Identification and application of molecular markers related to porcine sperm motility

Abstract

The present invention provides a molecular marker identification method related to porcine sperm motility and its application, relating to the field of biotechnology. This application involves applying a substance that detects the SNP molecular marker rs3476761356 to the preparation of a product for predicting porcine sperm motility. The SNP molecular marker rs3476761356 is associated with porcine sperm motility, with the TA genotype being the dominant genotype. Selecting pigs with the TA heterozygous genotype for breeding can effectively improve porcine sperm motility and accelerate the genetic improvement of boar semen quality, providing important insights into pig performance evaluation and genetic breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to molecular marker identification related to pig sperm motility and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] In pig reproduction and breeding, boar semen quality is a key factor influencing its reproductive capacity. Evaluation indicators for boar semen quality primarily include semen volume, sperm motility, sperm density, and total sperm count. Studies have shown that sperm motility is closely related to conception rate and litter size in dams. Sperm motility can affect sperm quality and various aspects of normal function. Insufficient sperm motility can directly lead to egg fertilization failure. Therefore, sperm motility has a significant impact on reproductive efficiency.

[0004] In recent years, marker-assisted selection (MAS) has become an effective method for improving quantitative traits in livestock and poultry, helping breeders identify and select livestock and poultry with ideal genetic characteristics at an early stage. Marker-assisted selection (MAS) improves breeding efficiency by indirectly selecting for target traits by detecting molecular markers that are tightly linked to the target trait. The core of this technology lies in leveraging the linkage relationship between molecular markers and genes for the target trait. By selecting markers tightly linked to the target trait, individuals carrying superior alleles can be quickly screened out at an early stage, without having to wait for the phenotypic expression of the trait. Therefore, by screening for molecular markers tightly linked to boar semen quality traits, marker-assisted selection (MAS) can be used to more accurately select boars carrying markers for superior semen traits, thereby improving semen quality at the genetic level. This is of great significance for improving reproductive efficiency and accelerating the process of genetic improvement.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of the prior art and provide a SNP molecular marker related to pig sperm motility and its application.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] In a first aspect, the invention provides the use of a substance for detecting the SNP molecular marker rs3476761356 in the preparation of a product for predicting pig sperm motility.

[0009] In a second aspect, a kit for predicting pig sperm motility is provided, wherein the kit comprises a substance for detecting the SNP molecular marker rs3476761356.

[0010] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3476761356 described in the first aspect, or the kit described in the second aspect in pig semen quality evaluation, sow screening or pig breeding.

[0011] In a fourth aspect, a method for predicting pig sperm motility is provided, the method comprising predicting a sample having a genotype of TA of the SNP molecular marker rs3476761356 as a boar with high sperm motility.

[0012] In a fifth aspect, a method for screening boars is provided, comprising obtaining the genotype of the SNP molecular marker rs3476761356, and screening boars with a genotype of TA, wherein the boars with a genotype of TA of the SNP molecular marker rs3476761356 have high sperm motility.

[0013] In a sixth aspect, a pig breeding method is provided, the method comprising causing the boar to acquire the genotype of the SNP molecular marker rs3476761356 as TA.

[0014] In the seventh aspect, the application of a substance for gene editing the SNP molecular marker rs3476761356 in the preparation of a product for improving boar sperm motility is provided.

[0015] In an eighth aspect, a kit for improving boar sperm motility is provided, the kit comprising a reagent for gene editing the SNP molecular marker rs3476761356, wherein the gene editing reagent causes the subject to have a genotype of TA at the SNP molecular marker rs3476761356.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a molecular marker associated with porcine sperm motility. By detecting the genotype of the rs3476761356 locus in the porcine CD163 gene, the present invention found that the genotype of the locus is AA, TT, or TA, and that the locus is significantly associated with porcine sperm motility. The TA genotype is the dominant genotype, with sperm motility higher than that of the TT genotype and significantly higher than that of the AA genotype. The rs3476761356 locus can identify or assist in the identification of porcine sperm motility traits. By selecting pigs with the TA heterozygous genotype for breeding, pig sperm motility can be effectively improved, accelerating the genetic improvement of boar semen quality, and having important reference significance for pig performance evaluation and genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is the typing result of the rs3476761356 site of the CD163 gene;

[0020] Figure 2 This is the typing result of the rs1112657230 site of the CD163 gene;

[0021] Figure 3 This is the typing result of the rs3471402610 site of the CD163 gene;

[0022] Figure 4 This is the typing result of the rs3475334360 site of the CD163 gene;

[0023] Figure 5 This is the typing result of the rs3469885070 site of the CD163 gene;

[0024] Figure 6 This is the typing result of the rs1111878725 site of the CD163 gene. DETAILED DESCRIPTION

[0025] The technical solutions of the present invention will be described clearly and completely below in conjunction with the embodiments. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention. Unless otherwise specified, the professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the described contents may also be applied to the present invention.

