broad-spectrum potential.

[0219] 4. Detection of cellular immunity level.

[0220] 4.1 Isolation of splenic lymphocytes

[0221] The mice were killed by cervical dislocation and soaked in 70% alcohol for 3 minutes. The spleen of the mouse was aseptically removed in the biosafety cabinet and placed on a 200-mesh cell sieve placed in a sterile plate. 10 mL of RPMI1640 complete medium was added, and the spleen was gently ground into single cells using the piston of a syringe. The spleen cell suspension was transferred to a 15 mL centrifuge tube and centrifuged at 800 g for 5 minutes at 4 ° C. The supernatant was discarded, and the cells were resuspended in 2 mL of Solebol red blood cell lysis buffer, lysed at room temperature for 5 minutes, and 13 mL of RPMI1640 complete medium was added, and centrifuged at 500 g for 5 minutes at 4 ° C. The supernatant was discarded, and the cells were washed once with 10 mL of RPMI1640 complete medium, resuspended with an appropriate amount of medium, filtered through a 200-mesh cell sieve into a 10 mL test tube, and 50 μL was taken and diluted 20 times for counting and set aside.

[0222] 4.2 Flow cytometry was used to detect the secretion of specific cytokines.

[0223] 4.2.1 In vitro stimulation of mouse splenocytes

[0224] Dilute the mouse spleen cells separated above to 1×107 cells / mL, and add 0.1mL to each well of a 96-well plate. Set up specific CTL epitope stimulation wells and non-stimulation wells for the spleen cells of each mouse. The peptides used for specific CTL epitope stimulation are EBOV-GP and MARV-GP. As a positive control, add PMA and ionomycin stimulation wells, where the PMA concentration is 100ng / mL and the ionomycin concentration is 1μg / mL.

[0225] After the cells were cultured in a 37°C, 5% CO2 incubator for 12 hours, they were stained for relevant antigens and used for flow cytometry detection of intracellular cytokines.

[0226] 4.2.2 Staining of cell surface antigens and intracellular cytokines

[0227] After 6 hours of in vitro stimulation, spleen cells were transferred to flow cytometry tubes and centrifuged at 4°C, 500g for 5 minutes, and the supernatant was discarded. Centrifuge at 4°C, 500g for 5 minutes, and the supernatant was discarded. Dilute the appropriate amount of fluorescent labeled antibodies FITC Hamster Anti-Mouse CD3, PerCP-Cy5.5 Rat Anti-Mouse CD8, and BV421 Rat Anti-Mouse CD4 with PBS + 2% FBS according to the recommended usage in the instructions, and place at 4°C for 30 minutes. After 30 minutes, add 3mL PBS + 2% FBS to each tube, centrifuge at 4°C, 500g for 5 minutes, and discard the supernatant. Add Cytofix / CytopermTM Fixation and PermeabilizaitonSolution according to the recommended amount in the instructions, and place at 4°C for 20 minutes to fix and perforate the cells. After 20 minutes, add 1×Perm / WashTMBuffer, centrifuge at 4°C, 600g for 5 minutes, and discard the supernatant. Dilute the appropriate amount of BV786 Rat Anti-Mouse IFN-γ antibody with 1×Perm / WashTM Buffer according to the recommended dosage in the manual, mix gently, and place at 4°C for 30 minutes. Finally, wash each tube once with 1mL1×Perm / WashTM Buffer and 3mL PBS, discard the supernatant, resuspend with 200μL PBS, and detect on the machine. In order to adjust the fluorescence compensation between the dyes during the detection, set up unstained tubes, single-stained FITC Hamster Anti-Mouse CD3 tubes, single-stained PerCP-Cy5.5 Rat Anti-Mouse CD8 tubes, single-stained BV421 Rat Anti-Mouse CD4 tubes, and single-stained BV786 RatAnti-Mouse IFN-γ tubes. Among them, the BV786 Rat Anti-Mouse IFN-γ single-stained tube uses positively stimulated cells.

