Linear covalently closed DNA vaccines, their preparation methods, and applications

Abstract

The present application relates to a linear covalently closed DNA vaccine, comprising a plasmid vector containing an IHNV virus antigen expression unit, the sequence of the antigen expression unit is shown as SEQ ID NO. 1, and the DNA structure is in the form of linear end covalently closed form. The present application also relates to a preparation method and application of the linear covalently closed DNA vaccine. Compared with the traditional DNA vaccine, the linear covalently closed DNA vaccine has no redundant bacterial-derived nucleic acid sequence, and has good safety and effectiveness for the prevention and treatment of rainbow trout infectious hematopoietic necrosis.

Description

Technical Field

[0001] This invention belongs to the field of animal vaccines and veterinary biological products technology, specifically relating to a linear covalently closed DNA vaccine and its preparation method and application. Background Technology

[0002] Infectious hematopoietic necrosis (IHN) is a serious fish disease caused by infectious hematopoietic necrosis virus (IHNV). This virus belongs to the Rhabdoviridae family and primarily infects cold-water fish such as rainbow trout (Oncorhynchus mykiss). Symptoms mainly include darkening of body color, bulging eyes, abdominal swelling, gill congestion, abnormal swimming, and internal bleeding. IHN has a very high mortality rate, especially in juvenile and fingerling stages, where mortality can reach 80% to 100%. Infected fish typically die in large numbers within 2 to 3 weeks.

[0003] The IHNV virus is bullet-shaped, with a diameter of approximately 45–100 nanometers and a length of 100–430 nanometers. The viral particle consists of an envelope and a nucleocapsid, with densely distributed spikes on its surface. Its genome is a non-segmented, negative-sense, single-stranded RNA, approximately 11,000 nucleotides in length, encoding six proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), nonviral protein (NV), and polymerase (L). Among these, glycoprotein (G) is the primary antigenic protein, capable of inducing a specific immune response in the host and playing a crucial role in viral infection, including recognizing and binding to host cell receptors. Therefore, glycoprotein (G) is the most important antigenic protein expressed in DNA vaccines.

[0004] DNA vaccines are a novel vaccine technology that originated in the 1990s. They represent the third generation of vaccines, following live attenuated vaccines and genetically engineered vaccines. DNA vaccines work by directly introducing plasmid DNA containing genes encoding foreign antigens into human or animal cells, utilizing the host cell's transcription and translation systems to express the antigen proteins. These antigen proteins are then recognized by the host's immune system, stimulating humoral and cellular immune responses. This process is similar to pathogen infection or live attenuated vaccine administration, thus DNA vaccines can effectively elicit a strong immune response. Because DNA vaccines do not contain live pathogens, they avoid the infection risks associated with traditional vaccines, offering the advantage of high safety. Furthermore, plasmid DNA can be mass-produced by bacteria and stored and transported at room temperature, resulting in low cost and good stability. However, the presence of bacterial antibiotic resistance gene sequences and prokaryotic replication sequences on the plasmid DNA backbone poses risks such as foreign gene integration and adverse reactions.

[0005] Telomerase-optimized plasmid backbone technology is a technique that utilizes telomerase to optimize the plasmid backbone. Telomerase is an enzyme that elongates telomeres at the ends of chromosomes, and it is mainly composed of RNA and protein. Through reverse transcription, it adds nucleotide sequences from an RNA template to the ends of chromosomes, thereby elongating telomeres and protecting chromosomes from damage.

[0006] The core of telomerase-optimized plasmid backbone technology lies in utilizing the elongation effect of telomerase to modify and optimize the ends of plasmid DNA. When a plasmid is modified and inserted into a corresponding telomerase recognition site, and then incubated with telomerase under certain conditions, the plasmid will be cleaved at the telomerase-specific recognition site under the action of telomerase, and telomere elongation will occur, thereby generating linearly closed telomere structures at the specific recognition sites. When the plasmid has two specific recognition sites, after enzyme digestion, a linear DNA fragment with covalently closed ends is obtained. Currently, this technology has been applied to the optimization of related plasmid backbones. Touchlight, for example, optimizes plasmid backbones using telomerase, removes irrelevant redundant sequences, and combines this with rolling circle amplification technology to efficiently synthesize related linearly closed DNA (US11384388 B2).

