Bifidobacterium longum capable of regulating circadian rhythm and remarkably improving cognitive memory ability and application of bifidobacterium longum

Abstract

The invention discloses bifidobacterium longum capable of regulating circadian rhythm and remarkably improving cognitive memory ability and application of the bifidobacterium longum, and belongs to the technical field of microorganisms. The bifidobacterium longum GDMCC No: 65850 provided by the invention can effectively relieve rhythm gene expression disorder caused by sleep deprivation, thereby relieving cognitive defects of mice with circadian rhythm disorder. Besides, the intervention of the bifidobacterium longum GDMCC No: 65850 can regulate the intestinal flora health and the change of the intestinal metabolite level, promote the generation of neuroprotective metabolite and reduce the cognitive ability decline caused by circadian rhythm disorder. According to the bifidobacterium longum, the application range of the bifidobacterium longum as probiotics is expanded, and the bifidobacterium longum has a huge application prospect in products for relieving cognitive memory ability decline induced by circadian rhythm disorder.

Description

Technical Field

[0001] The present invention relates to a Bifidobacterium longum strain with the ability to significantly improve cognitive memory by regulating the circadian rhythm and its application, belonging to the field of microbial technology. Technical Background

[0002] Modern lifestyles, such as social jet lag, shift work, and delayed bedtime, often disrupt people's normal sleep-wake cycle, causing a mismatch between the natural environment and the endogenous biological clock, as well as between different circadian rhythm oscillators in the body (i.e., circadian rhythm disorder). More and more clinical evidence shows that long-term circadian rhythm disorder can trigger various complications, such as obesity, diabetes, sleep disorders, etc. Circadian rhythm disorder can also affect brain function, accelerating the development of various chronic diseases including cognitive impairment, and affecting people's daily study, work, and life. Mild cognitive impairment is a disease in the transitional stage between normal cognitive function and dementia, mainly manifested as memory decline, inattention, decreased thinking ability, and changes in mood and emotion, etc. Melatonin is considered an effective drug for treating circadian rhythm disorder and can reduce rhythm-induced cognitive impairment by regulating the expression of rhythm genes. However, long-term supplementation with exogenous melatonin will inevitably produce side effects on the body, such as dizziness, drowsiness, and hormonal secretion imbalance, etc. Therefore, it is necessary to find safer and more effective treatment strategies.

[0003] In recent years, more and more studies have revealed the association between the host circadian rhythm, cognitive ability, and gut microbiota. Research shows that sleep deprivation-induced rhythm disorder can significantly change the composition of the gut microbiota in mice, especially significantly reducing the abundances of beneficial bacteria Lactobacillaceae and Akkermansia (Microbiological Research, 2023, 268:127292; Gut Microbes, 2023, 15(2):2252764). Transplanting the fecal microbiota of sleep-deprived mice into the gut of healthy antibiotic-treated mice, the cognitive ability of the recipient mice is significantly inferior to that of the control group mice (Brain, Behavior, and Immunity, 2023, 108:98-117), but the cognitive impairment of mice can be observed to be repaired after transplanting the fecal microbiota of healthy mice (Brain, Behavior, and Immunity, 2023, 108:98-117; Nutritional Neuroscience, 2023, 26(3):254-264). Therefore, the gut microbiota may be an important target involved in regulating the host circadian rhythm and cognitive level.

