Rapid detection kit for bursaphelenchus xylophilus and method and application thereof

Abstract

The invention provides a rapid detection kit for bursaphelenchus xylophilus and a method and application thereof.The detection kit comprises a fluorescent RAA dry powder reagent premixed with primer probes, the primer probes for rapidly detecting the bursaphelenchus xylophilus based on RAA are designed and screened, and a primer and probe set for specifically amplifying the ITS gene of the bursaphelenchus xylophilus is obtained; no cross reaction with the bursaphelenchus mucronatus is caused; meanwhile, the kit comprises a lysis solution for rapidly extracting the DNA of the pine wood nematode suspension, and the lysis solution contains quaternary ammonium salt, isopropanol and DMSO, so that the DNA extraction quality and efficiency are remarkably improved. The bursaphelenchus xylophilus detection kit provided by the invention is strong in detection specificity, high in sensitivity, simple to operate and portable, and can rapidly detect bursaphelenchus xylophilus within 30 minutes under field conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular diagnostic biology and relates to a rapid detection kit for pine wood nematodes and a method and application thereof. Background Art

[0002] Pine wilt disease, also known as pine wilt disease, is a devastating forest disease caused by the pine wood nematode (Bursaphelenchus xylophilus) and is the only forest pest in my country that is classified as a Class I hazardous pest. Once a pine tree is infected, the nematodes will multiply rapidly, causing the pine leaves to turn from green to yellow and finally to reddish brown, causing the pine tree to dry up and die in as little as 40 days, and entire pine forests to be destroyed in 3-5 years.

[0003] Pine wood nematodes are not directly transmitted, but mainly rely on natural insect vectors and human transmission. Among them, Monochamus alternatus is the most important vector of pine wood nematodes. According to research reports, one pine wood nematode can carry up to 280,000 pine wood nematodes. In late spring and early summer every year, the pine wood nematodes emerge from their shells and fly to healthy pine trees to feed, and the pine wood nematodes carried in their bodies are released. Pine wood nematodes enter the pine tree through the wounds caused by the beetles feeding, and begin to reproduce in large numbers and cause harm. When the larvae of the pine wood nematodes feed and grow in the trunks of pine trees infected with pine wood nematodes, the pine wood nematodes will gather around the larvae of the beetles. As the larvae pupate and emerge as adults, the pine wood nematodes will attach to the body surface or digestive tract of the adult pine wood nematodes and enter their bodies, causing a large-scale infection cycle. The transportation of wood and its products infested with pine wood nematodes is the main human factor in the long-distance spread of pine wood nematodes, for example, the logging of international trade timber is not strictly quarantined and processed, and improper disposal such as installation and packaging of communications and power facilities, and discarding of cable reels.

[0004] The main identification methods for pine wood nematodes are morphological identification and molecular biological identification - GB / T 23476-2009 "Technical Regulations for Quarantine of Pine Wood Nematode Disease". The external symptoms of pine trees are observed with the naked eye to preliminarily determine whether they may be infected with pine nematodes. The needles of pine trees infected with pine nematodes will become wilted, and the color changes from yellow-brown to reddish-brown. The whole tree will dry up and die, as if burned. In general, the cross-section of the dead tree trunk will turn blue, blue-gray, and radiate. In addition, longhorn beetle debris or secondary pests can be seen on the trunk. The microscopic observation method uses the morphological characteristics of pine nematodes to observe that the adult is slender and worm-like. The female is about 0.8-1.3 mm long, and the male is slightly smaller than the female, with a body length of about 0.7-1.1 mm. After being killed by heat, the female generally appears in a large C shape, and the male appears in a J shape, with a body length of about 1 mm. The lip area of ​​the head is high and constricted; the stylet is slender and slightly thickened at the base; the mid-esophageal bulb is oval, accounting for more than 2 / 3 of the body width, and the valve door is clear. The tail of the male adult is pointed and claw-shaped, with a short ovoid copulatory umbrella wrapped at the end, the copulatory spines are large, arched, paired, the beak process is sharp, and there is a clear disc-shaped swelling at the distal end; the tail of the female adult is sub-cylindrical, with a wide and round end, no caudal tip, or a caudal tip at the end, but not more than 2μm, and the vulva is located about three-quarters of the posterior part of the insect body, covered by a backward-extending, wide vulval cover. Molecular biological methods mainly include fluorescent quantitative PCR and DNA barcoding technology. The fluorescent quantitative PCR method uses the conserved region specific to pine wood nematodes to design primers and probes, and is not affected by the age of pine wood nematodes. It can identify pine wood nematode larvae without cultivation, which is very helpful for identifying pine wood nematodes or pseudo-pine wood nematodes and larvae with less typical morphological characteristics, and can detect extremely small amounts of species DNA content; DNA barcode technology: by sequencing specific gene fragments of pine wood nematodes, obtaining their DNA barcodes, and then comparing them with known pine wood nematode DNA barcodes to determine their species. This method has high accuracy, but requires professional sequencing equipment and technicians.

[0005] Patent document CN117660666A discloses a specific primer probe set, a kit and its application for detecting pine wood nematodes, and provides a specific primer probe set for detecting pine wood nematodes based on RAA technology. However, the application uses agarose gel electrophoresis results to judge the amplification efficiency of primers in the primer screening process, and the results have large errors. At the same time, the RAA amplification product needs to be combined with lateral flow dipstick assay (LFA) technology to visualize the detection results, which is complicated to operate and has high costs.

