LeMAN2 gene and effect of LeMAN2 gene in improvement of salt-tolerant breeding of tomatoes

Abstract

The invention belongs to the technical field of gene engineering, and provides a LeMAN2 gene and an effect of the LeMAN2 gene in improvement of salt-tolerant breeding of tomatoes. The cDNA (complementary deoxyribonucleic acid) sequence of the LeMAN2 is as shown in SEQ ID NO. 1. The invention discovers that the tolerance of tomatoes under salt stress is improved by overexpression of the LeMAN2 gene. The cell damage degree of the LeMAN2 overexpression plant under the stress treatment condition of 100mmol / L NaCl is lower than that of the wild type (WT), and the emphasized expression is that the respiratory action intensity, the chlorophyll content and the activity of antioxidant enzymes (SOD, POD and CAT) are higher than those of the wild type plant; on the contrary, knockout of LeMAN2 reduces salt resistance of tomato plants. The results show that the overexpression of the LeMAN2 is beneficial to enhancing the salt adaptability of tomato plants, and the LeMAN2 is an important gene resource which can be utilized for developing salt-resistant biological breeding of tomatoes.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to the role of LeMAN2 gene in improving salt tolerance breeding of tomatoes. Background Art

[0002] Tomato (Lycopersicon esculentum M.), as an important dicotyledonous member of the Solanaceae family, is the second largest vegetable crop in the world, accounting for about 15% of the total vegetable production, and plays a pivotal role in agricultural production. However, tomatoes have poor stress resistance, especially in saline-alkali soils where their growth will be significantly inhibited (Wang Limin, Huang Dongfeng, Lin Qiong, et al. Research Progress on Salt Resistance of Tomato Crops [J]. Journal of Fujian Agricultural Sciences, 2015, 30(10): 1019-1026). In recent years, extreme weather events caused by climate change have occurred frequently, especially the increasingly severe problem of salt stress, which has brought unprecedented challenges to the global tomato planting industry. As one of the countries with extensive saline-alkali land and the most serious damage, China urgently needs to cultivate new varieties with strong salt resistance by exploring and utilizing the salt-resistant gene resources of tomatoes themselves to cope with this environmental pressure.

[0003] Therefore, how to improve the salt tolerance of plants is a key issue that needs to be solved urgently. Summary of the invention

[0004] The purpose of the present invention is to overcome the defects of the prior art and provide the LeMAN2 gene and its role in improving tomato salt tolerance breeding. The overexpression of the LeMAN2 gene can improve the salt tolerance of tomatoes and help accelerate the breeding process of tomato salt-resistant organisms.

[0005] To achieve the above object, the present invention is achieved as follows:

[0006] In the first aspect of the present invention, a gene LeMAN2 is provided, and the cDNA sequence of the gene LeMAN2 is shown as SEQ ID NO.1.

[0007] Furthermore, the gene LeMAN2 has a nucleotide sequence with salt tolerance and more than 90% homology generated by adding, replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 1. The adding of one or more nucleotides includes adding a tag sequence.

[0008] In the second aspect of the present invention, a protein encoded by the gene LeMAN2 is provided, wherein the protein has an amino acid sequence as shown in SEQ ID NO: 2 or a derivative protein obtained by modifying the amino acid sequence as shown in SEQ ID NO. 4 by one or more amino acid residues, having at least 95% homology and having salt tolerance.

[0009] Specifically, a tag sequence can be added to the amino acid sequence shown in SEQ ID NO.2.

[0010] In order to facilitate the study and utilization of the LeMAN2 protein in (1), a tag as shown in Table 1 can be connected to the amino terminus of the protein sequence.

[0011] Table 1. Tags and their amino acid sequences

[0012] Label Residue sequence Poly-His 6 HHHHHH FLAG 8 DYKDDDDK c-myc 10 EQKLISEEDL

[0013] The derived protein can be directly synthesized or obtained by transcription and translation of its base sequence. The coding gene of LeMAN2 can be obtained by deleting or adding one or more amino acid residue codons to the sequence shown in SEQ ID NO.2, and / or performing missense mutation of one or more base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5' end and / or 3' end.