[0004] However, it is currently unknown whether Bifidobacterium longum can alleviate cognitive impairment caused by circadian rhythm disorders. Although Bifidobacterium longum has been disclosed in some prior arts to be able to alleviate cognitive decline caused by Alzheimer's disease (CN118256399A) and aging (Scientific Reports, 2019, 9(1): 11814) to a certain extent, there are differences in the scope of influence, pathogenesis, and manifestation symptoms between cognitive decline caused by rhythm disorders and cognitive impairment caused by the above two factors. First, there are differences in the apparent symptoms of different types of cognitive impairment: Alzheimer's disease (AD) is a very common neurodegenerative disease in the elderly, and most AD patients are over 65 years old. In contrast, the influence of rhythm disorders is wider and can affect people of all ages and different occupations, such as teenagers with irregular work and rest, adults working in shifts, and the elderly with declining physical functions. Rhythm disorders can cause systemic damage to the body. Moreover, the cognitive impairment caused by Alzheimer's disease is a manifestation of neurodegenerative diseases, with the characteristics of irreversibility and progressive aggravation; the cognitive impairment caused by aging is progressive and irreversible and requires long-term intervention and management; while insomnia causes temporary cognitive impairment, which can be alleviated by improving sleep. Second, there are differences in the mechanisms of different types of cognitive impairment. Circadian rhythm genes are key regulators of biological rhythms, and the main manifestation of circadian rhythm disorders is the dysregulation of rhythm gene expression. Research has shown that rhythm genes play an important role in regulating neurogenesis and cognitive function. The deletion of Bmal1 will increase the activation of microglia and astrocytes and promote the occurrence of neuroinflammation, reducing the host's cognitive level. The deletion of Bmal1 can also enhance the activation of the LPS-induced NF-κB pathway by increasing the ROS level (The FASEB Journal, 2020, 34(5): 6570-6581). In contrast, in a disclosed invention (Scientific Reports, 2019, 9(1): 11814), Bifidobacterium longum NK46 mainly alleviates cognitive decline caused by AD by regulating the gut microbiota to reduce the LPS levels in feces and blood, thereby inhibiting the activation of the LPS-mediated NF-κB pathway. In another invention (CN118256399A), Bifidobacterium longum CGMCC No. 24068 mainly alleviates cognitive decline caused by aging by reducing the accumulation of amyloid-β 1-42 in the hippocampus of D-galactose-induced mice and increasing the level of neurotransmitters (acetylcholine). Therefore, there are differences in both mechanisms and appearances between the weakening of cognitive ability caused by rhythm disorders and the weakening of cognitive ability caused by the above-mentioned AD and aging.

[0005] In view of the fact that there is currently no direct evidence that Bifidobacterium longum can regulate the circadian rhythm mechanism and improve cognitive impairment induced by rhythm disorders, it is of great significance to explore the regulation of the circadian rhythm and cognitive ability by Bifidobacterium longum and its application. Summary of the Invention

[0006] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides a Bifidobacterium longum that can alleviate circadian rhythm disorders and the decline in cognitive memory ability induced thereby, and its application. At present, it is unknown whether Bifidobacterium longum can alleviate cognitive impairment caused by circadian rhythm disorders, and its role in improving rhythm-related intestinal flora and changes in intestinal metabolites is also unclear. Therefore, it is necessary to develop a new probiotic agent with the effect of alleviating circadian rhythm disorders and the decline in cognitive memory ability to fill the current technical gap.

[0007] The present invention provides a Bifidobacterium longum GDMCC No: 65850 that can alleviate cognitive ability damage induced by rhythm disorders by regulating the circadian rhythm, and its application in the preparation of application products for regulating biological circadian rhythm, improving cognition and memory damage caused by sleep rhythm disorders, regulating intestinal flora disorders and abnormal metabolite synthesis.

[0008] In one embodiment, the Bifidobacterium longum was deposited at the Guangdong Provincial Microbial Culture Collection Center on January 23, 2025, with the deposit number GDMCC No: 65850 and the deposit address being the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou.

[0009] In one embodiment, the growth characteristics of the Bifidobacterium longum GDMCC No: 65850: This strain is a facultative anaerobe. When inoculated into the culture medium, it is cultured in an anaerobic incubator at 37°C for at least 24 hours.

[0010] In one embodiment, the Bifidobacterium longum GDMCC No: 65850 is a Gram-positive bacterium. When growing on MRS solid medium, it can form smooth, convex circular colonies, white in color and with neat edges; when growing in MRS liquid medium, it shows uniform turbidity, and the cells form a white precipitate after standing for a long time. The optimum growth temperature is 37°C.

[0011] The present invention also provides a microbial preparation containing the Bifidobacterium longum GDMCC No: 65850.

[0012] In one embodiment, the addition amount of the Bifidobacterium longum GDMCC No: 65850 in the microbial preparation is not less than 5×10 9CFU / g or 5×10 9 CFU / mL.

[0013] The present invention also provides a product containing the Bifidobacterium longum GDMCC No: 65850 or the microbial preparation described above.

[0014] In one embodiment, the product includes food, medicine or health care products.

[0015] The present invention also provides the use of the Bifidobacterium longum GDMCC No: 65850 or the microbial preparation in the preparation of a drug having the effect of regulating the circadian rhythm.

[0016] In one embodiment, the drug can treat circadian rhythm disorders caused by sleep deprivation or insomnia.

[0017] In one embodiment, in the drug, the addition amount of the Bifidobacterium longum GDMCC No: 65850 is not less than 5×10 9 CFU / g or 5×10 9 CFU / mL.

[0018] In one embodiment, the drug contains the Bifidobacterium longum GDMCC No: 65850 and pharmaceutically acceptable carriers and / or pharmaceutical excipients.

