Enzyme recognition site protection method and application thereof, and gene cloning method

Abstract

The embodiment of the invention provides a protection method of an enzyme recognition site, application of the protection method and a gene cloning method, relates to the technical field of molecular biology, and is used for protecting the enzyme recognition site from being recognized and cut by restriction enzyme. The enzyme recognition site protection method comprises the following steps: designing a guide sequence to guide dCas enzyme to cover a to-be-protected enzyme recognition site of a target gene sequence, so that the to-be-protected enzyme recognition site is prevented from being recognized and cut by restriction endonuclease. The protection method of the enzyme recognition site is used for gene cloning.

Description

Technical Field

[0001] The present disclosure relates to the technical field of molecular biology, and in particular to a method for protecting an enzyme recognition site and an application thereof, a gene cloning method and a gene cloning reagent system. Background Art

[0002] In the process of continuous development of medicine and detection technology, people gradually realize that the detection of DNA and RNA is an essential tool and key step to achieve precision medicine. Through the detection and analysis of nucleic acids, researchers can understand the pathogenic mechanism of many genetic diseases, which can be used to distinguish the specific types of cancer and can also be used for the diagnosis of infectious diseases. Summary of the invention

[0003] The purpose of the embodiments of the present disclosure is to provide a method for protecting an enzyme recognition site and its application, a gene cloning method and a gene cloning reagent system, which are used to protect the enzyme recognition site from recognition and cleavage by a restriction endonuclease.

[0004] To achieve the above objectives, the embodiments of the present disclosure provide the following technical solutions:

[0005] On the one hand, a method for protecting an enzyme recognition site is provided, the method comprising: designing a guide sequence to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cutting by a restriction endonuclease.

[0006] In the above-mentioned method for protecting the enzyme recognition site, the target gene sequence combined with the dCas enzyme produces steric hindrance at the enzyme recognition site. When the restriction endonuclease cuts the target gene sequence, the steric hindrance makes it impossible for the restriction endonuclease to complete normal recognition and cutting.

[0007] In some embodiments, the target gene sequence includes: a non-target recognition site of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is referred to as the target recognition site.

[0008] In some embodiments, the target gene sequence comprises: any one of a plasmid and a linear DNA fragment.

[0009] In some embodiments, the guide sequence includes: a single-stranded nucleotide; the single-stranded nucleotide includes: a first fragment and a second fragment connected from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.

[0010] On the other hand, a gene cloning method is provided, which includes: preparing a ribonucleoprotein complex solution, preparing a sample solution, and preparing an enzyme cutting system, and performing enzyme cutting. The ribonucleoprotein complex includes: a dCas enzyme and a guide sequence. The sample includes: a target gene sequence and the ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected of the target gene sequence. The enzyme cutting system includes: a restriction endonuclease and the sample, and under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cutting by the restriction endonuclease.

[0011] In some embodiments, the target gene sequence includes: a non-target recognition site of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is referred to as the target recognition site. In the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.

[0012] The above gene cloning method has the same beneficial technical effects as the enzyme recognition site protection method provided in some of the above embodiments, and will not be described in detail here.

[0013] On the other hand, a gene cloning reagent system is provided, which includes: a ribonucleoprotein complex solution; wherein the ribonucleoprotein complex solution includes: a dCas enzyme solution and a guide sequence solution. In the dCas enzyme solution, the concentration range of the dCas enzyme is 1 μmol / L to 20 μmol / L; the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:10. In the guide sequence solution, the concentration range of the guide sequence is 2 μmol / L to 9 μmol / L; the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:10.

[0014] In some embodiments, the ribonucleoprotein complex solution further comprises: a first buffer solution. The first buffer solution comprises: 1000 mmol / L to 1500 mmol / L NaCl, 400 mmol / L to 600 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value of the first buffer solution ranges from 7.9 to 8.1. The ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.

[0015] In some embodiments, the gene cloning reagent system further comprises: a sample solution. The sample solution comprises: the ribonucleoprotein complex solution and the target gene sequence solution. The ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is in the range of 3:20 to 1:2. The number of copies of the target gene sequence is greater than or equal to 10 3 ; The ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:4.

[0016] In some embodiments, the sample solution further comprises: a second buffer solution. The second buffer solution comprises:

[0017] 1000mmol / L~1500mmol / L NaCl, 400mmol / L~600mmol / L Tris-HCl, 80mmol / L~150mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value range of the second buffer solution is 7.9 to 8.1; the ratio of the volume of the second buffer solution to the volume of the sample solution is in the range of 1:10 to 3:10.

[0018] In some embodiments, the gene cloning reagent system further includes: an enzyme cutting system. The enzyme cutting system includes: the sample solution and a restriction endonuclease solution; the ratio of the volume of the sample solution to the volume of the enzyme cutting system is in the range of 1:10 to 1:2. In the restriction endonuclease solution, the concentration of the restriction endonuclease is in the range of 4U / μL to 20U / μL. The ratio of the volume of the restriction endonuclease solution to the volume of the enzyme cutting system is in the range of 1:20 to 1:10.

[0019] In some embodiments, the enzyme digestion system further comprises: a third buffer solution. The third buffer solution comprises:

[0020] 100mmol / L~330mmol / L Tris-HCl, 80mmol / L~150mmol / L MgCl 2 ,

[0021] 660mmol / L~1000mmol / L KCl, 0.5mg / mL~1.5mg / mL bovine serum albumin; the pH value range of the third buffer solution is 7.9~8.5; the ratio range of the volume of the third buffer solution to the volume of the enzyme cleavage system is 1:10~3:20.

[0022] The above gene cloning reagent system has the same beneficial technical effects as the enzyme recognition site protection methods provided in some of the above embodiments, which will not be described in detail here.

[0023] In another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any one of the above embodiments in plasmid construction.

[0024] In yet another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any of the above embodiments in the construction of a recombinant library.

[0025] In yet another aspect, there is provided an application of the method for protecting the enzyme recognition site as described in any of the above embodiments in the linearization of a plasmid in the RNA pharmaceutical preparation process.

[0026] The application of the above-mentioned enzyme recognition site protection method has the same beneficial technical effects as the enzyme recognition site protection method provided in some of the above-mentioned embodiments, which will not be described in detail here. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the present disclosure, the following briefly introduces the drawings required to be used in some embodiments of the present disclosure. Obviously, the drawings described below are only drawings of some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can also be obtained based on these drawings. In addition, the drawings described below can be regarded as schematic diagrams, and are not limitations on the actual size of the product involved in the embodiments of the present disclosure, the actual process of the method, the actual timing of the signal, etc.