[0014] In the third aspect of the present invention, an expression vector for expressing the protein encoded by the gene LeMAN2 is provided.

[0015] In a fourth aspect of the present invention, a method for constructing an expression vector of gene LeMAN2 is provided, the method comprising:

[0016] The gene LeMAN2 is cloned into an expression vector to obtain an expression vector of the gene LeMAN2.

[0017] In the fifth aspect of the present invention, a transformant of the expression vector is provided.

[0018] In some embodiments, the transformant is Agrobacterium tumefaciens, and / or a plant cell (or organism); the organism is a transgenic drought-resistant plant, which is one of tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0019] In the sixth aspect of the present invention, provided is the use of the gene LeMAN2, the expression vector, the expression vector prepared by the method, or the transformant in improving the salt tolerance of plants.

[0020] The plant is selected from at least one of tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0021] As a specific implementation manner, the plant described in the embodiment of the present invention is a plant of the genus Tomato of the Solanaceae family, and the plant is a wild-type tomato Micro-Tom.

[0022] In the seventh aspect of the present invention, a method for improving plant salt tolerance is provided, wherein the expression vector mediates plant genetic transformation by means of genetic engineering means, and the obtained transgenic plants thus improve plant salt tolerance.

[0023] In the eighth aspect of the present invention, a method for detecting transgenic plants of the tomato gene LeMAN2 is provided, wherein primers with sequences such as SEQ ID NO.3 and SEQ ID NO.4 are used for PCR. If a 787 bp fragment is amplified by PCR, it indicates that the plant is transgenic-positive. If this fragment is not amplified, it indicates that the plant is transgenic-negative.

[0024] The present invention has the following beneficial effects:

[0025] 1. After the cloned LeMAN2 gene of the present invention is overexpressed, the salt tolerance of tomatoes is enhanced, indicating that the LeMAN2 gene is strong in improving the salt tolerance of tomatoes. Therefore, overexpression of the LeMAN2 gene through genetic engineering technology can improve the salt tolerance of tomato plants. At the same time, plant variety improvement can be carried out by combining gene editing technology and molecular breeding.

[0026] 2. The successful expression of the LeMAN2 gene further confirmed the important role of the MAN family in the process of salt stress resistance, which is of great significance for clarifying the biological functions of the MAN family. It also has a great promoting effect on further understanding of MAN family genes in other plants.

[0027] 3. Although some genes that improve plant stress resistance have been cloned, the molecular mechanism of plant stress resistance is still unclear. The LeMAN2 gene cloned in the present invention can improve the salt tolerance of tomato plants and has a great role in determining the key factors of plant stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a diagram for the construction of the LeMAN2 gene overexpression vector;

[0029] Figure 2 This is the sequencing result of LeMAN2 gene mutant;

[0030] Figure 3 The PCR identification results and expression level detection of LeMAN2-OE transgenic materials; Figure A is the PCR identification results of LeMAN-OE transgenic materials, and Figure B is the expression level detection, M: DL2000; 1-8: LeMAN2 overexpression regeneration seedling number; +: positive control; -: blank control;

[0031] Figure 4 This is a comparison of the growth status of different transgenic materials under salt stress.

[0032] Figure 5 Comparison of physiological indicators of WT, LeMAN2-CR, and LeMAN2-OE after salt stress; Figure A shows the results of MDA content detection; Figure B shows the detection of POD enzyme activity; Figure C shows the detection of CAT enzyme activity; Figure D shows the detection of SOD enzyme activity; Figure E shows the detection of chlorophyll content; Figure F shows the comparison of respiratory rates of different genotypes of tomatoes 7 days after salt stress; Figure G shows the results of NBT staining of tomato leaves of different genotypes. The data are the average of three repeated results, and the significant difference analysis represents the comparison between different transgenic plants and the wild type. *P<0.05; **P<0.01; ***P<0.001.