[0026] Cluster of differentiation 163 (CD163) is a type I membrane protein primarily expressed in monocytes and macrophages and is a type B member of the cysteine-rich scavenger receptor superfamily. The porcine CD163 gene is located on chromosome 5. The genome comprises 17 exons and 16 introns, with a coding region of 3,333 bp in length, encoding a total of 1,110 amino acids. The CD163 gene plays an important role in inflammatory responses, immune regulation, and the development and progression of diseases. Testicular macrophages (tMΦ) have immunosuppressive functions that protect spermatogenesis from autoimmune attacks. Studies have shown that CD163-positive M2 macrophages are significantly negatively correlated with spermatogenesis, potentially affecting semen quality, suggesting that CD163 may be a key factor influencing male reproduction. The present invention discovered that the SNP site rs3476761356 in the CD163 gene is associated with porcine sperm motility. The SNP molecular marker rs3476761356 is located at the 63334090bp position on chromosome 5 in the pig genome with the sequence information version number Sscrofa11.1 (accession number NM_213976.1). The site is the 41st position of SEQ ID NO.6. The base W at the site is A or T, and the genotype at the site is AA, TT or TA.

[0027] SEQ ID NO.6:

[0028] ATCATATGGAGGTGCTTTTAAAAAAGGCATTTCTGCACTG W TGTTCTCTGGAATAGAAGTAATTCTTATGTACACTGAAGT.

[0029] Experiments have found that the rs3476761356 locus is significantly associated with pig sperm motility. The TA genotype is the dominant genotype, with higher sperm motility than the TT genotype and significantly higher than the AA genotype (P < 0.05). In this article, high sperm motility refers to sperm motility that is higher than the average sperm motility of the breed.

[0030] Based on the above findings, the following technical solutions are provided.

[0031] In a first aspect, the invention provides the use of a substance for detecting the SNP molecular marker rs3476761356 in the preparation of a product for predicting pig sperm motility.

[0032] In an optional embodiment, the substance for detecting SNP molecular markers includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for mass spectrometry detection, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substance for detecting SNP sites includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent labels, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned substance for detecting SNP molecular markers based on general and more specific methods described in textbooks, references, process manuals, product descriptions, and standard documents, and the present invention is not limited thereto.

[0033] In an optional embodiment, the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0034] SEQ ID NO.1: GGAGGTGCTTTTAAAAAAGG;

[0035] SEQ ID NO. 2: AGCACACTACTTTCCTGAAC.

[0036] In an optional embodiment, the forward primer and the reverse primer further independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protection base for sequencing.

[0037] In an optional embodiment, the substance for detecting SNP molecular markers includes a MassARRAY detection reagent, which is a nucleic acid mass spectrometry analysis method based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology. MassARRAY detection first obtains an amplification product containing a SNP site by nucleic acid amplification, and then performs a single base extension reaction using a single base extension primer designed next to the SNP site. The extension primer terminates after extending one base at the SNP site, so that the allele extension product of each SNP has only a difference in the terminal base. Mass spectrometry is then performed to obtain a spectrum, and a peak diagram is generated at the corresponding respective molecular weight positions according to the difference in the molecular weight of the extension product. The MassARRAY detection reagent includes a forward primer, a reverse primer, and an extension primer.

[0038] In an optional embodiment, the nucleotide sequence of the forward primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 1 and is at least 30 bp in length; the nucleotide sequence of the reverse primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 2 and is at least 30 bp in length. The length of the forward and reverse primers being at least 30 bp facilitates the distinction between the primers and the target product during mass spectrometry analysis, preventing interference with the detection results due to incomplete primer digestion.

[0039] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0040] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0041] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0042] In a second aspect, a kit for predicting pig sperm motility is provided, the kit comprising a substance for detecting the SNP molecular marker rs3476761356 of the first aspect.

[0043] In an optional embodiment, the kit includes one or more of reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for mass spectrometry detection, reagents for constructing a sequencing library, and reagents for sequencing. More specifically, the kit includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent labels, buffers, dNTPs, salts, and the like. Depending on the specific detection method, those skilled in the art can select the reagent composition of the kit based on general and more specific methods described in textbooks, reference literature, process manuals, product specifications, and standard documents, and the present invention is not limited thereto.