[0028] Figure 1 A structural diagram of a plasmid provided according to some embodiments of the present disclosure;

[0029] Figure 2 A structural diagram of the dCas9 enzyme provided according to some embodiments of the present disclosure;

[0030] Figure 3 A flow chart of a gene cloning method provided according to some embodiments of the present disclosure;

[0031] Figure 4 A structural diagram corresponding to each step of the gene cloning method provided according to some embodiments of the present disclosure;

[0032] Figure 5 The present invention provides a gel electrophoresis diagram according to some embodiments of the present disclosure. DETAILED DESCRIPTION

[0033] The following will be combined with the accompanying drawings to clearly and completely describe the technical solutions in some embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all the embodiments. Based on the embodiments provided by the present disclosure, all other embodiments obtained by ordinary technicians in this field belong to the scope of protection of the present disclosure.

[0034] Unless the context requires otherwise, throughout the specification and claims, the term "comprise" and other forms thereof, such as the third person singular form "comprises" and the present participle form "comprising", are to be interpreted as open, inclusive, that is, "including, but not limited to". In the description of the specification, the terms "one embodiment", "some embodiments", "exemplary embodiments", "example", "specific example" or "some examples" and the like are intended to indicate that specific features, structures, materials or characteristics associated with the embodiment or example are included in at least one embodiment or example of the present disclosure. The schematic representation of the above terms does not necessarily refer to the same embodiment or example. In addition, the specific features, structures, materials or characteristics may be included in any one or more embodiments or examples in any appropriate manner.

[0035] In the following, the terms "first" and "second" are used for descriptive purposes only and are not to be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. In the description of the embodiments of the present disclosure, unless otherwise specified, "plurality" means two or more.

[0036] When describing some embodiments, the expressions "coupled" and "connected" and their derivatives may be used. The term "connected" should be understood in a broad sense. For example, "connection" can be a fixed connection, a detachable connection, or an integral connection; it can be directly connected or indirectly connected through an intermediate medium. The term "coupled" indicates, for example, that two or more components are in direct physical or electrical contact. The term "coupled" or "communicatively coupled" may also refer to two or more components that are not in direct contact with each other, but still cooperate or interact with each other. The embodiments disclosed herein are not necessarily limited to the contents of this document.

[0037] “At least one of A, B, and C” has the same meaning as “at least one of A, B, or C” and both include the following combinations of A, B, and C: A only, B only, C only, the combination of A and B, the combination of A and C, the combination of B and C, and the combination of A, B, and C.

[0038] “A and / or B” includes the following three combinations: A only, B only, and a combination of A and B.

[0039] As used herein, "about," "substantially," or "approximately" includes the stated value and an average value that is within an acceptable range of variation from the particular value as determined by one of ordinary skill in the art taking into account the measurements in question and the errors associated with the measurement of the particular quantity (i.e., the limitations of the measurement system).

[0040] As used herein, "parallel", "perpendicular", and "equal" include the situations described and situations similar to the situations described, and the range of the similar situations is within the acceptable deviation range, wherein the acceptable deviation range is determined by a person of ordinary skill in the art taking into account the measurement in question and the errors associated with the measurement of a particular quantity (i.e., the limitations of the measurement system). For example, "parallel" includes absolute parallelism and approximate parallelism, wherein the acceptable deviation range of approximate parallelism may be, for example, a deviation within 5°; "perpendicular" includes absolute perpendicularity and approximate perpendicularity, wherein the acceptable deviation range of approximate perpendicularity may also be, for example, a deviation within 5°. "Equal" includes absolute equality and approximate equality, wherein the acceptable deviation range of approximate equality may be, for example, the difference between the two equalities is less than or equal to 5% of either one.

[0041] It will be understood that when a layer or an element is referred to as being on another layer or substrate, it can be directly on the other layer or substrate, or intervening layers may be present between the layer or element and the other layer or substrate.

[0042] Exemplary embodiments are described herein with reference to cross-sectional views and / or plan views that are idealized exemplary drawings. In the drawings, the thickness of the layers and the area of ​​the regions are exaggerated for clarity. Therefore, variations in the shapes relative to the drawings due to, for example, manufacturing techniques and / or tolerances are conceivable. Therefore, the exemplary embodiments should not be interpreted as being limited to the shapes of the regions shown herein, but include shape deviations due to, for example, manufacturing. For example, an etched region shown as a rectangle will typically have curved features. Therefore, the regions shown in the drawings are schematic in nature, and their shapes are not intended to illustrate the actual shapes of the regions of the device, and are not intended to limit the scope of the exemplary embodiments.

[0043] In the present application, DNA (deoxyribonucleic acid) is a long-chain polymer, the constituent units of which are four deoxynucleotides, namely: adenine deoxynucleotide (dATP), thymine deoxynucleotide (dTTP), cytosine deoxynucleotide (dCTP), guanine deoxynucleotide (dGTP). Deoxynucleotides are composed of phosphate, deoxyribose and bases; among them, there are four main bases, namely A (adenine), G (guanine), C (cytosine) and T (thymine). Among them, the size unit of DNA fragments is base pairs, and commonly used ones are bp (base pairs), Kbp (kilobase pairs) and Mbp (megabase pairs).

[0044] In this application, RNA (Ribonucleic Acid) is a genetic information carrier present in biological cells and some viruses and viroids. Its main function in the body is to guide protein synthesis. RNA is a macromolecular polymer composed of ribonucleotides, which are composed of phosphate, ribose and bases; among them, there are four main bases, namely A (adenine), G (guanine), C (cytosine) and U (uracil).

[0045] In the present application, a plasmid is a small circular DNA molecule outside the cell chromosome that can replicate autonomously. Plasmids exist in many bacteria, yeast and other organisms.

[0046] In the present application, restriction endonuclease is an endonuclease that hydrolyzes double-stranded DNA at a specific nucleotide sequence. Restriction endonuclease is an endonuclease that can recognize and cut a specific double-stranded DNA sequence in an organism. It is an enzyme that can cut off foreign DNA, that is, it can limit the invasion of heterologous DNA and make it lose its vitality, but it has no damaging effect on its own DNA, so that the original genetic information of the cell can be protected. Since this cutting action is carried out inside the DNA molecule, it is called restriction endonuclease. Restriction endonuclease is generally composed of the first letter of the genus name of the microorganism and the first two letters of the species name, and the fourth letter represents the strain (strain).

[0047] In the present application, the enzyme recognition site (or recognition site) refers to a specific sequence of bases on DNA. The restriction endonuclease can recognize this sequence and cut the DNA sequence into two segments. Usually, different enzymes have different recognition sequences.

[0048] In the process of plasmid construction, restriction endonucleases are usually used to recognize specific nucleotide sequences in double-stranded DNA molecules (i.e., the recognition sites of restriction endonucleases) and cut the phosphodiester bonds in the DNA chains at specific locations to complete the enzyme cleavage step. Figure 1As shown, if there are multiple identical restriction endonuclease recognition sites in a double-stranded DNA molecule 100 (such as a linear DNA fragment or a plasmid), the restriction endonuclease will cut the DNA molecule into multiple fragments, making it impossible to carry out subsequent plasmid construction, or simply forming linearized fragments.