[0019] In one embodiment, the carrier includes one or more of fillers, binders, wetting agents, disintegrants, lubricants, and flavoring agents commonly used in medicine.

[0020] In one embodiment, the dosage form of the drug is granules, capsules, tablets, pills or oral liquids.

[0021] In one embodiment, the application includes at least one of the following functions:

[0022] (a) Regulating the biological circadian rhythm;

[0023] (b) Improving the anxiety-like mood caused by circadian rhythm disorders;

[0024] (c) Improving the decline in exploration and memory ability caused by circadian rhythm disorders.

[0025] The present invention also provides a drug capable of regulating the circadian rhythm, and the drug contains the Bifidobacterium longum GDMCC No: 65850.

[0026] In one embodiment, in the drug, the addition amount of the Bifidobacterium longum GDMCC No: 65850 is not less than 5×10 5 CFU / g or 5×10 9 CFU / mL.

[0027] The present invention also provides an application of the above-mentioned Bifidobacterium longum GDMCC No: 65850 in the preparation of a drug having at least one of the following functions:

[0028] (a) Relieving abnormal expression of genes related to the ileum and hypothalamus circadian rhythm caused by circadian rhythm disorder;

[0029] (b) Relieving anxiety-like behaviors and impaired exploration and memory functions caused by circadian rhythm disorder;

[0030] (c) Relieving intestinal microbiota disorder caused by circadian rhythm disorder;

[0031] (d) Relieving changes in intestinal metabolites caused by circadian rhythm disorder.

[0032] The present invention also provides an application of the Bifidobacterium longum GDMCC No: 65850 in the preparation of a health product helpful for improving memory decline caused by insomnia or in the preparation of a health product helpful for improving sleep.

[0033] Beneficial effects:

[0034] The present invention provides a strain of Bifidobacterium longum GDMCC No: 65850 that relieves cognitive impairment caused by circadian rhythm disorder and improves changes in the composition of intestinal microbiota and the level of intestinal metabolites caused by circadian rhythm disorder. After the Bifidobacterium longum GDMCC No: 65850 provided by the present invention acts on sleep-deprived mice, it can significantly relieve the decline in cognitive memory level of sleep-deprived mice and improve the changes in the composition of intestinal microbiota and the level of intestinal metabolites caused by rhythm disorder. Specifically, compared with the model group:

[0035] (1) The disordered expression of rhythm genes in the ileum and hypothalamus of mice with circadian rhythm disorder is improved.

[0036] (2) In the water maze test of mice with circadian rhythm disorder, the shortest time to find the center of the platform is shortened from 35.40 ± 5.50 s to 12.20 ± 8.40 s.

[0037] (3) In the water maze test of mice with circadian rhythm disorder, the proportion of the residence time in the third quadrant is increased from 15.67 ± 4.93% to 34.57 ± 8.45%.

[0038] (4) In the open field test of mice with circadian rhythm disorder, the proportion of the activity time in the central area is increased from 30.35 ± 4.57% to 44.28 ± 5.87%, and the activity trajectory in the central area is significantly increased.

[0039] (5) In the Y-maze test for mice with circadian rhythm disorders, the alternation frequency of the three arms increased from 46.96 ± 4.61% to 57.08 ± 2.05%.

[0040] (6) In the elevated plus-maze test for mice with circadian rhythm disorders, the proportion of time spent in the open arms increased from 17.07 ± 0.28% to 29.97 ± 5.19%.

[0041] (7) By regulating the disorder of the gut microbiota caused by circadian rhythm disorders, the relative abundance of Proteobacteria decreased from 4.53 ± 0.85% to 2.05 ± 0.61%, restoring the gut microbiota to a level close to that of health.

[0042] (8) By improving the changes in the levels of gut metabolites caused by circadian rhythm disorders, the contents of metabolites such as 2'-deoxyguanosine, guanosine, inosine, and N,N-dimethylglycine were up-regulated, while the contents of metabolites such as sphingosine were down-regulated.

[0043] Therefore, Bifidobacterium longum GDMCC No: 65850 has great application prospects in the preparation of products for relieving circadian rhythm disorders and related decline in cognitive memory ability.

[0044] Biological material preservation

[0045] Bifidobacterium longum GDMCC No: 65850, taxonomically named Bifidobacterium longum, was deposited in the Guangdong Provincial Culture Collection of Microorganisms on January 23, 2025, with the deposit number GDMCC No: 65850 and the deposit address at the 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. Description of the drawings

[0046] Figure 1 Regulatory effect of Bifidobacterium longum GDMCC No: 65850 on the expression of circadian rhythm-related genes in sleep-deprived mice: (A) Expression level of Bmal1 mRNA in the ileum; (B) Expression level of Per3 mRNA in the ileum; (C) Expression level of Cry1 mRNA in the ileum; (D) Expression level of Bmal1 mRNA in the hypothalamus; (E) Expression level of Per3 mRNA in the hypothalamus; (F) Expression level of Cry1 mRNA in the hypothalamus.