[0044] In an optional embodiment, the kit includes a reagent for nucleic acid amplification, the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0045] In an optional embodiment, the forward primer and the reverse primer further independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protection base for sequencing.

[0046] In an optional embodiment, the kit includes a MassARRAY detection reagent. The MassARRAY detection reagent includes a forward primer, a reverse primer, and an extension primer.

[0047] In an optional embodiment, the nucleotide sequence of the forward primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 1 and is at least 30 bp in length; the nucleotide sequence of the reverse primer used in the MassARRAY assay includes the sequence shown in SEQ ID NO. 2 and is at least 30 bp in length. The length of the forward and reverse primers being at least 30 bp facilitates the distinction between the primers and the target product during mass spectrometry analysis, preventing interference with the detection results due to incomplete primer digestion.

[0048] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0049] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0050] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0051] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3476761356 described in the first aspect, or the kit described in the second aspect in pig semen quality evaluation, sow screening or pig breeding.

[0052] In a fourth aspect, a method for predicting pig sperm motility is provided, the method comprising predicting a sample having a genotype of TA of the SNP molecular marker rs3476761356 as a boar with high sperm motility.

[0053] In an optional embodiment, the prediction method can also be combined with other targets, such as other polymorphic molecular markers (such as SSR molecular markers, STR molecular markers or InDel molecular markers), or other prediction methods known in the art to assist in predicting pig sperm motility.

[0054] In a fifth aspect, a method for screening boars is provided, comprising obtaining the genotype of the SNP molecular marker rs3476761356, and screening boars with a genotype of TA, wherein the boars with a genotype of TA of the SNP molecular marker rs3476761356 have high sperm motility.

[0055] In a sixth aspect, a pig breeding method is provided, comprising causing a boar to acquire a genotype of TA for the SNP molecular marker rs3476761356. The specific means for acquiring a specific genotype in a boar can be accomplished by conventional methods known in the art by those skilled in the art, and the present invention is not limited thereto.

[0056] In an alternative embodiment, offspring with a target genotype are obtained by obtaining parents with known genotypes.

[0057] In an optional embodiment, offspring with a target genotype are obtained by gene editing methods.

[0058] In the seventh aspect, the application of a substance for gene editing the SNP molecular marker rs3476761356 in the preparation of a product for improving boar sperm motility is provided.

[0059] In an optional embodiment, the substances used for gene editing of the SNP molecular marker rs3476761356 include but are not limited to reagents for the CRISPR-Cas gene editing system, specifically but not limited to guide RNA or polynucleotides encoding guide RNA; donor DNA or polynucleotides encoding donor DNA; Cas enzymes or polynucleotides editing Cas nucleases, the Cas nucleases including but not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or proteins, polypeptides or complexes mutated from the above-mentioned Cas nucleases and / or fused with other functional domains.

[0060] In an eighth aspect, a kit for improving boar sperm motility is provided, the kit comprising a reagent for gene editing the SNP molecular marker rs3476761356, wherein the gene editing reagent causes the subject to have a genotype of TA at the SNP molecular marker rs3476761356.

[0061] In an optional embodiment, the kit for improving boar sperm motility includes reagents for the CRISPR-Cas gene editing system, and the reagents for the CRISPR-Cas gene editing system include but are not limited to guide RNA or a polynucleotide encoding the guide RNA; donor DNA or a polynucleotide encoding the donor DNA; Cas enzyme or a polynucleotide that edits the Cas nuclease.

[0062] In an optional embodiment, the pig described in any of the above aspects includes a Duroc pig.

[0063] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0064] Example Discovery of SNP Molecular Markers Related to Sperm Motility Traits in Duroc Pigs

[0065] 1. Detection of Duroc pig sperm motility

[0066] Computer-assisted sperm analysis was used to evaluate Duroc pig sperm motility. The steps were as follows:

[0067] First, place the semen sample in a 37°C constant-temperature water bath to liquefy it. Once the semen is completely liquefied, mix thoroughly by inverting the sample. Add an appropriate amount of the semen sample to a sperm quality analysis counting plate preheated to 37°C. After incubating for 2 minutes, sperm motility measurements can be performed. The results of sperm motility testing on 341 Duroc pigs are shown in Table 1.