[0049] For example, Figure 1 As shown, the double-stranded DNA molecule 100 is a plasmid formed by the plasmid vector pUC57 and the gene insertion sequence, and the plasmid includes 3388 base pairs. Among them, EcoRV (431) indicates that the sequence of 431 base pairs is GATATC, and GATATC is a recognition site sequence of the restriction endonuclease EcoRV; EcoRV (3353) indicates that the sequence of 3353 base pairs is GATATC, and GATATC is another recognition site sequence of the restriction endonuclease EcoRV. That is, in the plasmid, there are two recognition sites for the restriction endonuclease EcoRV, and the sequence of the recognition site is 5'-GATATC-3'. Among them, the cutting position 110 is located between the base T and the base A from the 5' end to the 3' end in the sequence of the recognition site.

[0050] It should be noted that Figure 1 This is used to illustrate the situation where the double-stranded DNA molecule 100 has two identical restriction endonuclease recognition sites. The recognition sites of other restriction endonucleases in the plasmid and other information of the plasmid are not introduced in detail here.

[0051] In the related art, the above problems can be solved by replacing the restriction endonuclease or the plasmid vector. However, replacing the restriction endonuclease or the plasmid vector has the problems of long replacement cycle and low efficiency, and there is also the problem that the solution of replacing the plasmid vector is difficult to implement.

[0052] Based on this, an embodiment of the present disclosure provides a method for protecting an enzyme recognition site, which includes: designing a guide sequence to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cutting by a restriction endonuclease.

[0053] Exemplarily, the dCas enzyme is a dCas9 (dead Cas9) enzyme. Figure 2 As shown, the dCas9 enzyme is a mutant of the Cas9 protein, and the two nuclease activity regions of the Cas9 protein, RuvC1 and HNH, are mutated at the same time. Therefore, the dCas9 enzyme only retains the ability to enter the genome guided by the guide sequence, but the cleavage activity of the dCas9 enzyme is completely lost, that is, the dCas9 enzyme can enter the genome through the guide sequence, but the dCas9 enzyme will not cut the genome.

[0054] In some examples, the target gene sequence includes a non-target recognition site and at least one target recognition site of the same base sequence, and the enzyme recognition site to be protected is referred to as the target recognition site.

[0055] Exemplarily, the target gene sequence includes: any one of a plasmid and a linear DNA fragment. For example, the linear DNA fragment is a PCR amplification product or a multi-gene fragment connection product. PCR is the abbreviation of polymerase chain reaction (Polymerase Chain Reaction). PCR is a molecular biology technique used to amplify specific DNA fragments, which can be regarded as a special DNA replication outside the body. Its biggest feature is that it can greatly increase trace amounts of DNA.

[0056] For example, the copy number of the target gene sequence is greater than or equal to 10 3 The copy number refers to the number of a gene (which can be a plasmid) in the genome of a certain organism. Here, the copy number refers to the number of base pairs contained in the target gene sequence, that is, the number of base pairs contained in the target gene sequence is greater than or equal to 10. 3 .

[0057] The guide sequence is gRNA (guide RNA). In some examples, the guide sequence includes: a single-stranded nucleotide; the single-stranded nucleotide includes: a first fragment and a second fragment connected in sequence from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.

[0058] The target recognition site of the target gene sequence can be protected from recognition and cutting by the restriction endonuclease because the target gene sequence combined with the dCas enzyme produces steric hindrance at the target recognition site. When the restriction endonuclease cuts the target gene sequence, the steric hindrance makes it impossible for the restriction endonuclease to complete normal recognition and cutting.

[0059] Therefore, the enzyme recognition site protection method provided in the embodiments of the present disclosure can protect the restriction endonuclease recognition site in the target gene sequence. When the target gene sequence has multiple restriction endonuclease recognition sites, non-target DNA cutting can be avoided, reducing the technical difficulty caused by too many restriction endonuclease recognition sites.

[0060] In some examples, the first fragment of the guide sequence is paired with a base sequence near the target recognition site of the target gene sequence, so that the dCas enzyme bound to the second fragment binds to the vicinity of the target recognition site, covering the target recognition site of the target gene sequence, and generating steric hindrance at the target recognition site. When the restriction endonuclease cuts the target gene sequence, the steric hindrance prevents the restriction endonuclease from completing normal recognition and cutting, thereby achieving the purpose of protecting the enzyme recognition site.

[0061] It should be noted that after the first fragment is combined with the target gene sequence, the sequence in the target gene sequence that is combined with the first fragment is called the binding sequence. Among them, in the above-mentioned "pairing of the first fragment of the guide sequence with the base sequence near the target recognition site of the target gene sequence", "near" means that after the first fragment is combined with the target gene sequence, the binding sequence includes the target recognition site, or the number of bases between the target recognition site and the binding sequence is less than or equal to 15. This can ensure that the dCas enzyme covers the target recognition site of the target gene sequence, and generates steric hindrance at the target recognition site, so that the restriction endonuclease cannot complete normal recognition and cutting.

[0062] For example, the number of bases between the target recognition site and the binding sequence is 1, 2, 4, 5, 8, 10, 11, 13 or 15, etc., which is not limited here.

[0063] Exemplarily, the first fragment is a 20-base sequence. The 20-base sequence binds to the target gene sequence through the base complementary pairing principle, guides the dCas enzyme bound to the second fragment to the target recognition site and covers the target recognition site, and the dCas enzyme generates steric hindrance at the target recognition site to prevent the target recognition site of the target gene sequence from being recognized and cut by the restriction endonuclease.

[0064] And in the target gene sequence, the downstream of the sequence that binds to the first fragment must be an NGG sequence, where N is any one of A (adenine), G (guanine), C (cytosine) and T (thymine). Moreover, the first fragment should match the target gene sequence to avoid complex secondary structures. In biochemistry and structural biology, secondary structure refers to the three-dimensional general formula of a local segment of a biological macromolecule, such as protein and nucleic acid (DNA or RNA).

[0065] The second fragment is used to bind to the dCas enzyme. When the dCas enzyme is dCas9 enzyme, the second fragment is a fixed base sequence. The sequence of the second fragment is: 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'.

[0066] In some examples, in the first segment of the guide sequence, the ratio of the sum of the number of guanine and cytosine to the number of bases in the first segment is greater than or equal to 30% and less than or equal to 70%.

[0067] Illustratively, in the first segment of the guide sequence, the ratio of the sum of the numbers of guanine (G) and cytosine (C) to the number of bases in the first segment is 30%, 40%, 50%, 60% or 70%, etc., which is not limited here.

[0068] Since three hydrogen bonds are formed between guanine (G) and cytosine (C), the pairing combination of guanine (G) and cytosine (C) is relatively stable. Therefore, by setting the ratio of the sum of the number of guanine and cytosine to the number of bases in the first fragment to be greater than or equal to 30%, the stability of the binding of the first fragment to the target gene sequence can be ensured. In addition, by setting the ratio of the sum of the number of guanine and cytosine to the number of bases in the first fragment to be less than or equal to 70%, it is convenient to subsequently release the binding between the guide sequence and the target gene sequence. Regarding the step of releasing the binding between the guide sequence and the target gene sequence, the embodiments of the present disclosure are not described in detail.