[0047] Figure 2Performance of experimental mice in different groups in the water maze behavioral test: (A) Change in escape time in the 5-day consecutive place navigation experiment; (B) Representative swimming trajectory map and trajectory heat map of the spatial exploration test on the 6th day; (C) Escape time in the spatial exploration test on the 6th day; (D) Proportion of residence time in the third quadrant in the spatial exploration test on the 6th day.

[0048] Figure 3 Performance of experimental mice in different groups in the open field behavioral test: (A) Representative movement trajectory of the open field test; (B) Proportion of activity time of mice in the central area of the open field.

[0049] Figure 4 Performance of experimental mice in different groups in other behavioral tests: (A) Y-maze alternation frequency; (B) Proportion of residence time in the open arms of the elevated plus maze.

[0050] Figure 5 Regulatory effect of GDMCC No: 65850 on the intestinal flora of sleep-deprived mice: (A) α-diversity; (B) Change in the abundance of Proteobacteria; (C) β-diversity.

[0051] Figure 6 Regulatory effect of GDMCC No: 65850 on the intestinal metabolite levels of sleep-deprived mice: (A) Volcano plot analysis of the blank group vs. the model group; (B) Volcano plot analysis of the GDMCC No: 65850 intervention group vs. the model group.

[0052] In the above pictures: *, **, *** indicate that the p-value is less than 0.05, 0.01, 0.001 compared with the blank group, respectively. Detailed implementation mode

[0053] The following is an explanation of the embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0054] The C57BL / 6J male mice involved in the following embodiments were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The RNA extraction, reverse transcription kit, and fluorescent dye ChamQ Universal SYBR qPCR Master Mix were purchased from Nanjing Novoprotein Biotechnology Co., Ltd. The fecal DNA extraction kit was purchased from MP Biomedicals, USA. The gel extraction kit was purchased from Biomiga, USA. The melatonin involved in the following embodiments was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0055] The culture media involved in the following embodiments are as follows:

[0056] MRS Liquid Medium (1 L): Peptone 10 g, Beef Extract 10 g, Yeast Extract 5 g, Anhydrous Glucose 20 g, Anhydrous Sodium Acetate 2 g, Magnesium Sulfate Heptahydrate (MgSO 4 ·7H 2 O) 0.5 g, Manganese Sulfate Monohydrate (MnSO 4 ·H 2 O) 0.25 g, Diammonium Hydrogen Citrate 2 g, Dipotassium Hydrogen Phosphate Trihydrate (K 2 HPO 4 ·3H 2 O) 2.6 g, Tween 80 1 mL.

[0057] MRS Solid Medium (1 L): Add 2% agar powder based on MRS liquid medium.

[0058] Preparation method of the Bifidobacterium longum GDMCC No: 65850 bacterial suspension involved in the following examples:

[0059] (1) Strain screening, activation and purification

[0060] Use a disposable sterile stool collector to collect the feces of an 84-year-old female in Wuxi City, Jiangsu Province. Take 1 g of the sample, mix and homogenize it with PBS (added with 0.05% cysteine), and perform gradient dilution. Select the dilution solution with a concentration of 10 -7 ~10 -9 and spread it on the MRS solid medium containing 1% nystatin and mupirocin, and culture it at 37 °C for 48 h in an anaerobic environment. Observe and record the colony morphology, pick a single colony and streak it on the MRS solid medium for purification, and culture it inverted in a 37 °C anaerobic incubator for 48 h. Pick several single colonies and inoculate them into 5 mL of MRS liquid medium respectively, and perform Gram staining after culturing in a 37 °C anaerobic incubator for 24 h. Select Gram-positive bacteria. After catalase analysis, discard the catalase-positive strains and retain the catalase-negative strains.