[0007] The telomerase-optimized plasmids remove irrelevant antibiotic resistance genes, retaining only the functional elements relevant to the application, such as cistron sequences. Compared to traditional DNA plasmids, linear covalently closed DNA, while maintaining comparable expression efficiency, reduces potential safety risks due to the absence of antibiotic resistance genes and offers higher base utilization. For example, Walters et al. optimized the backbone of influenza virus DNA vaccines, showing that linear covalently closed DNA has the same immunogenicity as ordinary DNA vaccines (Walters AA, Kinnear E, Shattock RJ, McDonald JU, Caproni LJ, Porter N, Tregoning JS. Comparative analysis of enzymatically produced novel linear DNA constructs with plasmids for use as DNA vaccines. GeneTher. 2014 Jul; 21(7):645-52. doi:10.1038 / gt.2014.37.Epub2014May 15.PMID:24830436;PMCID:PMC4082409.). Conforti A et al. demonstrated in cats that linear DNA containing the SARS-CoV-2 receptor-binding domain has high safety profiles, with no adverse reactions observed after inoculation (Conforti A, Sanchez E, Salvatori E, Lione L, Compagnone M, Pinto E, Palombo F, D'Acunto E, Muzi A, Roscilli G, Sun Y, Viscount B, Hayward J, Shorrock C, Diel DG, Impelleri JA, Aurisicchio LA. linear DNA encoding the SARS-CoV-2 receptor-binding domain elicits potent immune response and neutralizing antibodies in domestic cats. Mol Ther Methods ClinDev. 2023 Mar 9; 28:238~248. doi:10.1016 / j.omtm.2022.12.015.Epub 2023 Jan). 2. PMID: 36618106; PMCID: PMC9806924.). Summary of the Invention

[0008] To address the aforementioned problems in existing technologies, such as the enormous economic losses caused by infectious hematopoietic necrosis disease resulting from rainbow trout IHNV virus, and the potential risks posed by prokaryotic sequences and antibiotic resistance genes in traditional DNA vaccines, this invention provides a linear covalently closed DNA vaccine without redundant sequences, containing only the essential elements of a DNA vaccine, as well as its preparation method and applications.

[0009] To achieve the above objectives, a first aspect of the present invention provides a linear covalently closed DNA vaccine, characterized in that it comprises a plasmid vector containing an IHNV virus antigen expression unit, wherein the sequence of the antigen expression unit is shown in SEQ ID NO.1, and the DNA structure is a linearly covalently closed form.

[0010] Preferably, the plasmid vector used is the PVAX1 plasmid.

[0011] Preferably, the plasmid vector contains a CpG motif, as shown in SEQ ID NO.4.

[0012] The present invention provides a competent cell, comprising a plasmid vector containing an IHNV virus antigen expression unit, wherein the sequence of the antigen expression unit is shown in SEQ ID NO.1, and is preferably a Stbl3 competent cell.

[0013] A second aspect of the present invention also provides a method for preparing a linear covalently closed DNA vaccine, characterized in that it comprises the following steps:

[0014] (1) The plasmid vector containing the IHNV virus antigen expression unit was modified by inserting a telomerase recognition site, and the sequence of the antigen expression unit is shown in SEQ ID NO.1;

[0015] (2) Linearize the plasmid vector obtained in step 1;

[0016] (3) The linearized plasmid vector obtained in step 2 was digested with telomerase;

[0017] (4) The product obtained in step 3 is digested with exonuclease and purified by alcohol precipitation.

[0018] Preferably, in step (1), the telomerase recognition site is TelRL, with the sequence shown in SEQ ID NO.2; in step (2), linearization is performed by restriction endonuclease digestion or PCR linear amplification; in step (3), the telomerase used is TelN; and in step (4), the exonuclease is T5 exonuclease.