[0069] Exemplarily, the guide sequence includes: 5'-AGGAUAUCUUCAGGUAGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AGGAUAUCUUCAGGUAGUCC is the first fragment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second fragment.

[0070] For example, in a gene sequence of a plasmid, there is a recognition site for the restriction endonuclease EcoRV, the sequence of which is 5'-GATATC-3', and the recognition site is a target recognition site that needs to be avoided from being recognized and cut by the restriction endonuclease EcoRV, and the first fragment of the guide sequence AGGAUAUCUUCAGGUAGUC binds to the base sequence near the target recognition site. Thus, the dCas enzyme bound to the second fragment GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU is guided to bind to the vicinity of the target recognition site, covering the target recognition site, and generating steric hindrance at the target recognition site, which makes it impossible for the restriction endonuclease EcoRV to recognize the recognition site and complete normal cutting, thereby playing a role in protecting the enzyme recognition site.

[0071] Exemplarily, the restriction endonuclease includes any one of a type I restriction endonuclease, a type II restriction endonuclease, and a type III restriction endonuclease.

[0072] Among them, type I restriction endonuclease is a complex multi-subunit enzyme with both restriction and methylase activity. Type I restriction endonuclease was first discovered in Escherichia coli strains. Type II restriction endonucleases can specifically recognize rotationally symmetrical (also known as palindromic) nucleic acid sequences of tetranucleotides or hexanucleotides, and endonuclease the phosphodiester bonds in the DNA double helix at specific nucleotides in the recognition region to produce defined restriction fragments and gel bands. Type III restriction endonucleases can recognize two independent non-palindromic sequences, which are in reverse order. In addition, it cuts DNA about 20bp to 30bp downstream of the recognition site. Typically, type III restriction endonucleases are heterodimers with two different subunits.

[0073] For example, the restriction endonuclease is any one of BamHI, KpnI, EcoRI, HindIII, NdeI and XhoI.

[0074] The enzyme recognition site protection method provided in the embodiments of the present disclosure can be applied in plasmid construction. By protecting the restriction endonuclease recognition site from being recognized and cut by the restriction endonuclease, the technical difficulty caused by too many restriction endonuclease recognition sites can be reduced.

[0075] The protection method of the enzyme recognition site provided by the embodiments of the present disclosure can be applied in the construction of a recombinant library, for example, the recombinant library includes: a fragment library and a plasmid library. By protecting the restriction endonuclease recognition site from the recognition and cutting of the restriction endonuclease, the technical difficulty caused by too many restriction endonuclease recognition sites can be reduced.

[0076] The enzyme recognition site protection method provided in the embodiments of the present disclosure can be applied to the linearization of plasmids in the RNA pharmaceutical process. By protecting the restriction endonuclease recognition sites from being recognized and cut by the restriction endonuclease, the technical difficulty caused by too many restriction endonuclease recognition sites can be reduced.

[0077] The embodiments of the present disclosure also provide a gene cloning method, such as Figure 3 As shown, the method includes steps S1 to S3.

[0078] S1: Figure 4 As shown, a ribonucleoprotein complex solution is prepared, wherein the ribonucleoprotein complex includes: a dCas enzyme and a guide sequence.

[0079] For the introduction of guide sequences and dCas enzymes, please refer to the above content and will not be repeated here.

[0080] Ribonucleoprotein complex (RNP) is a complex formed by a specific protein and a specific RNA. Here, the specific protein is the dCas enzyme, and the specific RNA is the guide sequence. The dCas enzyme and the guide sequence combine to form a ribonucleoprotein complex.

[0081] In some examples, the step of preparing the ribonucleoprotein complex solution includes: mixing the dCas enzyme solution, the guide sequence solution and the first buffer solution, and storing them at room temperature.

[0082] The first buffer solution includes: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value of the first buffer solution ranges from 7.9 to 8.1; the ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10. The first buffer solution is a carrier solution of the ribonucleoprotein complex solution.

[0083] NaCl is called sodium chloride in Chinese, white crystals, and is easily soluble in water. Exemplarily, in the first buffer solution, the molar concentration of NaCl is 1000mmol / L, 1100mmol / L, 1200mmol / L, 1300mmol / L, 1400mmol / L or 1500mmol / L, etc., which is not limited here.

[0084] The Chinese name of Tris-HCl is tris(hydroxymethyl)aminomethane hydrochloride, and its molecular formula is C 4 H11 NO 3 .HCl. Exemplarily, in the first buffer solution, the molar concentration of Tris-HCl is 400mmol / L, 450mmol / L, 500mmol / L, 550mmol / L or 600mmol / L, etc., which is not limited here.

[0085] MgCl 2 The Chinese name is magnesium chloride, which is a colorless and hygroscopic crystal. 2 The molar concentration is 80mmol / L, 90mmol / L, 100mmol / L, 110mmol / L, 120mmol / L, 130mmol / L, 140mmol / L or 150mmol / L, etc., but is not limited thereto.

[0086] Recombinant albumin is an artificially synthesized protein obtained by applying the technology of recombinant DNA or recombinant RNA. Exemplarily, in the first buffer solution, the mass concentration of the recombinant protein is 800 μg / mL, 900 μg / mL, 1000 μg / mL, 1100 μg / mL, 1200 μg / mL, 1300 μg / mL, 1400 μg / mL or 1500 μg / mL, etc., which is not limited here.

[0087] Exemplarily, the pH value of the first buffer solution is 7.9, 8.0 or 8.1, etc., which is not limited here.

[0088] Illustratively, the ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.

[0089] In some examples, in the dCas enzyme solution, the concentration of the dCas enzyme ranges from 1 μmol / L to 20 μmol / L.

[0090] Illustratively, in the dCas enzyme solution, the molar concentration of the dCas enzyme is 1 μmol / L, 2 μmol / L, 4 μmol / L, 7 μmol / L, 9 μmol / L, 13 μmol / L, 15 μmol / L, 18 μmol / L or 20 μmol / L, etc., which is not limited here.

[0091] In some examples, the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.

[0092] Exemplarily, the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.

[0093] In some examples, in the guide sequence solution, the concentration of the guide sequence ranges from 2 μmol / L to 9 μmol / L.

[0094] Illustratively, in the guide sequence solution, the molar concentration of the guide sequence is 2 μmol / L, 3 μmol / L, 4 μmol / L, 5 μmol / L, 6 μmol / L, 7 μmol / L, 8 μmol / L or 9 μmol / L, etc., which is not limited here.

[0095] In some examples, the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution ranges from 1:10 to 3:10.

[0096] Illustratively, the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.

[0097] By mixing the above-mentioned dCas enzyme solution, guide sequence solution and first buffer solution, a ribonucleoprotein complex solution including dCas enzyme and guide sequence of appropriate concentration can be prepared for protecting the enzyme recognition site in the subsequent gene cloning step.