[0006] Therefore, providing a method for rapid detection of pine wood nematodes and improving the simplicity of operation and the accuracy of detection results are issues that need to be urgently addressed in the prevention and control of pine wood nematode disease. Summary of the invention

[0007] To solve the above problems, the present invention provides a RAA constant temperature fluorescence detection kit for pine wood nematodes and a method for on-site rapid separation and detection, which can realize extraction (10 minutes) and amplification (20 minutes) of separated nematode fluid for detection within 30 minutes under laboratory conditions; and can realize on-site rapid disposal and detection of suspected diseased trees within 35 minutes under field conditions. It can be used as an auxiliary method for rapid screening of customs import and export quarantine and forestry protection.

[0008] Recombinase Aided Amplification (RAA) is a new in vitro constant temperature nucleic acid amplification technology. This technology relies on a pair of primers with a length of 30-35bp and three enzymes (recombinase, single-strand binding protein and strand displacement polymerase). The reaction is carried out at a constant temperature of 37-42°C for 5-40 minutes to quickly complete the amplification of nucleic acids. However, the specificity and sensitivity of the RAA detection method for pine wood nematodes in the prior art are limited. Therefore, the present invention refers to the sequences of the pine wood nematode Actin gene, cytochrome P450 gene, Hsp70 gene and ITS gene published on GenBank, and conducts screening experiments on primer pairs and probes for specific amplification of these four genes. The results show that all groups of primers and probes of the ITS gene can detect and have good detection effects. The ITS gene as a target gene can specifically amplify the DNA of pine wood nematodes, but will not amplify closely related species such as pseudopine wood nematodes.

[0009] In one aspect, the present invention provides a primer probe set for rapid detection of pine wood nematodes based on RAA, comprising:

[0010] (1) a forward primer having a sequence as shown in SEQ ID NO. 3;

[0011] (2) a reverse primer having a sequence as shown in SEQ ID NO.6;

[0012] (3) A probe having a sequence as shown in SEQ ID NO. 9, wherein the 5' end is modified with a fluorescent group and the 3' end is labeled with a fluorescent quenching group.

[0013] Since different primers have a certain influence on the effect and sensitivity of isothermal amplification, in some embodiments, the present invention designs several sets of primers and probes for the conserved segment of the ITS gene, including forward primer sequences shown in SEQ ID NO.1 to SEQ ID NO.4, reverse primer sequences shown in SEQ ID NO.5 to SEQ ID NO.8, and the probe shown in SEQ ID NO.9. The four sets of primers are combined in pairs and combined with the probe to amplify the ITS gene of pine wood nematode. The results show that after the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.6 are combined with the probe, the replication speed of the amplified target product is faster and the quantity is larger, the amplification reaction efficiency is higher, and the effect is better.

[0014] In some embodiments, the primer pair designed for the Actin gene of pine wood nematode includes the forward primer sequence shown in SEQ ID NO.11 to SEQ ID NO.12, the reverse primer sequence shown in SEQ ID NO.13 to SEQ ID NO.14, and the probe shown in SEQ ID NO.15; the primer pair designed for the cytochrome P450 gene includes the forward primer sequence shown in SEQ ID NO.16 to SEQ ID NO.17, the reverse primer sequence shown in SEQ ID NO.18 to SEQ ID NO.19, and the probe shown in SEQ ID NO.20; the primer pair designed for the Hsp70 gene includes the forward primer sequence shown in SEQ ID NO.21 to SEQ ID NO.22, the reverse primer sequence shown in SEQ ID NO.23 to SEQ ID NO.24, and the probe shown in SEQ ID NO.25.

[0015] In some embodiments, the fluorescent reporter group of the fluorescent probe is selected from one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460, and the fluorescence quenching gene is selected from one of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0016] On the other hand, the present invention provides a kit for rapid detection of pine nematodes based on RAA, comprising the primer probe set, RAA dry powder reagent and lysis solution as described above.

[0017] In some embodiments, the RAA dry powder reagent provided by the present invention includes the following components: 1mmol / L dNTP, 90ng / μL SSB protein, 120ng / μL recA recombinase protein or 30ng / μL Rad51, 30ng / μL Bsu DNA polymerase, 100mmol / L Tricine, 20% PEG, 5mmol / L dithiothreitol, 100ng / μL creatine kinase, Exo nuclease, 2μL forward primer (10μmol), 2μL reverse primer (10μmol), 0.6μL probe (10μmol) and 5% trehalose.

[0018] Furthermore, the RAA-based rapid detection kit for pine wood nematodes also includes a pine wood nematode positive control reference substance and a negative control reference substance.

[0019] The pine wood nematode positive control reference substance is a positive plasmid containing a partial sequence of a gene in the conserved region of pine wood nematodes, and the positive plasmid containing a partial sequence of a gene in the conserved region is shown in SEQ ID NO.26; the pine wood nematode negative control reference substance is DNase-Free Water.

[0020] Furthermore, the lysis solution includes any one or more of quaternary ammonium salt, isopropanol, and DMSO.