[0228] 4.2.3 On-machine testing

[0229] BD was used for flow cytometry. First, the voltage was adjusted appropriately, and the fluorescence compensation between each dye was adjusted using a single fluorescent staining sample, and then the sample was loaded. Lymphocytes were circled by FSC and SSC and set as Gate 1. For cells coming out of Gate 1, CD3 cells were circled by FITC and SSC and set as Gate 2. For cells coming out of Gate 2, PerCP-Cy5.5 was used to identify the cells.

[0230] The percentage of IFN-γ positive cells in CD8+ cells to total T cells (CD3 cells) was analyzed by BV786 and PerCP-Cy5.5, and the percentage of IFN-γ positive cells in CD4+ cells to total T cells (CD3 cells) was analyzed by BV786 and BV421. The results were analyzed using FlowJo flow analysis software.

[0231] like Fig.13 As shown, the results showed that at 2 weeks and 22 weeks after immunization, the level of IFN-γ secreted by CD8 positive cells in the spleen cells of mice immunized with the recombinant measles virus Ebola vaccine was significantly higher than that in the control vaccine group.

[0232] 4.3 ELISPOT detection of cytokines

[0233] The ELISPOT plate was coated with 5 μg / mL anti-mouse IFN-γ antibody and placed at 4°C overnight. Before the experiment, the plate was blocked with RPMI1640+10% FBS medium at room temperature for 2 hours. During the experiment, the blocking solution was discarded, and 100 μL of RPMI1640+10% FBS medium containing EBOV-GP peptide mixture was added to each well. According to the design, 100 μL of isolated mouse spleen cells were added to each well, and the cell concentration was 2×106 cells / mL. 50 ng / mL of PMA was added to each well of the positive control well, and a non-stimulation control was set up at the same time. The cells were cultured in a 37°C, 5% CO2 incubator for 18-24 hours. The next day, the cells in the plate were discarded, and each well was washed twice with 200 μL of distilled water, and then washed 3 times with PBS+0.1% Tween-20, each time for 2-3 minutes. Discard the wash solution in the plate, add 100μL of Biotinylated anti-mouse IFN-γ diluted 1:250 in PBS + 10% FBS to each well, and leave at room temperature for 2 hours. After 2 hours, discard the liquid in the wells, wash 3 times with wash solution, leave for 2-3 minutes each time, add 100μL of streptavidin-horseradish peroxidase diluted 1:100 in PBS + 10% FBS to each well, and leave at room temperature for 1 hour. Discard the liquid in the wells, wash 4 times with wash solution, and then wash 3 times with PBS. Use BD ELISPOT AEC substrate set for color reaction. When the spots in the wells grow to the appropriate size, discard the color substrate and rinse with a large amount of distilled water to terminate the reaction. Dry the plate and count the spots using the enzyme-linked spot imaging analysis system.

[0234] The experimental data are collated as follows Fig.14As shown in the figure, the amount of IFN-γ secreted by the spleen cells of mice immunized with the Ebola vaccine group was significantly higher than that of the control vaccine group. However, there was no significant difference in the amount of IFN-γ secreted by the spleen cells of mice immunized with the two recombinant measles virus vaccines, MV-EBOVGP and MV-EBOVGP+VP40, whether 2 weeks after immunization or 22 weeks after immunization. This result is consistent with the results of flow cytometry detection.