[0098] S2: Figure 4 As shown, a sample solution is prepared, the sample comprising: a target gene sequence and a ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence.

[0099] For example, Figure 4 As shown in the figure, taking the target gene sequence as a linear DNA sequence as an example, the target gene sequence has two enzyme recognition sites with the same base sequence, one of which is a non-target recognition site and the other is a target recognition site. The guide sequence guides the dCas enzyme to bind to the vicinity of the target recognition site, covering the target recognition site, and the dCas enzyme is not bound near the non-target recognition site.

[0100] In some examples, preparing the sample solution includes: mixing the ribonucleoprotein complex solution, the target gene sequence solution, and the second buffer solution, and storing at room temperature. For example, the room temperature storage time range is greater than or equal to 20 minutes, which can ensure that the dCas enzyme is fully combined with the target gene sequence.

[0101] The second buffer solution is a carrier solution for the sample solution.

[0102] The second buffer solution includes: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value of the second buffer solution ranges from 7.9 to 8.1, and the ratio of the volume of the second buffer solution to the volume of the sample solution ranges from 1:10 to 3:10.

[0103] Illustratively, in the second buffer solution, the molar concentration of NaCl is 1000 mmol / L, 1100 mmol / L, 1200 mmol / L, 1300 mmol / L, 1400 mmol / L or 1500 mmol / L, etc., which is not limited here.

[0104] Illustratively, in the second buffer solution, the molar concentration of Tris-HCl is 400 mmol / L, 450 mmol / L, 500 mmol / L, 550 mmol / L or 600 mmol / L, etc., which is not limited here.

[0105] Exemplarily, in the second buffer solution, MgCl 2 The molar concentration is 80mmol / L, 90mmol / L, 100mmol / L, 110mmol / L, 120mmol / L, 130mmol / L, 140mmol / L or 150mmol / L, etc., but is not limited thereto.

[0106] Illustratively, in the second buffer solution, the mass concentration of the recombinant protein is 800 μg / mL, 900 μg / mL, 1000 μg / mL, 1100 μg / mL, 1200 μg / mL, 1300 μg / mL, 1400 μg / mL or 1500 μg / mL, etc., which is not limited here.

[0107] Exemplarily, the pH value of the second buffer solution is 7.9, 8.0 or 8.1, etc., which is not limited here.

[0108] Illustratively, the ratio of the volume of the second buffer solution to the volume of the sample solution is 1:10, 3:20, 1:5, 1:4 or 3:10, etc., which is not limited here.

[0109] It should be noted that the components of the first buffer solution are the same as those of the second buffer solution, and the content of each component in the first buffer solution and the content of each component in the second buffer solution may be the same or different, and there is no limitation thereto.

[0110] In some examples, the ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution ranges from 3:20 to 1:2.

[0111] Illustratively, the ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is 3:20, 1:5, 1:4, 3:10, 7:20, 2:5, 9:20 or 1:2, etc., which is not limited here.

[0112] In some examples, the ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:4.

[0113] Illustratively, the ratio of the volume of the target gene sequence solution to the volume of the sample solution is 1:20, 1:10, 3:20, 1:5 or 1:4, etc., which is not limited here.

[0114] By mixing the ribonucleoprotein complex solution, the target gene sequence solution and the second buffer solution, a sample solution in which the dCas enzyme is bound near the target recognition site of the target gene sequence is prepared. In the sample solution, the dCas enzyme covers the target recognition site of the target gene sequence to generate steric hindrance.

[0115] S3: Figure 4 As shown, an enzyme cutting system is prepared, which includes: a restriction endonuclease and a sample, and enzyme cutting is performed; under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cutting by the restriction endonuclease.

[0116] The target gene sequence includes: non-target recognition sites of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is referred to as the target recognition site. In the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.

[0117] That is, in the enzyme cleavage step, the target recognition site of the target gene sequence can be protected from recognition and cleavage by the restriction endonuclease, while the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.

[0118] That is, the target recognition site of the target gene sequence is protected from recognition and cutting by the restriction endonuclease, while the non-target recognition site of the target gene sequence is recognized and cut by the restriction endonuclease, so that the target gene sequence is cut to obtain two gene fragments, for example, the first gene fragment and the second gene fragment.

[0119] Exemplarily, in this step, the enzyme cutting time ranges from 15 minutes to 30 minutes. For example, the enzyme cutting time is 15 minutes, 18 minutes, 20 minutes, 22 minutes, 25 minutes, 28 minutes or 30 minutes, etc., which are not limited here. By setting the enzyme cutting time range, it can be ensured that the restriction endonuclease fully cuts the sample, that is, the non-target recognition site of the target gene sequence is fully cut, and the target recognition site of the target gene sequence is not damaged, so that the target recognition site of the target gene sequence can be protected from recognition and cutting by the restriction endonuclease.

[0120] In some examples, the step of preparing the enzyme digestion system includes: mixing a sample solution, a restriction endonuclease solution, and a third buffer solution.

[0121] The third buffer solution includes: 100 mmol / L to 330 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl 2 , 660mmol / L~1000mmol / L KCl, 0.5mg / mL~1.5mg / mL bovine serum albumin. The pH value range of the third buffer solution is 7.9~8.5. The ratio of the volume of the third buffer solution to the volume of the enzyme cleavage system is in the range of 1:10~3:20. The third buffer solution is the carrier solution of the enzyme cleavage system.

[0122] Exemplarily, the molar concentration of Tris-HCl is 100mmol / L, 120mmol / L, 130mmol / L, 150mmol / L, 180mmol / L, 200mmol / L, 230mmol / L, 250mmol / L, 280mmol / L, 300mmol / L or 330mmol / L, etc., but is not limited thereto.

[0123] For example, MgCl 2 The molar concentration is 80mmol / L, 90mmol / L, 100mmol / L, 110mmol / L, 120mmol / L, 130mmol / L, 140mmol / L or 150mmol / L, etc., but is not limited thereto.

[0124] KCl is called potassium chloride in Chinese, a kind of hydrochloride, white crystals or crystalline powder, and is easily soluble in water. Exemplarily, the molar concentration of KCl is 660mmol / L, 680mmol / L, 720mmol / L, 750mmol / L, 780mmol / L, 800mmol / L, 830mmol / L, 870mmol / L, 900mmol / L, 960mmol / L or 1000mmol / L, etc., which is not limited here.

[0125] Bovine serum albumin (BSA) is a type of albumin in bovine serum. Exemplarily, the mass concentration of BSA is 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, 1.2 mg / mL, 1.4 mg / mL or 1.5 mg / mL, etc., which is not limited here.

[0126] Exemplarily, the pH value of the third buffer solution is 7.9, 8.0, 8.1, 8.2, 8.3, 8.4 or 8.5, etc., which is not limited here.

[0127] Illustratively, the ratio of the volume of the third buffer solution to the volume of the enzyme cleavage system is 1:10, 1:8 or 3:20, etc., which is not limited here.