[0021] In conventional DNA lysing solution, the lipid bilayer structure of the cell membrane and the nuclear membrane is generally destroyed by the Triton X-100 component, so as to achieve the purpose of lysing cells and releasing DNA; at the same time, substances such as Chelex-100 are used to cause DNA molecules to aggregate and precipitate, so as to facilitate separation from the lysing solution to improve the recovery efficiency of DNA. However, the concentration and quality of DNA extracted by the existing lysing solution component combination are poor, which has a certain impact on the subsequent fluorescence detection results. Therefore, the present invention creatively adds quaternary ammonium salts, isopropanol and DMSO to the existing lysing solution, and compares the test with the existing lysing solution. The results show that after the existing lysing solution is used for treatment, the curve of the RAA amplification reaction peaks later and the fluorescence signal is lower, while after the lysing solution provided by the present invention is used to treat the diseased wood sample, the fluorescence curve of the subsequent detection peaks earlier, the signal intensity is high, and the effect is better. The reason may be that, on the one hand, quaternary ammonium salts are a type of cationic surfactant that can destroy the lipid bilayer structure of the cell membrane and nuclear membrane, thereby effectively lysing the cells and releasing DNA; at the same time, it can denature proteins and reduce the nonspecific binding of proteins to DNA, which is helpful for subsequent purification steps. On the other hand, in the process of DNA precipitation, the addition of isopropanol can help co-precipitate certain small molecule impurities and improve the recovery rate of DNA. At the same time, DMSO can increase the permeability of the lysate, making it easier for the lysis reagent to enter the cell, accelerate the cell lysis process, and help maintain the integrity of DNA. Therefore, adding quaternary ammonium salts, isopropanol and DMSO to the lysate at the same time significantly improves the quality and efficiency of DNA extraction.

[0022] Furthermore, the nucleic acid lysis solution includes polyvinylpyridinium quaternary ammonium salt, DMSO, TritonX-100, isopropanol, Tris-HCl, Chelex-100, PEG8000 and magnesium acetate.

[0023] In some embodiments of the present invention, the lysis solution in the kit was compared and screened, and the test results showed that the lysis solution provided by the present invention can quickly process and extract the pine wood nematode DNA nucleic acid template within 10 minutes, and can quickly detect pine wood nematodes within 30 minutes when combined with the pine wood nematode RAA fluorescent detection reagent, and is suitable for rapid screening of a large number of samples for wood quarantine.

[0024] In another aspect, the present invention provides a method for rapid detection of RAA of pine wood nematode, using the primer probe set or kit as described above for detection.

[0025] Furthermore, the detection method comprises the following steps:

[0026] (1) taking a sample, adding a lysis solution, mixing, and heating for lysis;

[0027] (2) The lysed samples are amplified and detected.

[0028] In some embodiments, the sample in step (1) is added with lysis solution and then heated at 95° C. for 10 min.

[0029] In some embodiments, in step (2), the sample to be tested is analyzed according to the amplification curve of the real-time fluorescence RAA. Under the condition that positive and negative controls are established, if the FAM channel of the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, it is judged as a positive result for pine wood nematodes; when the sample to be tested has no obvious amplification curve and the Ct value is ≥40, it is judged as a negative result for pine wood nematodes; when the FAM channel of the sample to be tested has a fluorescence amplification curve and the Ct value is 35<Ct value<40, it is judged as suspicious, and it is necessary to exclude the inaccurate results caused by laboratory environmental pollution, and then test again. If the result of the sample is still 35<Ct value<40, the negative control is used as the reference standard, and the Ct value of the negative control is detected. If the Ct value of the negative control is ≥40, the sample to be tested is judged as positive.

[0030] In another aspect, the present invention provides use of an ITS gene for preparing a reagent for improving the sensitivity of pine wood nematode detection, wherein the ITS gene has a nucleotide sequence as shown in SEQ ID NO.10.

[0031] In yet another aspect, the present invention provides use of a primer probe set for preparing a reagent for improving the sensitivity of pine wood nematode detection.

[0032] Furthermore, the primer probe set is used to detect the ITS gene of pine wood nematode, and the ITS gene has a nucleotide sequence as shown in SEQ ID NO.10.

[0033] In yet another aspect, the present invention provides a use of a composition for preparing a lysis solution for improving the lysis effect of a pine wood nematode sample, wherein the lysis solution comprises a quaternary ammonium salt, isopropanol and DMSO.

[0034] The present invention has the following beneficial effects:

[0035] (1) The primer probe set provided by the present invention can achieve high sensitivity and high specificity amplification of the pine wood nematode target gene. The entire amplification can be completed in just 30 minutes, and the amplification yield can reach 10 9 -10 10 The detection sensitivity can reach 5 copies / μL, with no cross reaction with pine wood nematode, thus achieving accurate detection of pine wood nematode.

[0036] (2) The kit provided by the present invention has a simple operation method, and the lysis solution therein can quickly process and extract the pine wood nematode DNA nucleic acid template within 10 minutes, significantly improving the extraction efficiency and quality of DNA.

[0037] (3) The method for rapid detection of pine wood nematodes based on RAA provided by the present invention directly determines the amplification result according to the real-time fluorescence data, without the need for electrophoresis detection, and is suitable for POCT on-site detection and on-site detection in remote forests. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Fluorescence amplification curves of primer probes designed for Actin gene, P450 gene and Hsp70 gene when the nucleic acid template of pine wood nematode was used;

[0039] Figure 2 The fluorescence amplification curve of the primer probe designed for the ITS gene when the nucleic acid template of pine wood nematode is used;

[0040] Figure 3 The concentration of pine nematode nucleic acid is 10 4 The fluorescence amplification curve of 4 pairs of RAA primers screening P450 genes at 10 copies / ul;

[0041] Figure 4 The concentration of pine nematode nucleic acid is 10 4 Comparison of fluorescence amplification curves of ITS gene primers in each group at copies / ul;