[0019] Preferably, step (1) specifically involves: using PVAX1 as the original plasmid vector, inserting the truncated IHNV virus G protein sequence and attaching a CpG motif between the T7 promoter sequence and the SV40 poly(A)signal sequence of the PVAX1 plasmid vector, and naming the resulting plasmid PVAX1-G-CpG; inserting the telomerase TelN specific recognition site TelRL upstream of the CMV enhancer and downstream of the SV40 poly(A)signal in the plasmid PVAX1-G-CpG to obtain the plasmid PVAX1-TelRL-G-CpG.

[0020] Preferably, step (2) specifically involves: using restriction endonuclease BamHI or KOD one DNA polymerase for PCR linearization amplification to obtain a linearized PVAX1-TelRL-G-CpG fragment.

[0021] The specific steps (3) are as follows: After incubation with telomerase TelN, linear closed-terminal DNA containing only the essential elements of the antigen expression unit for expressing G protein is obtained, named DbDNA-G-CpG, and two redundant linear open circular fragments.

[0022] The specific steps (4) are as follows: the linear open-circular fragment is digested by T5 exonuclease, and only DbDNA-G-CpG is retained. After alcohol precipitation, pure DbDNA-G-CpG is obtained.

[0023] A third aspect of the present invention provides the application of the linear covalently closed DNA vaccine or the linear covalently closed DNA vaccine obtained by the preparation method described above in the prevention and treatment of infectious hematopoietic necrosis, particularly the prevention and treatment of rainbow trout infectious hematopoietic necrosis.

[0024] This invention constructs a DNA vaccine plasmid using a truncated G protein sequence of the IHNV virus and optimizes the plasmid backbone to contain only the essential elements for antigen expression without any other redundant bacterial sequences, thus greatly reducing potential safety risks. The optimized DbDNA-G-CpG can efficiently express the G protein antigen in rainbow trout cells, triggering an immune response and achieving a protective effect. Attached Figure Description

[0025] Figure 1 This is a schematic diagram of the DbDNA-G-CpG structure of the present invention.

[0026] Figure 2 This is a schematic diagram of the modification of plasmid PVAX1-G-CpG according to the present invention.

[0027] Figure 3A schematic diagram of the process for preparing DbDNA-G-CpG from plasmid PVAX1-TelRL-G-CpG of the present invention.

[0028] Figure 4 This is a schematic diagram of agarose gel electrophoresis and structural verification of DbDNA-G-CpG in Example 2. Both DbDNA-G-CpG and the control linear DNA fragment can be treated with T5 exonuclease.

[0029] Figure 5 The expression of G antigens DbDNA-G-CpG and PVAX1-G-CpG in the CHSE cell line was shown by Western Blot, where P-DNA represents PVAX1-G-CpG and DbDNA represents DbDNA-G-CpG. Detailed Implementation

[0030] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below with reference to specific embodiments.

[0031] Unless otherwise specified, all reagents used in the following embodiments are commercially available reagents, and all detection methods and techniques used are conventional detection methods and techniques in the art.

[0032] This invention provides a linear closed-end optimized DNA vaccine for the prevention and treatment of rainbow trout IHN disease, the structure of which is as follows: Figure 1 As shown in the figure. The DNA vaccine contains a recombinant vector, which uses PVAX1 as the original plasmid vector. An antigen expression unit of the truncated G protein of rainbow trout IHNV virus is inserted between the T7 promoter sequence and the SV40 poly(A)signal sequence of the PVAX1 plasmid vector, and a CpG motif is attached. The resulting plasmid is named PVAX1-G-CpG, and the antigen expression sequence is shown in SEQ ID NO:1.

[0033] Furthermore, the telomerase TelN specific recognition site TelRL (SEQ ID NO:2) was inserted upstream of the CMV enhancer and downstream of the SV40 poly(A)signal of the PVAX1-G-CpG plasmid, which already has an inserted antigen expression unit, to obtain PVAX1-TelRL-G-CpG.