[0068] Table 1 Duroc pig sperm motility test results

[0069]

[0070]

[0071] 2. SNP molecular marker genotyping using the MassARRAY method

[0072] 1. Design and synthesis of primers for genotyping

[0073] Corresponding primer sets were designed at specific sites on chromosome 5 of the pig genome with sequence information version number Sscrofa11.1, including the 63334090bp site (marked as rs3476761356), the 63306451bp site (marked as rs1112657230), the 63328806bp site (marked as rs3471402610), the 63321759bp site (marked as rs3475334360), the 63303006bp site (marked as rs3469885070), and the 63306373bp site (marked as rs1111878725). The nucleotide sequences of the primers are shown in Table 2 (F represents the forward primer, R represents the reverse primer, and U represents the extension primer).

[0074] Table 2 Primer sequences

[0075]

[0076]

[0077] The above primers were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0078] 2. Extraction of genomic DNA from semen of 341 Duroc pigs

[0079] (1) Prepare semen extractant: 0.5 mL Tris-HCl (1 M, pH = 8), 1 mL EDTA-Na (0.5 M, pH = 8), 1 mL NaCl (5 M), 2 mL SDS (10%), 400 μL DTT (1 M) and 5.5 mL ddH2O, mix well, sterilize under high pressure and store at room temperature.

[0080] (2) Mix the semen sample thoroughly by inverting it upside down, then add 1 mL to a centrifuge tube and centrifuge at 12,000 rpm for 2 min. Then, take 100 μL of the sample and precipitate it in a 1.5 mL centrifuge tube.

[0081] (3) Add 400 μL ddH2O, 100 μL semen extractant, and 30 μL proteinase K and mix thoroughly.

[0082] (4) Digest overnight (12 h) in a constant temperature water bath at 60°C until the sample becomes transparent.

[0083] (5) Add the same volume of Tris-saturated phenol, slowly invert to mix, and centrifuge at 10,000 rpm for 7 minutes in a pre-cooled centrifuge (4°C). Pipette the supernatant (about 400 μL) into a new centrifuge tube; repeat the operation once more.

[0084] (6) Tris-saturated phenol, chloroform, and isoamyl alcohol were prepared in a ratio of 25:24:1 to form equal volumes of liquid and added to the reaction, and the above extraction steps were repeated.

[0085] (7) Prepare equal volumes of chloroform and isoamyl alcohol in a ratio of 24:1 and add them to the reaction. Repeat the above extraction steps and transfer the supernatant to a 2 mL centrifuge tube.

[0086] (8) Add 1 / 10 volume of sodium acetate solution (3 M) and 2 volumes of anhydrous ethanol (pre-cooled at -20°C) to the supernatant. Slowly invert the centrifuge tube to see white clumps of DNA precipitate. Gently shake to mix and aggregate the DNA into clumps. Centrifuge at 4°C, 10,000 rpm for 2 min and discard the supernatant.

[0087] (9) Prepare 75% ethanol (pre-cooled to -20°C) and add it to the DNA precipitate for 10 min. Centrifuge at 4°C, 10,000 rpm for 2 min, discard the supernatant, repeat the wash twice, and briefly centrifuge again to remove the remaining liquid.

[0088] (10) Open the lid and let it dry naturally. When the white precipitate becomes transparent, add 50 μL ddH2O to dissolve it. Mix it by pipetting and measure the DNA concentration using a micro-spectrophotometer.

[0089] 3. Genotyping using Sequenom MassARRAY SNP technology

[0090] (1) Amplification of target fragment

[0091] The genomic DNA of the semen of the above 341 Duroc pigs was used as a template, and PCR amplification was performed using the forward and reverse primers corresponding to the different sites in Table 2 to obtain PCR amplification products.

[0092] PCR amplification reaction system (5 μL): enzyme-free water 1.75 μL, 10x PCR reaction buffer 0.625 μL, 25 mM MgCl 0.325 μL, 25 mM dNTP Mix 0.1 μL, 0.5 μM forward primer 0.5 μL, 0.5 μM reverse primer 0.5 μL, 5 U / μL HotStar Taq 0.2 μL, 10 ng / μL genomic DNA 1 μL.

[0093] PCR amplification program: 94°C for 2 min; 94°C for 20 s, 56°C for 30 s, 72°C for 60 s, 45 cycles; 72°C for 3 min.

[0094] (2) Alkaline phosphatase treatment of PCR products (SAP digestion)

[0095] The PCR product is digested with SAP enzyme to obtain a digestion product;

[0096] Digestion system (7 μL): 1.53 μL of enzyme-free water, 0.17 μL of 10X SAP buffer, 0.3 μL of 1.7 U / μL SAP Enzyme, and 5 μL of PCR amplification product.