[0033] Figure 6 This is a map of the PV58-K vector. DETAILED DESCRIPTION

[0034] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0035] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0036] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0037] The technical solution of the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0038] 1. The applicant discovered a gene with differential expression in wild-type tomatoes and named it LeMAN2.

[0039] 2. Overexpression of LeMAN2 gene

[0040] The LeMAN2 gene sequence was amplified by PCR technology and connected to the plant binary expression vector pCAMBIA1301. The overexpression vector was introduced into wild-type tomatoes using the genetic transformation method mediated by Agrobacterium GV3101. Finally, overexpression tissue culture seedlings were obtained and planted in the field. The primer pair of SEQ ID NO.3 and SEQ ID NO.4 was used to amplify a 787 bp amplification fragment, indicating that it was a transgenic positive plant. The results are as follows: Figure 3, the positive plants were harvested and planted until homozygous plants were identified in the T2 generation.

[0041] 3. Verify the function of LeMAN2 gene

[0042] CRISPR-P2.0 software was used to design sgRNA, and after selecting the target fragment, Primer5.0 software was used to design primers for the known target sequence. The primers were named Le401-CAS9 F / R. The CRISPR vector was cut with endonuclease BsmHI, connected with T4 ligase, and transferred to Escherichia coli DH5α for vector identification. The successfully constructed LeMAN2 knockout vector was transferred into tomato through Agrobacterium-mediated method, and the transgenic plant DNA was extracted and PCR amplified. The homozygous transformants were screened for additional generation reproduction in preparation for subsequent experiments.

[0043] The present invention is described in detail below with reference to the embodiments.

[0044] Unless otherwise specified, the technical means used are conventional means familiar to those skilled in the art; the experimental methods used are all conventional methods and can be carried out according to the described recombinant technology (see Molecular Cloning, a Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained from commercial channels.

[0045] [Example 1] Construction of LeMAN2 gene overexpression plants

[0046] Total RNA was extracted from young tomato leaves and reverse transcribed into cDNA using:

[0047] Primer F1: AGAGGGGAGACAGTGGAAC (SEQ ID NO. 5)

[0048] Primer R1: CATTCAGACAAAAGCGTAC (SEQ ID NO.6)

[0049] After the cDNA fragment of the LeMAN2 gene was amplified by PCR, it was inserted between the Kpn I and Sal I restriction sites of the pCAMBIA1301 vector (purchased from Wuhan Transduction Biotechnology Development Co., Ltd., catalog number: pSN1301) to construct the LeMAN2 gene overexpression vector LeMAN2-pCAMBIA1301. The overexpression vector was introduced into the wild-type tomato Micr-Tom using the Agrobacterium GV3101-mediated genetic transformation method.

[0050] Agrobacterium GV3101-mediated genetic transformation method was used to introduce the overexpression vector into tomato Micr-Tom. All transgenic seedlings were transplanted into pots with soil, watered and fertilized regularly. After the seedlings grew up, the overexpression plants were tested. The primer pairs designed for the test were:

[0051] 35S F: CGTAAGGGATGACGCACAA (SEQ ID NO.3)

[0052] LeMAN2-R:AACCCATGCGTTAAGAGTA(SEQ ID NO.4)

[0053] The positive plants were harvested and planted until homozygous plants were identified in the T2 generation, and then the salt tolerance test of the plants was carried out. [Example 2] Identification of plants with mutant LeMAN2 gene

[0054] 1. This experiment used CRISPR / Cas9 technology to obtain LeMAN2 gene knockout regeneration seedlings. According to the mRNA sequence of LeMAN2 and the corresponding genome sequence information, two CRISPR target sites were designed, and target site PCR amplification primers were designed according to the target sites. PCR was performed to amplify the fragment containing the target site and cloned into the PV58-K vector (purchased from Wuhan Tianwen Biotechnology Co., Ltd., the map is shown in Figure 6 The final CRISPR expression vector was formed by electroporation of the constructed CRISPR vector into Escherichia coli DH5α, and positive clones were screened by colony PCR. The primer pair for target site PCR amplification is:

[0055] Table 2 Target site sequences

[0056]

[0057] DNA was extracted from young plant tissue leaves, and the full-length DNA sequence of the LeMAN2 gene was amplified using PCR technology and base sequencing was performed. The sequencing results showed that the three plants achieved gene editing in the target region and were determined to be LeMAN2 gene positive mutant strains. The primer pairs designed for detection are:

[0058] LeMAN2-Fn:ATGGCTTATTTTCAAAGAC(SEQ ID NO.9)

[0059] LeMAN2-Rn: CTAAATCTTAACCAAATGAGCC (SEQ ID NO. 10).

[0060] [Example 3] Detection of LeMAN2 gene expression efficiency

[0061] Total RNA was extracted from transgenic tomato seedling tissues and reverse transcribed into cDNA. Tomato β-actin was selected as the internal reference gene to design specific primers for LeMAN2 fluorescence quantitative PCR. Real-time fluorescence quantitative PCR was performed according to the instructions of the ChamQUniversal SYBR qPCR Master Mix kit with ROX. The qRT-PCR reaction parameters are shown in Table 1. The data were obtained using 2 -ΔΔCt Method for analysis.

[0062] The results are as follows Figure 4 As shown, compared with the wild type, the expression level of LeMAN2 in the LeMAN2-OE overexpressing plant was significantly upregulated, indicating that the LeMAN2 gene was successfully overexpressed in tomato seedlings, which can be used to further explore the function of the LeMAN2 gene. [Example 4] Identification of transgenic plants and mutant plants for salt stress resistance

[0063] 1. Tomato seedlings in the "five leaves and one heart" period were used as materials for salt stress (100mmoL / LNaCl) treatment for two consecutive weeks. During this period, the phenotypic growth of different genotype strains was observed, and leaves from the same part were collected at 7 days after treatment for various physiological indexes. One-way ANOVA (and nonparametric or mixed) was used for statistical comparison and analysis. "*" represents the degree of significant difference between the data, "*" represents P < 0.05, "**" represents P < 0.01, and "***" represents P < 0.001.

[0064] 2. The accumulation of reactive oxygen is one of the important factors causing plant death under adverse conditions. The antioxidant enzyme system can remove excess reactive oxygen in plants and maintain the balance of reactive oxygen.

[0065] Results from Figure 5 It can be seen that:

[0066] Compared with WT plants, the activities of SOD, POD, and CAT in LeMAN2-CR and LeMAN2-OE plants (LeMAN2 overexpression lines) under salt stress showed significant changes. The activities of SOD, POD, and CAT in LeMAN2-OE plants increased to varying degrees compared with LeMAN2-CR and WT lines.

[0067] The SOD activity was 3.47 times and 3.82 times that of the LeMAN2-CR strain and the WT strain, respectively, while there was no significant change between the LeMAN2-CR strain and the WT strain, but the LeMAN2-CR strain was slightly lower than the WT strain;

[0068] The POD activity was significantly higher than that of the LeMAN2-CR strain and the WT strain, which were 1.33 and 2.04 times higher, respectively, while the activity in the LeMAN2-CR strain was the lowest, which was 1.54 times lower than that of the WT.

[0069] CAT activity increased significantly in the overexpression strain, which was significantly higher than that of LeMAN2-CR and WT strains, 1.58 times and 1.44 times higher, respectively, while there was no significant change in LeMAN2-CR and WT strains.

[0070] 3. Oxidative damage experiment under NaCl stress

[0071] When plants are subjected to abiotic stress, the levels of related physiological indicators will undergo a series of changes, such as malondialdehyde (MDA) content, chlorophyll content, respiration rate and reactive oxygen content. MDA can be used to determine the degree of cytoplasmic membrane peroxidation in plants, and the oxidative damage of LeMAN2-CR and LeMAN2-OE tomato plants under 100mmol / L NaCl stress was analyzed and compared.