[0034] Furthermore, PCR linearization amplification was performed using restriction endonuclease BamHI or KOD one DNA polymerase to obtain a linearized PVAX1-TelRL-G-CpG fragment. This fragment was then incubated with telomerase TelN to obtain a linear closed-terminal DNA (DbDNA-G-CpG) containing only the essential elements of the antigen expression unit for G protein expression, as well as two redundant linear open circular fragments.

[0035] Finally, the linear open-circular fragment was specifically digested with T5 exonuclease, retaining only DbDNA-G-CpG. After alcohol precipitation, pure DbDNA-G-CpG was obtained. Pure DbDNA-G-CpG can then be purified using Lipofectamine. TM The 3000 (Thermo Fisher Scientific) nanoliposome (LNP) delivery vector can be incubated and packaged to successfully deliver the product into cells for expression, triggering an immune response to IHNV-G and thus achieving an immune effect.

[0036] Example 1

[0037] DNA vaccine plasmid PVAX1-TelRL-G-CpG

[0038] The G protein of IHNV virus is its most important antigenic protein. Therefore, a DNA vaccine plasmid containing a truncated G protein expression unit was selected as the initial modified plasmid. The antigen expression unit sequence is shown in SEQ ID NO: 1, which is derived from the truncated G protein sequence of IHNV virus. The nucleic acid sequence is shown in SEQ ID NO: 3.

[0039] In this embodiment, the DNA vaccine plasmid PVAX1-TelRL-G-CpG is modified from PVAX1-G-CpG. Figure 2 The plasmid modification process is shown in the following steps:

[0040] Materials: The DNA vaccine plasmid vector PVAX1-G-CpG plasmid was prepared in our laboratory using PVAX1 plasmid (commercially available); PrimeSTAR MAX high-fidelity enzyme was purchased from Takara; homologous recombinase was purchased from Abclonal; other materials such as competent cells Stabl3, plasmid mini extraction kit, kanamycin, LB medium components (yeast extract, peptone, and sodium chloride), and agarose powder were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0041] Preparation method of PVAX1-G-CpG:

[0042] (1) The IHNV virus genome was amplified using primer pair F1 / R1 to obtain the G protein sequence with terminal homologous arms, and the PVAX1 plasmid was linearized using primer pair F2 / R2. The two fragments were then ligated by terminal homologous complementation to obtain the PVAX1-G plasmid.

[0043] F1:GCCACCATGGACGCCATGATC

[0044] R1:GCGGCCGCCCATTTAAATTAGTGGGTGGTGGTGGTGGTG

[0045] F2:TAATTTAAATGGGCGGCCGCT

[0046] R2:GCGTCCATGGTGGCGATATCTCGAGGCTAGCCTATAGTGAGTC

[0047] (2) The CpG sequence (SEQ ID NO.4) was synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific CpG sequence is as follows:

[0048] AGAGGAACTTGGTTAGGTACTCGTCGTTTTGTCGTTTTGTCGTTCCATGACGTTCCTGATGCTTGCATAACGGCGAGCTACCGATGTCGTTTGCCGGTGACGTCCATGACGTCCCTGATGCTTCGTCGTTGTCGTTTTGTCGTTTCGTCGTTTTGTCGTTTTGTCGTTCCATGACGTTCCTGATGCTTGCATAACGGCGAGCTACC GATGTCGTTGCCGGTGACGTCCATGACGTCCCTGATGCTTCGTCGTTGTCGTTTTGTCGTTTCGTCGTTTTGTCGTTTTGTCGTTCCATGACGTTCCTGATGCTTGCATAACGGCGAGCTACCGATGTCGTTTGCCGGTGACGTCCATGACGTCCCTGATGCTTCGTCGTTGTCGTTTTGTCGTTCTTCTGAGGCGGAAAGAACC.

[0049] The plasmid PVAX1-G was linearized using primer pair F3 / R3, and a terminal homologous arm was added. Homologous recombination ligation of the CpG sequence and the linearized PVAX1-G yielded the PVAX1-G-CpG DNA vaccine plasmid.