[0042] Figure 5 This is the fluorescence amplification curve of each group of ITS gene primers when the concentration of pine wood nematode nucleic acid is 10 copies / ul;

[0043] Figure 6 To evaluate the detection sensitivity and specificity of the detection reagent, A represents the sensitivity evaluation of the RAA detection kit; B represents the specificity evaluation of the RAA detection kit; C represents the sensitivity of the RAA detection kit for repeated detection of low-concentration templates;

[0044] Figure 7 The figures are the results of microscopic examination, RAA and PCR examination of the actual samples of cultured pine wood nematodes, wherein A represents the results of microscopic examination of the actual samples of cultured pine wood nematodes; B represents the result of the RAA constant temperature fluorescence detection kit for the actual samples of cultured pine wood nematodes; C represents the result of the RAA constant temperature fluorescence detection kit for the detection of different dilution templates; D represents the result of the qPCR detection kit for the detection of different dilution templates;

[0045] Figure 8 This is the result of using the RAA constant temperature fluorescence detection kit to detect actual samples of pine wood nematodes isolated from infected wood;

[0046] Fig. 9 To verify the amplification effect of different lysis solutions, A represents the RAA amplification curves of the diseased wood samples after being treated with the three lysis solutions; B represents the RAA amplification curves of the diseased wood samples after being treated with the lysis solution ①. DETAILED DESCRIPTION

[0047] In order to make the above-mentioned objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary implementation modes of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0048] Unless otherwise specified, the raw materials used in the examples were purchased commercially.

[0049] Example 1. Design and screening of primer probe sets for constant temperature fluorescence detection of pine wood nematode RAA

[0050] (I) Target gene screening

[0051] The invention refers to the pine wood nematode Actin gene, cytochrome P450 gene, Hsp70 gene and ITS gene sequences published on GenBank, uses DNAMAN 6.0 software to align multiple sequences, selects the conservative segments of each gene, and preliminarily designs primers and fluorescent probes. Among them, we designed forward primers ITS-F1~ITS-F4 (SEQ ID NO.1~4), reverse primers ITS-R1~ITS-R4 (SEQ ID NO.5~8), and probe ITS-P (SEQ ID NO.9) according to the ITS gene; forward primers Actin-F1 (SEQ ID NO.11) and Actin-F2 (SEQ ID NO.12), reverse primers Actin-R1 (SEQ ID NO.13), Actin-R2 (SEQ ID NO.14), and probe Actin-P (SEQ ID NO.15) according to the Actin gene; forward primers P450-F1 (SEQ ID NO.16) and P450-F2 (SEQ ID NO.17), reverse primers P450-R1 (SEQ ID NO.18), P450-R2 (SEQ ID NO.19), and probe P450-P (SEQ ID NO.20) according to the cytochrome P450 gene. ID NO.20); forward primers Hsp70-F1 (SEQ ID NO.21) and Hsp70-F2 (SEQ ID NO.22), reverse primers Hsp70-R1 (SEQ ID NO.23), Hsp70-R2 (SEQ ID NO.24), and probe Hsp70-P (SEQ ID NO.25) were designed according to the Hsp70 gene.

[0052] Since the relationship between B.mucronatus and pine wood nematode is the closest, the two occupy the same ecological niche and have many similar biological characteristics in morphology, living habits, transmission medium, host, etc. However, B.mucronatus is not pathogenic or has weak pathogenicity, so the present invention uses B.mucronatus culture as a sample, and performs specific verification of primer probe sets of each gene by RAA constant temperature fluorescence detection technology to observe whether the target gene is specific to B.mucronatus.

[0053] like Figure 1 and Figure 2 The results showed that the primer probes designed for Actin gene and Hsp70 gene could detect pine wood nematode, while P450 gene and ITS gene could not detect pine wood nematode, indicating that the primer probe set of Actin gene and Hsp70 gene was not specific. Therefore, the primer probe set of P450 gene and ITS gene could specifically detect pine wood nematode.

[0054] Furthermore, the P450 gene and ITS gene sequences were compared using pine wood nematode cultures as samples. 4 The results showed that the detection sensitivity of the designed multiple sets of P450 gene primer probes could not detect or had very poor detection effect at this template concentration ( Figure 3 ), while all primers and probes of ITS gene can detect it and the detection effect is good ( Figure 4 ), so the ITS gene was determined to be the best detection target.

[0055] (II) Screening of primers and probes for amplification of ITS genes

[0056] In order to further screen out the primers with the best amplification efficiency for the ITS gene, the present invention further studied the amplification efficiency of 4 pairs of primers and probe combinations of the ITS gene through experiments. The positive plasmid containing the conservative region sequence of the ITS gene of pine wood nematode was used as a template, and the concentration was 10 4 copies / ul, and perform RAA constant temperature fluorescence detection. The results are shown in Figure 4 .

[0057] like Figure 4 The results show that when the concentration of positive plasmid template is 10 4 When the concentration of positive plasmid template was 10 copies / ul, the fluorescence amplification curves of primer combinations F3 / R1, F3 / R2, and F3 / R3 were the best, with the earliest peak, the highest fluorescence intensity (vertical value), and obvious exponential phase and plateau phase. The present invention further compared the amplification efficiency of these three primer sets under low template concentration, and selected the positive plasmid template concentration of 10 copies / ul for further screening. Figure 5As shown, the fluorescence curve of the F3 / R2 primer combination has a higher rising peak and an earlier peak time, and performs better than F3 / R1 and F3 / R3, indicating that the designed F3 / R2 primer probe combination can amplify the target product at a faster speed and in a larger quantity, and has a higher amplification reaction efficiency, making it a preferred combination.