[0072] The results showed that on the 7th day under 100 mmol / L NaCl stress, the MDA contents in LeMAN2-CR, LeMAN2-OE and WT plants were 39.24 μg / g, 6.2 μg / g and 16.69 μg / g, respectively. It can be seen that the MDA content in LeMAN2-OE plants was significantly lower than that in LeMAN2-CR plants and WT plants, while the MDA content in LeMAN2-CR plants was the highest, which was 6.33 times and 2.35 times higher than that of LeMAN2-OE and WT, respectively.

[0073] Chlorophyll is a key pigment for photosynthesis in plants. Therefore, the chlorophyll content of each strain was measured on the 7th day after stress. The results showed that the chlorophyll content of LeMAN2-OE was significantly higher than that of WT and LeMAN2-CR strains, while the chlorophyll content of LeMAN2-CR strain was the lowest. In addition, the changes in the respiration rate of each strain were compared. The results showed that the respiration rates of LeMAN2-CR, WT, and LeMAN2-OE were 297.45 μmol g -1 min -1 , 225.49 μmol g -1 min -1 , 509.70 μmol g -1 min -1 , among which the respiratory rates of LeMAN2-CR and WT were significantly lower than those of LeMAN2-OE, there was no significant change between WT and LeMAN2-CR, but WT was slightly higher than LeMAN2-CR.

[0074] The accumulation of reactive oxygen species is an important factor affecting plant growth and development under environmental stress. Therefore, we performed reactive oxygen staining on different plants after stress treatment. The results showed that after stress treatment, the superoxide ions of the transgenic LeMAN2-OE strain were significantly reduced compared with the wild-type tomato, and the LeMAN2-CR strain had the most active superoxide. This indicates that LeMAN2 can reduce the accumulation of superoxide by increasing the activity of antioxidant enzymes, thereby reducing damage to plants. The above results show that overexpression of the LeMAN2 gene helps to enhance the salt resistance of tomato plants.

[0075] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0076] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0077] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A gene LeMAN2, characterized in that The cDNA sequence of the gene LeMAN2 is shown as SEQ ID NO.

1.

2. A gene LeMAN2 according to claim 1, characterized in that The gene LeMAN2 has a nucleotide sequence with salt tolerance and a homology of more than 90% generated by adding, replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO:

1.

3. A protein encoded by the gene LeMAN2 according to claim 1, characterized in that: The protein has an amino acid sequence as shown in SEQ ID NO: 2, or a derivative protein obtained by modifying the amino acid sequence shown in SEQ ID NO. 2 by one or more amino acid residues, which has at least 95% homology and salt resistance.

4. An expression vector for expressing the protein encoded by the gene LeMAN2 according to claim 2.

5. A method for constructing an expression vector of gene LeMAN2, characterized in that: The method comprises: The gene LeMAN2 according to claim 1 is cloned into an expression vector to obtain an expression vector of the gene LeMAN2.

6. A transformant comprising the expression vector according to claim 4 or the expression vector prepared by the method according to claim 5.

7. Use of the gene LeMAN2 according to any one of claims 1-2, or the protein according to claim 3, or the expression vector according to claim 4, or the expression vector prepared by the method according to claim 5, or the transformant according to claim 6 in improving the salt tolerance of plants.

8. The use according to claim 7, characterized in that The plant comprises one of rice, corn and tomato.

9. A method for improving the salt tolerance of plants, characterized in that: The expression vector according to claim 4 or the expression vector prepared by the method according to claim 5 is used to mediate plant genetic transformation by genetic engineering means to obtain transgenic plants, thereby improving the plant's salt tolerance.

10. A method for detecting transgenic plants of tomato gene LeMAN2, characterized by: PCR was performed using primers with sequences as shown in SEQ ID NO.5 and SEQ ID NO.

6. If a 787 bp fragment was amplified by PCR, it indicated that the plant was transgenic-positive; if this fragment was not amplified, it indicated that the plant was transgenic-negative.

Images