[0128] In some examples, the ratio of the volume of the sample solution to the volume of the enzyme digestion system ranges from 1:10 to 1:2.

[0129] For example, the ratio of the volume of the sample solution to the volume of the enzyme digestion system is 1:10, 1:5, 3:10, 2:5 or 1:2, etc., which is not limited here.

[0130] In some examples, in the restriction endonuclease solution, the concentration of the restriction endonuclease ranges from 4 U / μL to 20 U / μL.

[0131] Among them, the size of enzyme activity, that is, the amount of enzyme, is expressed in enzyme activity units (U). In 1961, the Enzyme Commission of the International Biochemical Society proposed the use of a unified "International Unit" (IU) to express enzyme activity, which is stipulated as follows: Under optimal conditions (25°C), the amount of enzyme required to catalyze 1 micromole (μmol) of substrate into product per minute is defined as one activity unit, that is, 1IU = 1μmol / min. In other words, the content of the enzyme can be expressed by the number of enzyme activity units per gram or milliliter of enzyme preparation (U / g or U / ml), where U is the abbreviation of IU.

[0132] For example, in the restriction endonuclease solution, the concentration of the restriction endonuclease is 4U / μL, 5U / μL, 7U / μL, 8U / μL, 10U / μL, 12U / μL, 14U / μL, 15U / μL, 16U / μL, 17U / μL, 18U / μL or 20U / μL, etc., but is not limited thereto.

[0133] In some examples, the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system ranges from 1:20 to 1:10.

[0134] Exemplarily, the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system is 1:20, 3:40 or 1:10, etc., which is not limited here.

[0135] By mixing the sample solution, restriction endonuclease solution and the third buffer solution, an enzyme digestion system suitable for the reaction of restriction endonuclease and sample can be prepared.

[0136] The gene cloning method provided in the embodiments of the present disclosure uses a guide sequence to guide the dCas enzyme to bind near the enzyme recognition site (i.e., the target recognition site), covering the enzyme recognition site, generating steric hindrance, and protecting it from the recognition and cutting of the restriction endonuclease, thereby achieving the purpose of protecting the enzyme recognition site. This can reduce the technical difficulty caused by too many restriction endonuclease recognition sites.

[0137] The embodiments of the present disclosure also provide a gene cloning reagent system, which includes: a ribonucleoprotein complex solution, a sample solution and an enzyme cutting system. For the introduction of the ribonucleoprotein complex solution, the sample solution and the enzyme cutting system, please refer to the above content and will not be repeated here.

[0138] In order to objectively evaluate the technical effects of the embodiments of the present disclosure, the technical solutions provided by the present disclosure will be described in detail and exemplarily through the following experimental examples and comparative examples.

[0139] Example 1

[0140] First, a ribonucleoprotein complex solution is prepared. The dCas enzyme solution, the guide sequence solution and the first buffer solution are mixed to obtain a ribonucleoprotein complex solution. The first buffer solution includes: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl 2 , 1000 μg / mL recombinant protein. The pH value of the first buffer solution is 7.9. The specific volume usage of various reagents is shown in Table 1.

[0141] Table 1

[0142] Reagents Volume / μL Guide sequence solution 1～3 dCas enzyme solution 1～3 First buffer solution 1 water Fill up to 10

[0143] Then, a sample solution was prepared by mixing the ribonucleoprotein complex solution, the target gene sequence solution and the second buffer solution, and storing the mixture at room temperature for 20 minutes to obtain a sample solution.

[0144] In the sample provided in this embodiment, the target gene sequence is a circular plasmid formed by connecting the insertion sequence 1 and the plasmid vector pUC57, which is called the first plasmid.

[0145] The sequence of insertion sequence 1 is: 5'--3'. There is a recognition site for restriction endonuclease EcoRV in insertion sequence 1, and the sequence of the recognition site is 5'-GATATC-3'. Figure 1 As shown, the cleavage position 110 of the restriction endonuclease EcoRV is located between base T and base A from the 5' end to the 3' end in the sequence of the recognition site.

[0146] There is a recognition site for restriction endonuclease EcoRV in the plasmid vector pUC57, and the sequence of the recognition site is the same as that of the recognition site in the insertion sequence 1, both of which are 5'-GATATC-3'.

[0147] That is, in the first plasmid formed by connecting the insertion sequence 1 and the plasmid vector pUC57, there are two recognition sites for the restriction endonuclease EcoRV, one recognition site is located in the insertion sequence 1, and the other recognition site is located in the plasmid vector pUC57.

[0148] The guide sequence is referred to as guide sequence 1, and the base sequence of guide sequence 1 is: 5'-AACUUUGAUAUCAGCGGUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AACUUUGAUAUCAGCGGUCU is the first fragment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second fragment.

[0149] The purpose of designing the guide sequence 1 is to use the guide sequence 1 to guide the dCas enzyme to bind to the recognition site located near the insertion sequence 1 in the first plasmid. Whether the dCas enzyme binds to the recognition site located near the insertion sequence 1 under the guidance of the guide sequence 1 and generates steric hindrance to protect the recognition site from the recognition and cleavage of the restriction endonuclease EcoRV, the specific results are shown in the subsequent Figure 5 The gel electrophoresis diagram is not described in detail here.

[0150] The second buffer solution includes: 1000mmol / L NaCl, 500mmol / L Tris-HCl, 100mmol / L MgCl2, 1000μg / mL recombinant protein, and the pH value of the second buffer solution is 7.9. The specific volume usage of various reagents is shown in Table 2.

[0151] Table 2

[0152] Reagents Volume / μL Ribonucleoprotein complex solution 3～10 Target gene sequence 1～5 Second buffer solution 2 water Fill up to 20

[0153] Afterwards, an enzyme digestion system is prepared by mixing the sample solution, the restriction endonuclease solution and the third buffer solution to obtain an enzyme digestion system, and the enzyme digestion time ranges from 15 minutes to 30 minutes.

[0154] In the enzyme digestion system provided in this embodiment, the restriction endonuclease is EcoRV, and the sequence of the recognition site of the restriction endonuclease EcoRV is 5'-GATATC-3'.

[0155] The third buffer solution includes: 100mmol / L Tris-HCl, 100mmol / L MgCl 2, 1000mmol / L KCl, 1mg / mL bovine serum albumin, and the pH value of the third buffer solution is 8.5. The specific volume usage of various reagents is shown in Table 3.

[0156] Table 3

[0157] Reagents Volume / μL Sample solution 2～10 Restriction enzyme solution 1～2 The third buffer solution 2～3 water Fill up to 20

[0158] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the first plasmid.

[0159] It is understandable that, in the first plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV.

[0160] If the dCas enzyme binds to the vicinity of the recognition site in the insertion sequence 1 and covers the recognition site under the guidance of the guide sequence 1, the recognition site in the insertion sequence 1 can be protected from recognition and cleavage by the restriction endonuclease EcoRV. After the enzyme cleavage step, the first plasmid is cut into a linear fragment.