[0097] Digestion reaction conditions: 37°C for 40 min, 85°C for 5 min.

[0098] (3) Single base extension

[0099] Using the above digestion products as templates, single-base extension reactions were performed using the extension primers at each site in Table 2 to obtain extension products.

[0100] Extension reaction system (9 μL): enzyme-free water 0.619 μL, 10× iPLEX Buffer Plus 0.2 μL, iPLEX terminator 0.2 μL, extension primer 0.94 μL, iPLEX enzyme 0.041 μL, digestion product 7 μL.

[0101] Extension reaction conditions: 94°C for 30 s; [94°C for 5 s, (52°C for 5 s, 80°C for 5 s; 5 cycles); 40 cycles]; 72°C for 3 min.

[0102] (4) On-machine testing

[0103] The extension product was diluted 3-fold with enzyme-free water, and 6 mg of resin was added for desalting. The product was rotated on a rotary mixer for 15 minutes and centrifuged at 2000 rpm for 5 minutes. The desalted sample was spotted on the sample target using a mass spectrometer spotter, and after natural crystallization, it was placed on a mass spectrometer for matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection, and data was collected.

[0104] The mass spectrometry results of the extension products at different sites in 341 Duroc pigs are as follows Figures 1 to 6 The statistical results of relevant genotypes are shown in Tables 3 to 8. The results showed that only one genotype was detected at the rs1112657230 and rs3471402610 sites in 341 Duroc pigs, and no polymorphism was found, so no subsequent analysis was performed. The genotyping results of the rs3476761356, rs3475334360, rs3469885070 and rs1111878725 sites were good, with a genotype detection rate of >90%. The unsuccessful genotyping of some samples is indicated by " / ".

[0105] Table 3 Statistical raw data of different genotypes at rs3476761356 site of CD163 gene in Duroc pigs

[0106]

[0107]

[0108] Table 4 Statistical raw data of different genotypes at rs1112657230 site of CD163 gene in Duroc pigs

[0109]

[0110]

[0111] Table 5 Statistical raw data of different genotypes at rs3471402610 site of CD163 gene in Duroc pigs

[0112]

[0113]

[0114]

[0115] Table 6 Statistical raw data of different genotypes at rs3475334360 of CD163 gene in Duroc pigs

[0116]

[0117]

[0118] Table 7 Statistical raw data of different genotypes at rs3469885070 site of CD163 gene in Duroc pigs

[0119]

[0120]

[0121] Table 8 Statistical raw data of different genotypes of CD163 gene rs1111878725 locus in Duroc pigs

[0122]

[0123]

[0124]

[0125] 3. Correlation analysis between porcine CD163 gene SNP molecular markers and sperm motility

[0126] Excel software was used to perform population genetics analysis on the genotype distribution of the above-mentioned loci in the Duroc population. The genotype frequency, gene frequency, polymorphism information content (PIC), heterozygosity (HE), and effective number of alleles (Ne) of each locus in the population were calculated. The chi-square test was used to detect whether the locus was in Hardy-Weinberg equilibrium. HaploView software was used to detect the minor allele frequency (MAF) of each locus. The results are shown in Table 9.

[0127] In the Duroc population, the TA heterozygous genotype distribution at the rs3476761356 locus is the most abundant, and the distribution of allele T is higher than that of allele A; the AA homozygous genotype distribution at the rs3475334360 locus is the most abundant, and the distribution of allele A is higher than that of allele G; the TT homozygous genotype distribution at the rs3469885070 locus is the most abundant, and the distribution of allele T is higher than that of allele C; the CC homozygous genotype distribution at the rs1111878725 locus is the most abundant, and the distribution of allele C is higher than that of allele T; all 4 loci are moderately polymorphic (0.25 < PIC < 0.5) and in Hardy-Weinberg equilibrium (P > 0.05) in the Duroc population.

[0128] Table 9 Population genetics results of 4 SNPs loci of the CD163 gene in the Duroc population

[0129]

[0130] Note: PIC is the polymorphism information content, HE is the heterozygosity, NE is the effective number of alleles, MAF is the minor allele frequency, the P value is the chi-square value, and the numbers in parentheses are the sample numbers corresponding to the genotypes.