[0050] F3:CTTCTGAGGCGGAAAGAACCCTTCTGAGGCGGAAAGAACCAG

[0051] R3:CCAAGTTCCTCTTTCAGAGGTTATTTCAGG

[0052] Since the essential vaccine elements on the PVAX1-G-CpG plasmid are not distributed in the same region, it is necessary to place the TelRL site and then organize the essential vaccine elements on the plasmid to the same region.

[0053] First, circular PCR was performed on the plasmid vector PVAX1-G-CpG using primer pair PVAX1-G-F1 / R1. Then, the plasmid vector PVAX1-G-CpG was linearized by adding TelRL recognition site homologous arm sequences to both ends of the PVAX1-G-CpG using the TelRL recognition site homologous arm sequences on the PVAX1-GF / R primers.

[0054] PVAX1-G-F1:

[0055] TTATACGCGCGTATAATGGACTATTGTGTGCTGATAGCCATTGCATACGTTGTATC

[0056] PVAX1-G-R1:

[0057] AGTCCATTACGCGCGTATAATGGGCAATTGTGTGCTGATACAATAGCCAATATTGATTTATGCTATATAACC

[0058] After linearization, PVAX1-G-CpG, due to the TelRL homologous arm sequences on both sides, can form a circular plasmid after homologous recombination, named PVAX1-G-CpG-2, and transformed into competent Stbl3 cells. After overnight culture, single colonies were picked for colony PCR verification, and positive individuals were selected for sequencing verification. After the sequencing comparison was correct, the plasmid was extracted for further modification.

[0059] Then, the key vaccine elements on plasmid PVAX1-G-CpG-2 were organized and inserted into another TelRL site.

[0060] The plasmid vector PVAX1-G-CpG-2 was linearized and amplified using primers TelRL2-GF and CpG-GR, and the plasmid PVAX1-G-CpG was linearized and amplified using primers CpG-F and TelRL2-CpG-R.

[0061] TelRL2-GF:

[0062] CCATTATACGCGCGTATAATGGACTATTGTGTGCTGATATAAGGCTAGAGCCACCGCG

[0063] CpG-GR:TGTACCTAACTCGGATTTTACCACATTTGTAGAGGTTTTACTTG

[0064] CpG-F: TAAAATCCGAGTTAGGTACAGAGGAACTTGGTTAGGTACTC

[0065] TelRL2-CpG-R:

[0066] TTATACGCGCGTATAATGGGCAATTGTGTGCTGATACTGACACACATTCCACAGCTG

[0067] After PCR amplification, agarose gel electrophoresis, and gel recovery, two linearized fragments can be obtained. Homologous recombination can be performed using their terminal homologous arms to obtain the desired recombinant plasmid, which can then be transformed into competent Stbl3 cells.

[0068] After overnight culture, single colonies were selected for colony PCR verification. Positive individuals were selected for sequencing verification. After the sequencing comparison was correct, the colonies were expanded and cultured for 12-16 hours. The bacterial cells were collected and the plasmid was extracted to obtain the plasmid PVAX1-TelRL-G-CpG.

[0069] Example 2

[0070] Linear closed-terminal DNA (DbDNA-G-CpG)

[0071] Although the PVAX1-TelRL-G-CpG plasmid already contains the specific recognition site of telomerase TelN, the complex structure of most plasmids, being supercoiled, significantly affects the specific recognition of the TelRL site by telomerase TelN. Therefore, linearization must be performed before telomerase TelN digestion.

[0072] Because the PVAX1 plasmid vector contains a unique BamHI restriction endonuclease recognition site, which is located in a prokaryotic redundant fragment region, enzyme digestion does not affect the antigen expression unit.