[0235] According to the experimental design, the recombinant measles virus and measles virus vector control vaccines were diluted with OPTI-MEM to the appropriate infection titer, and 100 μL was injected intraperitoneally using a 1mL syringe for immunization. The challenge protection test was performed 4 weeks after the mice were immunized to evaluate the effectiveness of the vaccine, and the weight changes, survival of the mice after the challenge, and the clearance of the virus in the tissues of the mice in each immunized group after infection were continuously monitored. The mouse groupings set for evaluating the effectiveness of the recombinant measles virus vaccine against Ebola virus using rVSV-EBOV (replicating recombinant pseudovirus) and MA-EBOV (Ebola virus mouse-adapted live virus) are as follows in Table 7:

[0236] Table 7: Mouse challenge group list

[0237] Immunization group Immunization dose MV-Schwarz 1×105TCID50 MV-EBOVGP 1×105TCID50 MV-EBOVGP+VP40 1×105TCID50

[0238] Body weight changes and survival curves of mice challenged with rVSV-EBOV Fig.15 As shown; the weight changes and survival curves of MA-EBOV challenged mice are shown in Fig.16 Both vaccine strains can achieve 100% effective protection against Ebola pseudovirus and live virus. In the MA-EBOV challenge, the weight of mice in the recombinant measles virus vaccine strain MV-EBOVGP+VP40 showed a stable trend, while the MV-EBOVGP vaccine strain showed a trend of first decreasing and then increasing, indicating that the MV-EBOVGP+VP40 vaccine strain showed a better protective effect.

[0239] In summary, the Ebola recombinant measles virus vector vaccine induces efficient cellular immunity and humoral immunity in the mouse model. Both cellular and humoral immune responses are crucial for the body to resist Ebola virus infection. Studies in animal models in recent years have shown that compared with cellular immune responses, Ebola GP-specific IgG antibody levels are more correlated with the survival of infected animals.

[0240] In summary, the present invention provides a novel Ebola virus vaccine based on a measles virus vector, which has broad spectrum and high efficiency, and can provide effective protective measures against possible Ebola epidemics in the future.

[0241] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A recombinant measles virus vector expressing Ebola virus protein, characterized in that: It includes: The coding sequence of the negative-strand RNA of Ebola virus glycoprotein GP is inserted into the measles virus vector.

2. The recombinant measles virus vector according to claim 1, characterized in that The coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is also inserted into the measles virus vector; Preferably, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP is located in the non-coding region before the 5' end of the N gene on the measles virus vector, the non-coding region between the P gene and the M gene, or between the H gene and the L gene; Preferably, the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is located in the non-coding region before the 5' end of the N gene, the non-coding region between the P gene and the M gene, or between the H gene and the L gene on the measles virus vector; Preferably, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP is located in the non-coding region between the P gene and the M gene on the measles virus vector, and the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein is located in the non-coding region before the 5' end of the N gene on the measles virus vector; Preferably, the Ebola virus glycoprotein GP and VP40 protein are both from the Zaire type Ebola virus Mayinga strain, Genebank number: AF086833.2; Preferably, the coding sequences of the negative-strand RNA of the Ebola virus glycoprotein GP and VP40 protein are as shown in SEQ ID NO: 9 and SEQ ID NO:

10.

3. The recombinant measles virus vector according to claim 1, characterized in that The measles virus vector includes measles virus N gene, P gene, M gene, F gene, H gene and L gene; Preferably, the measles virus vector comprises the N gene, P gene, M gene, F gene, H gene and L gene of the attenuated measles virus strain, and the attenuated measles virus strain is Schwarz, with a Genebank number of AF266291.1; Preferably, the measles virus vector includes a sequence complementary to the negative-strand RNA sequence of the measles virus strain, and the negative-strand RNA sequence includes: N gene, P gene, M gene, F gene, H gene and L gene; Preferably, the coding sequence of the negative-strand RNA of the N gene on the measles virus vector is as shown in SEQ ID NO:6, the coding sequence of the negative-strand RNA of the P gene is as shown in SEQ ID NO:7, and the coding sequence of the negative-strand RNA of the L gene is as shown in SEQ ID NO:8; Preferably, the measles virus vector comprises: a measles virus gene fragment as shown in SEQ ID NO: 1-5.