[0131] Using the JMP Pro 18 software to conduct an association analysis between the different genotypes of the above 4 loci and sperm motility, the results are shown in Table 10. The rs3476761356 locus is significantly associated with the sperm motility of Duroc pigs. The TA genotype is the dominant genotype, and its sperm motility is higher than that of the TT genotype and significantly higher than that of the AA genotype (P < 0.05). In actual breeding, selecting boars with the TA heterozygous genotype at this locus for breeding will result in better semen quality.

[0132] Table 10 Association analysis between different genotypes of SNP molecular markers of the CD163 gene and sperm motility of Duroc pigs

[0133]

[0134]

[0135] Note: Different letters shown in the upper right corner indicate significant differences (P < 0.05), and the values are expressed as least square means ± standard error.

[0136] The rs3476761356 locus is located at the position of 63334090 bp on chromosome 5 in the pig genome with the sequence information version number of Sscrofa11.1 (accession number NM_213976.1). This locus is the 41st position of SEQ ID NO.6. The base W at this locus is A or T, and the genotypes at this locus are AA, TT, or TA.

[0137] In summary, the genotype of the rs3476761356 locus is related to the pig sperm motility trait. By determining whether the genotype of the rs3476761356 locus in the pig CD163 gene is AA, TT or TA, it can assist in identifying the sperm motility of the tested pigs: the sperm motility of the tested pigs with the TA genotype is higher than that of the tested pigs with the AA or TT genotype.

[0138] The main reagents used in the above examples are as follows:

[0139] PCR Enzyme (Roche, 05066506001);

[0140] PCR Accessory Set (Sequenom, 11327);

[0141] SpectroCHIP Resin Kit (Sequenom, 10117-2);

[0142] IPLEX Gold Reagent Kit (Sequenom, 10136);

[0143] enzyme-free water (Tiangen, RT121-02);

[0144] The main instruments used in the above examples are as follows:

[0145] 384-well PCR machine (Applied Biosystems / BIO-GENER, Veriti384 / RePURE-A);

[0146] Vortex mixer (Qilin Bell, QL-901);

[0147] Centrifuge (eppendorf, 5810R);

[0148] Massarray mass spectrometer (Agena, 260000);

[0149] Massarray mass spectrometer (Agena, RS1000);

[0150] Rotary mixer (Jiangsu Haimen Qilin Bell Instrument Manufacturing Co., Ltd., WA-986);

[0151] All reagents and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.

[0152] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for detecting the SNP molecular marker rs3476761356 in the preparation of a product for predicting sperm motility in Duroc pigs, wherein the TA genotype of the SNP molecular marker rs3476761356 is a dominant genotype, and the sperm motility of Duroc pigs with the TA genotype is higher than that of the TT genotype and the AA genotype.

2. The use according to claim 1, characterized in that The substances for detecting the SNP molecular marker rs3476761356 include one or more of reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for mass spectrometry detection, reagents for constructing sequencing libraries, and reagents for sequencing.

3. The use according to claim 2, characterized in that The reagent for nucleic acid amplification includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

4. The use according to claim 2, characterized in that The reagent for nucleic acid amplification includes a MassARRAY detection reagent, which includes a forward primer, a reverse primer and an extension primer.

5. The use according to claim 4, characterized in that The nucleotide sequence of the forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

6. The use according to claim 4, characterized in that The nucleotide sequence of the extension primer is shown in SEQ ID NO.

5.

7. Use of the substance for detecting the SNP molecular marker rs3476761356 according to any one of claims 1 to 6 in pig semen quality evaluation, breeding pig screening or pig breeding; the pig is a Duroc pig; The TA genotype of the SNP molecular marker rs3476761356 is a dominant genotype, and the sperm motility of Duroc pigs with the TA genotype is higher than that of the TT genotype and the AA genotype; The pig semen quality evaluation includes evaluating the semen of pigs with the advantageous genotype for high sperm motility; The breeding pig screening includes screening boars with a genotype of TA, and boars with a genotype of TA of the SNP molecular marker rs3476761356 have high sperm motility; The pig breeding includes enabling the boar to obtain the genotype of the SNP molecular marker rs3476761356 as TA.

8. A method for screening Duroc boars, characterized in that: The method includes obtaining the genotype of the SNP molecular marker rs3476761356, screening the boars with the genotype of TA, and the boars with the genotype of the SNP molecular marker rs3476761356 being TA have high sperm motility.

9. A Duroc pig breeding method, characterized in that: The method comprises making the boar acquire the genotype of the SNP molecular marker rs3476761356 as TA; the SNP molecular marker rs3476761356 TA genotype is a dominant genotype, and the sperm motility of the Duroc pig with the TA genotype is higher than that of the TT genotype and the AA genotype.

Images