[0073] like Figure 3 As shown, a specific method for preparing linear closed-terminal DNA (DbDNA-G-CpG) from the PVAX1-TelRL-G-CpG plasmid is provided. Specifically, the PVAX1-TelRL-G-CpG plasmid and the restriction endonuclease BamHI (Thermo Fisher Scientific) are prepared according to the system shown in Table 1, and incubated at 37°C for 15 min, followed by inactivation of BamHI at 80°C for 5 min to prevent its asterisk activity from affecting subsequent reactions.

[0074] Table 1 Linearization system of PVAX1-TelRL-G-CpG plasmid

[0075]

[0076] Inactivation: 37℃ for 15 min → 80℃ for 5 min

[0077] The linearized plasmids were further digested with telomerase TelN (novoprotein). The system was prepared according to the system in Table 2, and incubated at 30°C for 4 h, followed by inactivation of TelN enzyme at 75°C for 5 min to avoid affecting subsequent reactions.

[0078] Table 2 Telomerase (TelN) digestion system

[0079]

[0080]

[0081] Inactivation: 30℃ for 4 hours → 75℃ for 5 minutes

[0082] The telomerase TelN digestion product is then further digested with T5 exonuclease (novoprotein) to remove redundant non-closed linear DNA fragments.

[0083] By configuring the system as shown in Table 3 and incubating at 37°C for 1 hour, redundant non-closed linear DNA fragments can be completely digested, retaining only the linear closed-end DNA (DbDNA-G-CpG).

[0084] Table 3 Nucleotide digestion system

[0085]

[0086] 37℃ for 1 hour

[0087] The exonuclease digestion product undergoes a further alcohol precipitation step to obtain pure linear closed-terminal DNA (DbDNA-G-CpG). The specific steps are as follows: Add 0.1 volume of sodium acetate (3M, pH 5.2) and 2 volumes of isopropanol to the T5 exonuclease digestion product, freeze at -20°C for 1 hour, then centrifuge at 12000 rpm for 10 minutes, discard the supernatant, and retain the precipitate. Wash the precipitate with 70% cold ethanol, then centrifuge to remove the supernatant. Air-dry the resulting precipitate at 55°C for 10 minutes, and then reconstitute the precipitate with 10% of the initial volume of nuclease-free water to obtain concentrated pure DbDNA-G-CpG.

[0088] The product was validated by agarose gel electrophoresis, such as... Figure 4As shown, after digestion with T5 exonuclease, DbDNA-G-CpG did not decrease significantly, and the band size was correct, proving that the product was correct.

[0089] Example 3

[0090] Antigen expression effect of linear closed-terminal DNA (DbDNA-G-CpG) in CHSE salmon embryonic cells

[0091] By transfecting PVAX1-G-CpG DNA plasmid vaccine and DbDNA-G-CpG linear closed-terminal DNA vaccine into the CHSE cell line, the intracellular expression effects of the two different vaccines can be quantified because the G protein antigen expression unit is designed with a His tag.

[0092] The specific steps are as follows:

[0093] For transfection of CHSE cell lines that have reached 70-85% confluence in 24-well plates, the cells were first subjected to a medium change to an antibiotic-free and serum-free medium for starvation treatment.

[0094] Then, the transfection complex was prepared (Table 4), and the transfection reagent was Lipofectamine. TM 3000 (ThermoFisher Scientific) nanoliposomes were used to develop vaccines, namely PVAX1-G-CpG DNA vaccine and DbDNA-G-CpG DNA vaccine, with a vaccine dosage of 1.38 × 10⁻⁶ per well. 11 Copy number was configured. The transfection complex was transfected into the CHSE cell line, and the culture medium was changed to a medium containing antibiotics and serum 6 h after transfection to remove the starvation treatment. Cells were collected 24 h after transfection, proteins were extracted, and Western blot experiments were performed to detect G protein expression levels.