[0058] Example 2: Establishment of a fluorescence detection method for pine wood nematode RAA and evaluation of the kit effect

[0059] (1) A constant temperature fluorescence detection kit for pine wood nematode RAA

[0060] The present invention provides a pine wood nematode RAA constant temperature fluorescence detection kit, comprising a lysate, a RAA dry powder reagent premixed with primers and probes, a pine wood nematode positive control reference substance and a negative control reference substance, and the components of each reagent are as follows:

[0061] Lysis buffer: 0.1-1 mM polyvinylpyridinium quaternary ammonium salt, 10%-40% DMSO, 0.1%-1% TritonX-100, 10%-30% isopropanol, 10-50 mM Tris-HCl, 5%-30% Chelex-100, 5% PEG8000, 14 mM magnesium acetate.

[0062] RAA dry powder reagent for premixing primers and probes: 1mmol / L dNTP, 90ng / μL SSB protein, 120ng / μL recA recombinase protein or 30ng / μL Rad51, 30ng / μL Bsu DNA polymerase, 100mmol / L Tricine, 20% PEG, 5mmol / L dithiothreitol, 100ng / μL creatine kinase, Exo exonuclease, 2μL forward primer (10μmol), 2μL reverse primer (10μmol), 0.6μL probe (10μmol), 5% trehalose (m / v). The forward primer base sequence is shown in SEQ ID No.3, the reverse primer base sequence is shown in SEQ ID No.6, the specific probe base sequence is shown in SEQ ID No.9, the 5′ end of the probe is labeled with a FAM fluorescent reporter group, and the 3′ end is labeled with a BHQ1 fluorescent quencher group.

[0063] Positive control reference: a positive plasmid containing a partial sequence of the conserved region gene of pine wood nematode, the sequence of which is shown in SEQ ID NO.26.

[0064] Negative control reference: DNase-Free Water.

[0065] The method steps for detection using the pine wood nematode RAA constant temperature fluorescence detection kit are as follows:

[0066] 1. Take n lysis tubes, add 0.1g sawdust to each tube for lysis, take n RAA reaction freeze-dried tubes (n = number of samples + 1 positive control + 1 negative control) after lysis, and add 50ul lysis solution, positive control reference and negative reference to each freeze-dried tube.

[0067] 2. Set the reaction program of the constant temperature fluorescence detector or fluorescence quantitative PCR instrument to: 39℃, 1min (1 cycle); 39℃, 30s (40 cycles), and collect the fluorescence signal at the end of each cycle. Use a handheld centrifuge to centrifuge the reaction tube, check for bubbles, and then react immediately.

[0068] 3. Result analysis: Use the real-time fluorescence RAA instrument analysis software to analyze the sample to be tested according to the amplification curve of the real-time fluorescence RAA. Under the condition that the positive control and negative control results are established, if the FAM channel of the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, it is judged as a positive result for pine wood nematodes; when the sample to be tested has no obvious amplification curve and the Ct value is ≥40, it is judged as a negative result for pine wood nematodes; when the FAM channel of the sample to be tested has a fluorescence amplification curve and the Ct value is 35<Ct value<40, it is judged as suspicious, and it is necessary to exclude the inaccurate results caused by laboratory environmental pollution, and then test again. If the sample result is still 35<Ct value<40, use the negative control as the reference standard, and test the Ct value of the negative control. If the Ct value of the negative control is ≥40, the sample to be tested is judged as positive.

[0069] (2) Evaluation of the effect of the constant temperature fluorescence detection method for pine wood nematode RAA

[0070] In order to verify that the kit and detection method provided by the present invention have excellent detection effects, the concentration of pine wood nematode positive plasmid was measured using NanoDrop and diluted to 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 The sensitivity of the kit was evaluated using 8 concentration gradients of 1,200 copies / μL and 5 copies / μL as templates.

[0071] according to Figure 6 A The result shows that from left to right, there are 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3copies / μL, 10 2 The amplification results of the positive reference samples of 10 copies / μL, 10 copies / μL, and 5 copies / μL show that the sensitivity of the RAA fluorescence amplification reagent and detection of the present invention can reach 5 copies / μL, indicating that the RAA constant temperature fluorescence detection kit and detection method of the present invention are highly sensitive to the diagnosis of pine wood nematodes.

[0072] The kit specificity was evaluated using samples of pine wood nematodes and pseudopine wood nematodes and the extracted DNA templates. The results showed that ( Figure 6 B), only the pine wood nematode sample showed an "s"-shaped fluorescence curve amplification, while the negative control (DNase-Free Water) and the single pine wood nematode did not show amplification, indicating that the RAA constant temperature fluorescence detection kit of the present invention can specifically amplify the pine wood nematode ITS target sequence and does not cross-react with other similar nematode species, indicating that the method and kit of the present invention have good specificity and can effectively distinguish between pine wood nematodes and pine wood nematodes.

[0073] Use 10 2 copies / μL, 10 1 The sensitivity of the test kit was repeated using three concentrations of positive reference samples: copies / μL and 5 copies / μL. Figure 6 C, 10 2 The three low-concentration positive reference samples of copies / μL, 10 copies / μL, and 5 copies / μL were stably detected in repeated tests, and the CV was less than 5%, indicating that the method and the kit of the present invention have good repeatability.