4. The recombinant measles virus vector according to claim 1, characterized in that The measles virus vector further comprises at least one of the following regulatory elements: a transcription promoter, a termination sequence, an enhancer and other cis-acting elements.

5. A nucleic acid molecule, characterized in that It includes: The coding sequence of the Ebola virus glycoprotein GP negative-strand RNA and the cDNA sequence of the measles virus antigenome in the recombinant measles virus vector of any one of claims 1 to 4; and the coding sequence of the Ebola virus glycoprotein GP negative-strand RNA is operably linked to the cDNA sequence encoding the measles virus antigenome; Preferably, the nucleic acid molecule further comprises: a coding sequence of the negative-strand RNA of the VP40 protein of the Ebola virus, and the coding sequence of the negative-strand RNA of the VP40 protein of the Ebola virus is operably linked to a cDNA sequence encoding the antigenome of the measles virus; Preferably, the nucleic acid molecule includes, from 5' to 3', the coding sequence of the negative-strand RNA of the Ebola virus VP40 protein, the DNA coding sequence of the measles virus N gene, the DNA coding sequence of the P gene, the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP, ​​the DNA coding sequence of the M gene, the DNA coding sequence of the F gene, the DNA coding sequence of the H gene and the DNA coding sequence of the L gene.

6. A reverse genetics system for rescuing a recombinant measles virus vector expressing an Ebola virus protein, characterized in that: It comprises: a) an antigen expression plasmid, which comprises the coding sequence of the negative-strand RNA of the Ebola virus glycoprotein GP in the recombinant measles virus vector of any one of claims 1-4, operably linked to the cDNA sequence encoding the measles virus antigenome; b) an auxiliary plasmid 1 comprising the measles virus nucleocapsid protein coding sequence; c) an auxiliary plasmid 2 comprising the measles virus phosphoprotein coding sequence; and d) an auxiliary plasmid 3 comprising the measles virus RNA polymerase coding sequence.

7. The reverse genetics system of claim 6, characterized in that wherein the antigen expression plasmid is a eukaryotic expression plasmid; Preferably, the antigen expression plasmid is an animal-to-animal shuttle plasmid; Preferably, the antigen expression plasmid and auxiliary plasmids 1-3 are plasmids containing T7 promoter; Preferably, the attenuated measles virus strain is Schwarz, Genebank number AF266291.

1.

8. A method for preparing recombinant measles virus particles, characterized in that: This includes any of the following methods: Method 1: co-transfecting the plasmid in the reverse genetics system according to any one of claims 6 to 7 into the first cell line; Mode 2: Transfect the antigen expression plasmid in the reverse genetics system as described in any one of claims 6 to 7 into a helper cell line.

9. The method for preparing recombinant measles virus particles according to claim 8, characterized in that: The method further comprises: collecting the cell supernatant after transfection, infecting a second cell line and culturing it; Preferably, the cell supernatant is collected and purified to obtain recombinant measles virus particles expressing Ebola virus proteins; Preferably, the mass ratio of the antigen expression plasmid to the auxiliary plasmid 1, auxiliary plasmid 2 and auxiliary plasmid 3 is: 4-4.1:2.5-2.6:2.5-2.6:0.8-1; Preferably, the first cell line is a cell line stably expressing T7 RNA polymerase, and the second cell line is a Vero cell line.

10. A recombinant measles virus particle, characterized in that: Obtained by the method according to any one of claims 8-9.

11. A host cell, characterized in that It is obtained by transfecting cells with the nucleic acid molecule according to claim 5 or the recombinant measles virus vector according to any one of claims 1 to 4.

12. A composition, characterized in that It comprises the recombinant measles virus particle according to claim 10, and a pharmaceutically acceptable carrier; Preferably, the composition is a vaccine composition.

13. Use of the recombinant measles virus particle according to claim 10 or the composition according to claim 12 in the preparation of a drug or vaccine for preventing and / or treating Ebola virus infection; Preferably, the subject is a human.

Images