[0095] Table 4. Transfection complex configuration

[0096]

[0097] The results are as follows Figure 5As shown, the DbDNA-G-CpG DNA vaccine, using the commercial transfection reagent Lipofectamine 3000, achieved highly efficient expression of G protein antigens in the CHSE cell line. Compared with the traditional PVAX1-G-CpG DNA vaccine, it achieved comparable antigen expression with the same number of plasmid copies. Furthermore, the DbDNA-G-CpG DNA vaccine achieved nearly 100% base utilization, a significant improvement compared to the approximately 50% base utilization of PVAX1-G-CpG. Moreover, due to the absence of bacterial origin and antibiotic resistance gene sequences, the DbDNA-G-CpG DNA vaccine exhibits higher safety, greatly reducing the potential risks of DNA vaccination.

[0098] In this specification, the invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations can be made without departing from the spirit and scope of the invention. Therefore, the specification and drawings should be considered illustrative rather than restrictive.

Claims

1. A linear covalently closed DNA vaccine, characterized in that, The plasmid vector contains an IHNV virus antigen expression unit, the sequence of which is shown in SEQ ID NO. 1, and the DNA structure is in the form of linear terminal covalent closure; The preparation method of the DNA vaccine comprises the following steps: (1) inserting a telomerase recognition site into the plasmid vector containing the IHNV virus antigen expression unit, the sequence of which is shown in SEQ ID NO. 1; (2) linearizing the plasmid vector obtained in step 1; (3) performing telomerase enzyme cutting on the linearized plasmid vector obtained in step 2; (4) performing exonuclease digestion on the product obtained in step 3, and recovering by alcohol precipitation purification; In the step (1), the telomerase recognition site is TelRL, and the sequence is shown in SEQ ID NO. 2; In the step (2), linearization is performed by restriction enzyme digestion or PCR linear amplification; In the step (3), the telomerase used is TelN; In the step (4), the exonuclease is T5 exonuclease; The plasmid vector uses PVAX1 plasmid; The plasmid vector contains a CpG motif, as shown in SEQ ID NO.

4.

2. A method of preparing a linear covalently closed DNA vaccine, characterized by, The preparation method comprises the following steps: (1) inserting a telomerase recognition site into the plasmid vector containing the IHNV virus antigen expression unit, the sequence of which is shown in SEQ ID NO. 1; (2) linearizing the plasmid vector obtained in step 1; (3) performing telomerase enzyme cutting on the linearized plasmid vector obtained in step 2; (4) performing exonuclease digestion on the product obtained in step 3, and recovering by alcohol precipitation purification; In the step (1), the telomerase recognition site is TelRL, and the sequence is shown in SEQ ID NO. 2; In the step (2), linearization is performed by restriction enzyme digestion or PCR linear amplification; In the step (3), the telomerase used is TelN; In the step (4), the exonuclease is T5 exonuclease; The plasmid vector uses PVAX1 plasmid; The plasmid vector contains a CpG motif, as shown in SEQ ID NO.

4.

3. The production method according to claim 2, characterized by, The step (1) is specifically: The PVAX1 is used as the original plasmid vector, and the IHNV virus G protein truncated sequence is inserted between the T7 promoter sequence and the SV40 polyA signal sequence of the PVAX1 plasmid vector, and a CpG motif is attached, and the obtained plasmid is named PVAX1-G-CpG; The specific recognition site TelRL of the telomerase TelN is inserted upstream of the CMV enhancer and downstream of the SV40 polyA signal of the plasmid PVAX1-G-CpG, and the plasmid PVAX1-TelRL-G-CpG is obtained.

4. The production method according to claim 3, characterized by, The step (2) is specifically: restriction enzyme BamHI digestion or KOD one DNA polymerase PCR linearization amplification is used to obtain the linearized PVAX1-TelRL-G-CpG fragment; The step (3) is specifically as follows: linear closed end DNA containing only the essential elements of the antigen expression unit expressing G protein is obtained through telomerase TelN enzyme digestion incubation, and is named as DbDNA-G-CpG, and two redundant linear open loop fragments are obtained; The step (4) is specifically as follows: the linear open loop fragments are specifically digested by T5 exonuclease, only DbDNA-G-CpG is reserved, and the pure DbDNA-G-CpG is obtained through alcohol precipitation recovery step.

Images