[0074] Example 3: Detection of actual pine wood nematode samples by using the pine wood nematode RAA constant temperature fluorescence kit

[0075] In order to verify that the primer probe set and reagent provided by the present invention can be used normally in actual sample detection, the actual situation is simulated, and the RAA constant temperature fluorescence kit provided in Example 2 is used to detect actual pine wood nematode samples and diseased wood samples, and compared with the real-time fluorescence quantitative PCR results. If the test results are consistent with the known PCR test results, the compliance rate is 100%. The pine wood nematode samples are from the College of Forestry and Biotechnology of Zhejiang Agriculture and Forestry University, and the diseased wood samples are from the diseased wood pest control plant in Yuqian Town, Lin'an District, Zhejiang Province.

[0076] (1) Testing of actual samples of pine wood nematode suspension

[0077] 1. Prepare potato dextrose agar (PDA) plates, inoculate Botrytis cinerea with a cork borer, and culture at 25°C for 5 to 7 days.

[0078] 2. After the PDA plate is covered with white mycelium, inoculate the pine wood nematode sample on the Botrytis cinerea plate and culture it at 25°C for 4 to 7 days.

[0079] 3. After the PDA Botrytis cinerea is eaten by pine wood nematodes, the color of the plate turns brown. Use PBS to rinse the cover of the culture plate, collect the pine wood nematode suspension, observe it under a microscope, and centrifuge it at 1,0000 rpm for 2 minutes to remove the supernatant.

[0080] 4. Use the lysis solution in the RAA constant temperature fluorescence kit to extract nucleic acid from the collected pine wood nematodes.

[0081] 5. Finally, 50ul to 100ul of pine wood nematode DNA nucleic acid was obtained for RAA and qPCR detection.

[0082] Depend on Figure 7 As shown in A and 7B, the established pine wood nematode RAA constant temperature fluorescence kit successfully detected pine wood nematode samples cultured on laboratory plates, and the morphology was verified by microscopic examination. The extracted DNA nucleic acid sample was diluted 6 times with TE buffer 10 times, and 10 3 , 10 4 , 10 5 , 10 6 The samples diluted by 100 times were tested by RAA and qPCR respectively, and the qPCR reagent used was Nanjing Shengxing Pine Wood Nematode Detection Kit. Figure 7 C and 7D show that the RAA and qPCR methods are different from 10 6 The pine wood nematode RAA constant temperature fluorescence kit provided by the present invention has good detection sensitivity, which is consistent with the results of the PCR detection method. However, since the PCR detection technology requires 60 minutes, but the RAA constant temperature fluorescence detection is reduced to 20 minutes, the requirements for detection equipment, personnel, and environment are greatly reduced, which has obvious advantages.

[0083] (2) Testing of actual samples of diseased trees

[0084] 1. Take samples from multiple points on suspected diseased trees, and select samples near the invading holes of dead diseased trees. Use an electric drill to drill out wood chips and number them in sequence.

[0085] 2. Use the Baermann funnel method to separate suspected diseased trees or vector insects. After soaking for 24 hours, open the water stop clamp and collect 15 ml of the soaking liquid for microscopic examination or as a sample for inspection.

[0086] 3. After high-speed centrifugation at 10,000 rpm for 5 minutes, remove the supernatant and use the lysis buffer in the RAA constant temperature fluorescence kit to extract the DNA nucleic acid template and perform the RAA fluorescence reaction.

[0087] Depend on Figure 8 As shown, after the infected wood was separated and nucleic acid was extracted by the Baermann funnel method, the pine wood nematode RAA constant temperature fluorescence kit provided by the present invention successfully detected 4 actual samples of infected wood.

[0088] Example 4: Screening and Optimization of Pine Wood Nematode DNA Lysis Solution

[0089] In the RAA fluorescence detection process, in addition to the primers for amplifying the target gene, which mainly affect the amplification efficiency and specificity of the target product, the concentration and quality of the extracted pine wood nematode nucleic acid template will also significantly affect the subsequent fluorescence detection results. The nucleic acid extracted by the DNA extraction solution used in the prior art is of low quality and limited concentration, resulting in unsatisfactory subsequent detection results. Therefore, the present invention further screened and studied the lysate components for extracting pine wood nematode DNA, and compared and analyzed the amplification results of pine wood nematode DNA extracted by the nine lysates shown in Table 1 for RAA detection. Using 0.2 g of diseased wood sawdust as the sample, the other extraction, detection steps and result analysis were basically the same as in Example 2. The three repeated Ct values ​​of the amplification reaction are shown in Table 2, where the fluorescence amplification curves of lysate ①, ②, and ③ are shown in Table 2. Fig. 9 A.

[0090] Table 1 Rapid lysis solution formulation system

[0091]

[0092]

[0093] Table 2 Ct values ​​of different lysates used for RAA amplification reaction

[0094] formula Ct value 1 Ct value 2 Ct value 3 Lysis solution① 5.3 5.7 6.2 Lysis buffer② 9.5 9.1 10.2 Lysis buffer ③ 24.2 26.3 15.8 Lysis buffer ④ 22.5 22.9 21.8 Lysis solution⑤ 21.7 22.0 22.2 Lysis buffer ⑥ 18.8 23.6 18.4 Lysis buffer ⑦ 20.3 18.9 17.9 Lysis buffer⑧ 22.7 22.5 21.8 Lysis buffer ⑨ 15.4 15.8 14.6

[0095] As shown in Table 2 and Fig. 9 As shown in A, among the 9 lysates, lysate ① has the smallest Ct value and good repeatability, indicating that lysate ① helps to improve the amplification efficiency when used in RAA amplification reaction, and the three repeated fluorescence curves of lysate ① have an early peak and a high signal intensity, while lysate ② and lysate ③ have a late peak and a low fluorescence signal, and the repeatability of the Ct value is poor.