[0161] If the dCas enzyme does not bind to the recognition site located in the insertion sequence 1 under the guidance of the guide sequence 1, the recognition site in the insertion sequence 1 cannot be protected from recognition and cleavage by the restriction endonuclease EcoRV. Then, after the enzyme cleavage step, the first plasmid is cut into two linear fragments.

[0162] For details, see Figure 5 From the gel electrophoresis diagram, we can see that there is a band at 2000bp~4000bp and a band at 500bp~650bp. The two bands indicate that the cut first plasmid has become two linear fragments. Figure 5 In the example, "Example 1" indicates the test result of the example. The two "Example 1"s indicate that the example was implemented twice.

[0163] Therefore, it can be seen that the dCas enzyme does not bind to the vicinity of the recognition site in the insertion sequence 1 under the guidance of the guide sequence 1, thereby failing to protect the recognition site in the insertion sequence 1 from recognition and cleavage by the restriction endonuclease EcoRV, and the design of the guide sequence 1 is invalid.

[0164] Example 2

[0165] First, a ribonucleoprotein complex solution is prepared. The preparation of the ribonucleoprotein complex solution is the same as in Example 1, and the specific steps can refer to the introduction of Example 1, which will not be repeated here.

[0166] Then, a sample solution is prepared by mixing the ribonucleoprotein complex solution, the target gene sequence solution and the second buffer solution, and storing the mixture at room temperature for 20 minutes to obtain a sample solution.

[0167] In the sample provided in this embodiment, the target gene sequence is a circular plasmid formed by connecting the insertion sequence 2 and the plasmid vector pUC57, which is called the second plasmid.

[0168] The sequence of insertion sequence 2 is: 5'--3'. There is a recognition site for restriction endonuclease EcoRV in insertion sequence 2, and the sequence of the recognition site is 5'-GATATC-3'.

[0169] There is a recognition site for restriction endonuclease EcoRV in the plasmid vector pUC57, and the sequence of the recognition site is the same as that of the recognition site in the insertion sequence 2, both of which are 5'-GATATC-3'.

[0170] That is, in the second plasmid formed by connecting the insertion sequence 2 and the plasmid vector pUC57, there are two recognition sites for the restriction endonuclease EcoRV, one recognition site is located in the insertion sequence 2, and the other recognition site is located in the plasmid vector pUC57.

[0171] The guide sequence is called guide sequence 2, and the base sequence of guide sequence 2 is: 5'-AGGAUAUCUUCAGGUAGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3', wherein AGGAUAUCUUCAGGUAGUCC is the first fragment, and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU is the second fragment.

[0172] The purpose of designing the guide sequence 2 is to use the guide sequence 2 to guide the dCas enzyme to bind to the recognition site located near the insertion sequence 2 in the second plasmid. Whether the dCas enzyme binds to the recognition site located near the insertion sequence 2 under the guidance of the guide sequence 2 and covers the recognition site, and generates steric hindrance to protect the recognition site from the recognition and cleavage of the restriction endonuclease EcoRV, please refer to the subsequent Figure 5 The gel electrophoresis diagram is not described in detail here.

[0173] The components of the second buffer solution and the specific volumes of various reagents used are the same as those in Example 1 and will not be described in detail here.

[0174] Afterwards, the enzymatic cleavage system is prepared. The steps for preparing the enzymatic cleavage system are the same as those in Example 1 and will not be described in detail herein.

[0175] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the second plasmid.

[0176] It is understood that, in the second plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV.

[0177] If the dCas enzyme binds to the vicinity of the recognition site in the insertion sequence 2 under the guidance of the guide sequence 2 and covers the recognition site, the recognition site in the insertion sequence 2 can be protected from recognition and cleavage by the restriction endonuclease EcoRV. After the enzyme cleavage step, the second plasmid becomes a linear fragment.

[0178] If the dCas enzyme does not bind to the vicinity of the recognition site in the insertion sequence 2 under the guidance of the guide sequence 2, the recognition site in the insertion sequence 2 cannot be protected from recognition and cleavage by the restriction endonuclease EcoRV. After the enzyme cleavage step, the second plasmid becomes two linear fragments.

[0179] For details, see Figure 5 From the gel electrophoresis diagram, it can be seen that there is only one band at 3000bp to 4000bp. This data result shows that the second plasmid was cut into a linear fragment. Figure 5 In the example, "Example 2" indicates the test result of this example. The two "Example 2" indicate that this example was implemented twice.

[0180] Therefore, it can be seen that the dCas enzyme can bind to the vicinity of the recognition site located in the insertion sequence 2 under the guidance of the guide sequence 2, thereby protecting the recognition site in the insertion sequence 2 from recognition and cutting by the restriction endonuclease EcoRV, and the design of the guide sequence 2 is effective.

[0181] Comparative Example 1

[0182] First, a sample solution is provided. Compared with Example 1, no ribonucleoprotein complex solution is added to the sample solution, and the target gene sequence in the sample solution is the first plasmid. That is, in the first plasmid, there are two recognition sites for the restriction endonuclease EcoRV, one recognition site is located in the insertion sequence 1, and the other recognition site is located in the plasmid vector pUC57.

[0183] Then, the sample solution containing the first plasmid is subjected to enzyme digestion in an enzyme digestion system. The steps for preparing the enzyme digestion system are the same as those in Example 1 and will not be described in detail herein.

[0184] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the first plasmid.

[0185] It is understood that in the first plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV. At the same time, the recognition site located in the insertion sequence 1 will be recognized and cut under the action of the restriction endonuclease EcoRV. Therefore, the first plasmid will be cut into two linear fragments.

[0186] For details, see Figure 5 From the gel electrophoresis diagram of "Comparative Example 1", it can be seen that there is a band at 2000bp-4000bp and a band at 500bp-650bp. The appearance of two bands indicates that the first plasmid is cut into two linear fragments.

[0187] This comparative example further illustrates that in Example 1, the first plasmid was cut into two linear fragments. Therefore, in Example 1, the dCas enzyme did not bind to the vicinity of the recognition site in the insertion sequence 1 under the guidance of the guide sequence 1, and thus could not protect the recognition site in the insertion sequence 1 from recognition and cutting by the restriction endonuclease EcoRV, and the design of the guide sequence 1 was invalid.

[0188] Comparative Example 2

[0189] First, a sample solution is provided. Compared with Example 2, no ribonucleoprotein complex solution is added to the sample solution, and the target gene sequence in the sample solution is the second plasmid. That is, in the second plasmid, there are two recognition sites for the restriction endonuclease EcoRV, one recognition site is located in the insertion sequence 2, and the other recognition site is located in the plasmid vector pUC57.

[0190] Then, the sample solution containing the second plasmid is subjected to enzyme digestion in an enzyme digestion system. The steps for preparing the enzyme digestion system are the same as those in Example 1 and will not be described in detail herein.

[0191] In this step, the restriction endonuclease EcoRV recognizes and cuts the recognition site in the second plasmid.

[0192] It is understood that in the second plasmid, the recognition site located in the plasmid vector pUC57 will be recognized and cut under the action of the restriction endonuclease EcoRV. At the same time, the recognition site located in the insertion sequence 2 will be recognized and cut under the action of the restriction endonuclease EcoRV. Therefore, the second plasmid will be cut into two linear fragments.

[0193] For details, see Figure 5 From the gel electrophoresis diagram of "Comparative Example 2", it can be seen that there is a band at 2000bp-4000bp and a band at 400bp-500bp. The appearance of two bands indicates that the second plasmid is cut into two linear fragments.

[0194] This comparative example further illustrates that in Example 2, there is only one band at 3000 bp to 4000 bp, indicating that the second plasmid is cut into a linear fragment. Therefore, under the guidance of guide sequence 2, the dCas enzyme can bind to the vicinity of the recognition site in insertion sequence 2, thereby protecting the recognition site in insertion sequence 2 from recognition and cutting by restriction endonuclease EcoRV, and the design of guide sequence 2 is effective.

[0195] The above example uses the enzyme recognition site protection method provided in the embodiment of the present disclosure to protect the recognition site in the inserted sequence from being cut by the restriction endonuclease. It can be understood that the enzyme recognition site protection method provided in the embodiment of the present disclosure can also be used to protect the recognition site in the plasmid vector from being recognized and cut by the restriction endonuclease.

[0196] The above is only a specific embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any changes or substitutions that can be thought of by any person skilled in the art within the technical scope disclosed in the present disclosure should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.

Claims

1. A method for protecting an enzyme recognition site, It is characterized in that include: The guide sequence is designed to guide the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence, so that the enzyme recognition site to be protected is protected from recognition and cleavage by the restriction endonuclease.

2. The method for protecting the enzyme recognition site according to claim 1, It is characterized in that The target gene sequence includes: a non-target recognition site with the same base sequence and at least one target recognition site. The enzyme recognition site to be protected is also called the target recognition site.

3. The method for protecting the enzyme recognition site according to claim 1 or 2, It is characterized in that The target gene sequence includes: any one of a plasmid and a linear DNA fragment.

4. The method for protecting the enzyme recognition site according to claim 1 or 2, It is characterized in that The guide sequence includes: a single-stranded nucleotide; the single-stranded nucleotide includes: a first fragment and a second fragment connected from the 5' end to the 3' end, wherein the first fragment is used to bind to the target gene sequence, and the second fragment is used to bind to the dCas enzyme.

5. A gene cloning method, It is characterized in that include: preparing a ribonucleoprotein complex solution, the ribonucleoprotein complex comprising: a dCas enzyme and a guide sequence; Preparing a sample solution, the sample comprising: a target gene sequence and the ribonucleoprotein complex; wherein the guide sequence guides the dCas enzyme to cover the enzyme recognition site to be protected in the target gene sequence; An enzyme cutting system is prepared, the enzyme cutting system comprising: a restriction endonuclease and the sample, and enzyme cutting is performed; under the protection of the dCas enzyme, the enzyme recognition site to be protected is protected from recognition and cutting by the restriction endonuclease.

6. The gene cloning method according to claim 5, It is characterized in that The target gene sequence includes: a non-target recognition site of the same base sequence and at least one target recognition site, and the enzyme recognition site to be protected is also called the target recognition site; In the enzyme cleavage step, the non-target recognition site of the target gene sequence is recognized and cleaved by the restriction endonuclease.

7. A gene cloning reagent system, It is characterized in that include: Ribonucleoprotein complex solution; Wherein, the ribonucleoprotein complex solution comprises: a dCas enzyme solution and a guide sequence solution; In the dCas enzyme solution, the concentration range of the dCas enzyme is 1 μmol / L to 20 μmol / L; the ratio of the volume of the dCas enzyme solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:10; In the guide sequence solution, the concentration range of the guide sequence is 2 μmol / L to 9 μmol / L; the ratio of the volume of the guide sequence solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:

10.

8. The gene cloning reagent system according to claim 7, It is characterized in that The ribonucleoprotein complex solution further comprises: a first buffer solution; The first buffer solution comprises: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value range of the first buffer solution is 7.9 to 8.1; The ratio of the volume of the first buffer solution to the volume of the ribonucleoprotein complex solution is in the range of 1:10 to 3:

10.

9. The gene cloning reagent system according to claim 7 or 8, It is characterized in that Also includes: Sample solution; Wherein, the sample solution includes: the ribonucleoprotein complex solution and the target gene sequence solution; The ratio of the volume of the ribonucleoprotein complex solution to the volume of the sample solution is in the range of 3:20 to 1:2; The copy number of the target gene sequence is greater than or equal to 10 3 ; The ratio of the volume of the target gene sequence solution to the volume of the sample solution ranges from 1:20 to 1:

4.

10. The gene cloning reagent system according to claim 9, It is characterized in that The sample solution further includes: a second buffer solution; The second buffer solution includes: 1000mmol / L to 1500mmol / L NaCl, 400mmol / L to 600mmol / L Tris-HCl, 80mmol / L to 150mmol / L MgCl 2 , 800 μg / mL to 1500 μg / mL of recombinant protein, the pH value of the second buffer solution is in the range of 7.9 to 8.1; The ratio of the volume of the second buffer solution to the volume of the sample solution is in the range of 1:10 to 3:

10.

11. The gene cloning reagent system according to claim 9, It is characterized in that Also includes: Enzyme digestion system; Wherein, the enzyme digestion system comprises: the sample solution and the restriction endonuclease solution; The ratio of the volume of the sample solution to the volume of the enzyme digestion system ranges from 1:10 to 1:2; In the restriction endonuclease solution, the concentration of the restriction endonuclease is in the range of 4U / μL to 20U / μL; the ratio of the volume of the restriction endonuclease solution to the volume of the enzyme digestion system is in the range of 1:20 to 1:

10.

12. The gene cloning reagent system according to claim 11, It is characterized in that The enzyme digestion system further comprises: a third buffer solution; The third buffer solution includes: 100 mmol / L to 330 mmol / L Tris-HCl, 80 mmol / L to 150 mmol / L MgCl 2 , 660mmol / L~1000mmol / L KCl, 0.5mg / mL~1.5mg / mL bovine serum albumin; The pH value range of the third buffer solution is 7.9-8.5; the ratio range of the volume of the third buffer solution to the volume of the enzyme cleavage system is 1:10-3:

20.

13. Use of the method for protecting an enzyme recognition site as claimed in any one of claims 1 to 4 in plasmid construction.

14. Use of the method for protecting an enzyme recognition site as claimed in any one of claims 1 to 4 in the construction of a recombinant library.

15. Use of the method for protecting enzyme recognition sites as claimed in any one of claims 1 to 4 in the linearization of plasmids in the process of RNA pharmaceutical preparation.

Images