[0096] At the same time, by comparing the lysate ①, ④~⑨, it can be seen that when one or two of the components, polyvinylpyridinium quaternary ammonium salt, isopropanol or DMSO, are missing, the Ct value of the amplification curve increases, and the repeatability is poor; take 4

[0097] Repeat the test with lysis buffer ① for infected wood samples. Fig. 9B shows that 1. the lysate detects stably 4 copies of the actual samples of the diseased wood. The reason may be that the polyvinyl pyridinium quaternary ammonium salt added in the lysate can destroy the lipid bilayer structure of the cell membrane and the nuclear membrane, promote the cracking and release of DNA, and can denature proteins at the same time, reduce the non-specific binding of proteins to DNA; adding isopropanol can help coprecipitate some small molecule impurities, improve the recovery rate of DNA, and DMSO therein can increase the permeability of the lysate, make the lysis reagent more easily enter the cell interior, accelerate the cell lysis process, and can also help to maintain the integrity of DNA. Therefore, only by adding polyvinyl pyridinium quaternary ammonium salt, isopropanol and DMSO in the lysate at the same time (lysate 1.) can the efficiency and quality of extracting DNA be effectively improved. In addition, the lysate provided by the present invention only needs to carry out simple soaking and heating treatment to the diseased wood sawdust, free of separation nucleic acid extraction, and greatly shortens the sample pre-treatment time.

[0098] Although the present invention has been described in detail above with general descriptions and specific embodiments, the above embodiments are exemplary, and the specific features, structures, materials or characteristics described can be combined and combined in any one or more embodiments in a suitable manner, and some modifications or improvements can be made on the basis of the present invention, which is obvious to those skilled in the art. Therefore, these modifications, improvements, substitutions or variations made on the basis of not departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0099] Sequence Listing

[0100] SEQ ID NO.1:

[0101] ITS-F1:CGTCTCGCATTGTTCGCGCAATGTTAGGCA

[0102] SEQ ID NO.2:

[0103] ITS-F2:TGCACGTTGTGACAGTCGTCTCGCATTGTT

[0104] SEQ ID NO.3:

[0105] ITS-F3:CGTTGTGACAGTCGTCTCGCATTGTTCGCGCA

[0106] SEQ ID NO.4:

[0107] ITS-F4: TTTCAAGTTTCTGCACGTTGTGACAGTC

[0108] SEQ ID NO.5:

[0109] ITS-R1:TGAAACAACATCACCAAACGGTTTAGCC

[0110] SEQ ID NO.6:

[0111] ITS-R2:CACGACAATCGAGCACGAAGCCCTCTCG

[0112] SEQ ID NO.7:

[0113] ITS-R3:CAACATCACCAAACGGTTTAGCCGCGCACGA

[0114] SEQ ID NO.8:

[0115] ITS-R4:GTTTAGCCGCGCACGACAATCGAGCACGAA

[0116] SEQ ID NO.9:

[0117] ITS-P:

[0118] TGTTTTACGCGGTTTGTTCCGCGACCAATA[FAM-dT][THF][BHQ-dT]TCTACGCACTGTTTGT-C3

[0119] SEQ ID NO.10:

[0120] ITS:

[0121] AAACTCGAGCAGAACCGCCGACTTGTTTTTTTCAAGTTTCTGCACGTTGTGACAGTC

[0122] GTCTCGCATTGTTCGCGCAATGTTAGGCACCATCTGTTTTACGCGGTTTGTTCCGCGA

[0123] CCAATATCTTCTACGCACTGTTTGTCCGTGCGGGGCGAGAGGGCTTCGTGCTCGATTG

[0124] TCGTGCGCGGCTAAACCGTTTGGTGATGTTGTTTCAACGGCGCGGCCGTCAGGGACG

[0125] TTCGGATGAGAATGTTTGGAGTCCTGGCTGCGGTTTGTTGAGCTTCGTCGTGAAGCCT <h2 style=";text-align:left;direction:ltr">

[0126] <h2 style=";text-align:left;direction:ltr"> TGCGGGCAGTGTTGTCGGAATTGGTTGA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0127] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.11:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0128] <h2 style=";text-align:left;direction:ltr"> Actin-F1:TGAATCTGATTGTGAGCTTATATGACTTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0129] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.12:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0130] <h2 style=";text-align:left;direction:ltr"> Actin-F2:GGAGATGGTAAGTGAATCTGATTGTGAG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0131] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.13:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0132] <h2 style=";text-align:left;direction:ltr"> Actin-R1:GATCTTCATCAAGTAATCGGTCAAGTCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0133] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.14:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0134] <h2 style=";text-align:left;direction:ltr"> Actin-R2: GTAATCGGTCAAGTCACGGCCAGCCAAGTCG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0135] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.15:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0136] <h2 style=";text-align:left;direction:ltr"> Actin-P:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0137] <h2 style=";text-align:left;direction:ltr"> CACACCGTCCCCATCTATGAGGGTTACGC[Fam-dT][THF][BHQ-dT]TCCCCACGCCATCC-C3<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0138] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.16:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0139] <h2 style=";text-align:left;direction:ltr"> P450-F1:ACAACAACGAGGAGTACAAGTGTCTGAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0140] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.17:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0141] <h2 style=";text-align:left;direction:ltr"> P450-F2:AGGAGTACAAGTGTCTGATTGATGCGTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0142] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.18:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0143] <h2 style=";text-align:left;direction:ltr"> P450-R1:AGAAGGATGAAGGCGATGGTATGAGATG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0144] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.19:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0145] P450-R2: ATGAGATGTTGTGTCCTGACCGGCAGAGAA

[0146] SEQ ID NO.20:

[0147] P450-P:

[0148] AAATTAAGAACGATGTTAATCCAGCAGTG[FAM-dT][THF][BHQ-dT]AACCGCAAAATG CT-C3

[0149] SEQ ID NO.21:

[0150] Hsp70-F1: TTCAAGAGAAAGCACAAGAAGGATTTGG

[0151] SEQ ID NO.22:

[0152] Hsp70-F2: TTGGCCACCAATCCTCGTGCTCTTCGTCGA

[0153] SEQ ID NO.23:

[0154] Hsp70-R1: CGAATCTAGCACGAGTGATGTTGGTGTAGA

[0155] SEQ ID NO.24:

[0156] Hsp70-R2: CGAGTGATGTTGGTGTAGAAGTCAATTC

[0157] SEQ ID NO.25:

[0158] Hsp70-P:

[0159] TAAGAGAACTCTCTCCAGCTCCACCCAAGC[FAM-dT]A[THF]CA[BHQ-dT]TGAAATCG ACT-C3

[0160] SEQ ID NO.26:

[0161] Positive plasmid:

[0162] GGGTTTCTACGTGCTGTTGTCGAGTTGGCGTTTTACCGTGCCGACAGATGAGACCAG

[0163] CCAGCTGCTTGCCGATTCGTTCTGGCGAGCGTAGGATTGAAAAGCCCGAGAGGCTGC

[0164] CCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAGCTTTAAGTTACTCCGG

[0165] TGGATCACTTGGCTCGCGGGTCGATGAAGAACGCAGTGAATTGCGATAATAAGTACG

[0166] AATTACAGATATTATGAGTACCATGTTTTTGAATGCATATTGCGCTCTTGGGCCTTGCTC

[0167] TTGAGCATATTCGATTCAGGGTGTGTTTTTAAACTCGAGCAGAACCGCCGACTTGTTT

[0168] TTTTCAAGTTTCTGCACGTTGTGACAGTCGTCTCGCATTGTTCGCGCAATGTTAGGCA

[0169] CCATCTGTTTTACGCGGTTTGTTCCGCGACCAATATCTTCTACGCACTGTTTGTCCGTG

[0170] CGGGGCGAGAGGGCTTCGTGCTCGATTGTCGTGCGCGGCTAAACCGTTTGGTGATGT

[0171] TGTTTCAACGGCGCGGCCGTCAGGGACGTTCGGATGAGAATGTTTGGAGTCCTGGCT

[0172] GCGGTTTGTTGAGCTTCGTCGTGAAGCCTTGCGGGCAGTGTTGTCGGAATTGGTTGA

[0173] AACCACCTGAGTTGGGTATGACTACCTGCTGAACTTAAGCATATCA

Claims

1. A primer probe set for rapid detection of pine wood nematodes based on RAA, characterized in that: include: (1) a forward primer having a sequence as shown in SEQ ID NO. 3; (2) a reverse primer having a sequence as shown in SEQ ID NO.6; (3) A probe having a sequence as shown in SEQ ID NO. 9, wherein the 5' end is modified with a fluorescent group and the 3' end is labeled with a fluorescent quenching group.

2. A kit for rapid detection of pine nematodes based on RAA, characterized in that: It comprises the primer probe set as claimed in claim 1, a RAA dry powder reagent and a lysis solution.

3. The kit according to claim 2, characterized in that The lysate includes any one or more of quaternary ammonium salt, isopropanol and DMSO.

4. The kit according to claim 3, characterized in that The nucleic acid lysing solution comprises polyvinylpyridinium quaternary ammonium salt, DMSO, TritonX-100, isopropanol, Tris-HCl, Chelex-100, PEG8000 and magnesium acetate.

5. A method for rapid detection of RAA of pine wood nematodes, characterized in that: The detection is performed using the primer-probe set as claimed in claim 1, or the kit as claimed in any one of claims 2 to 4.

6. The detection method according to claim 5, characterized in that The following steps are involved: (1) taking a sample, adding a lysis solution, mixing, and heating for lysis; (2) The lysed samples are amplified and detected.

7. Use of ITS gene for preparing a reagent for improving the sensitivity of pine wood nematode detection, characterized in that: The ITS gene has a nucleotide sequence as shown in SEQ ID NO.

10.

8. Use of the primer probe set according to claim 1 for preparing a reagent for improving the sensitivity of pine wood nematode detection.

9. The use according to claim 8, characterized in that The primer probe set is used to detect the ITS gene of pine wood nematode, and the ITS gene has a nucleotide sequence as shown in SEQ ID NO.

10.

10. Use of a composition for preparing a lysis solution for improving the lysis effect of pine wood nematode samples, characterized in that: The composition includes a quaternary ammonium salt, isopropyl alcohol and DMSO.

Images