[0061] (2) Strain preservation and identification

[0062] The single colony bacterial liquid after the second activation was preserved. 500 μL of the bacterial liquid was aspirated into a bacterial preservation tube, and an equal volume of 60% sterile glycerol was added. After thorough mixing, it was labeled and stored in a -80 °C refrigerator. One tube of the glycerol bacterial liquid was taken for 16S rDNA bacterial species identification: centrifuged at 6000 rpm / min for 3 min, the supernatant was discarded, and the bacterial pellet was resuspended with 500 μL of sterile water. Centrifugation and resuspension were repeated 2 more times, and the obtained bacterial suspension could be used as a DNA template for PCR amplification. The bacterial PCR amplification reaction system (50 μL) was: 2.5 μL of the 27F forward primer, 2.5 μL of the 1492R reverse primer, 25 μL of Taq enzyme, 10 μL of the bacterial suspension template, and 10 μL of sterile water. The PCR reaction conditions were: ① 94 °C, 5 min; ② 94 °C, 30 s; ③ 55 °C, 30 s; ④ 72 °C, 1 min; ⑤ 72 °C, 10 min; ⑥ 12 °C, 2 min (② - ④ were repeated 30 cycles). The PCR amplification product was sent to a professional sequencing company, and the obtained sequence results were used to perform nucleic acid sequence alignment using the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The results showed a new strain with a nucleic acid sequence similarity of up to 99% to Bifidobacterium longum, named Bifidobacterium longum GDMCC No: 65850, which was preserved in the Guangdong Provincial Microbial Culture Collection Center on January 23, 2025, with the preservation number GDMCC No: 65850.

[0063] (3) Expanded system culture

[0064] The bacterial liquid of Bifidobacterium longum GDMCC No: 65850 after identification and more than two generations of activation was inoculated into 1 L of MRS liquid medium at an inoculation amount of 2% (v / v). After shaking well, it was placed in a 37 °C anaerobic incubator for 36 h. Centrifuged at 8000×g and 4 °C for 15 min, after removing the supernatant, it was washed 2 times with sterile physiological saline, and finally resuspended in a certain volume of 30% glycerol and aliquoted into several 5 mL EP tubes. One tube was taken for bacterial strain identification to ensure the correctness of the strain; another tube was taken for dilution plate coating to determine the concentration of the bacterial suspension; the remaining several tubes were stored at -80 °C.

[0065] (4) Preparation of the bacterial suspension for animal gavage

[0066] One tube of glycerol bacterial liquid was taken out from the -80 °C refrigerator and centrifuged at 4 °C and 8000×g for 10 min. The supernatant was discarded, washed 2 times with sterile physiological saline and then resuspended, and then diluted to a concentration of 5×10 9 CFU / mL to obtain the bacterial suspension of Bifidobacterium longum GDMCC No: 65850 required for gavage.

[0067] Example 1: Bifidobacterium longum GDMCC No: 65850 can alleviate the abnormal expression of circadian rhythm-related genes in the ileum and hypothalamus of mice caused by sleep deprivation

[0068] Twenty male SPF-grade C57BL / 6J mice, 6 - 8 weeks old and weighing 20 ± 2 g, were housed in an experimental environment with a temperature of 22 ± 2°C and a relative humidity of 50 ± 5%. They received a 12-h light cycle every day and had free access to food and water. After 1 week of adaptive feeding, all the mice were randomly divided into 4 groups (5 mice in each group) and treated for 28 days. The grouping and treatment methods of the animals are shown in Table 1.

[0069] Table 1 Grouping and treatment methods of animals

[0070]

[0071] Note: During the treatment, except for the blank group, all the mice were subjected to 19 hours of sleep deprivation every day for 28 consecutive days.

[0072] The method used for animal modeling was the modified multi-platform method (MMPM), which can simultaneously deprive multiple animals of sleep without affecting their free movement and food intake. Each sleep deprivation device consisted of 1 large water tank (40×30×20 cm) and 8 small platforms (diameter 3 cm, height 4 cm, with a 3-cm interval between each platform). The small platforms were fixed inside the large water tank, and the water level in the tank was 1 - 2 cm below the plane of the platforms. The distance between the small platforms was approximately 4 cm, and the mice could easily move between the platforms and maintain their free movement, food intake, and water intake. When the mice entered rapid eye movement sleep, muscle relaxation would cause them to easily fall into the water. Therefore, to avoid falling from the platforms, the mice always maintained a standing position and could not sleep normally. During the sleep deprivation period, the water at the bottom of the tank should remain clear, and the temperature should be maintained at 20 - 25°C. The mice in the blank group were placed in a special water tank equipped with 4 large platforms (diameter 12 cm, height 4 cm), and the platforms were large enough for them to sleep normally. The sleep deprivation period was from 14:00 in the afternoon to 9:00 in the morning the next day.

[0073] After the last sleep deprivation ended (at 9:00 am), the mice were sacrificed under isoflurane anesthesia. Fresh tissue samples (ileum, hypothalamus) of 50 - 100 mg were collected from each mouse, and 1 mL of Trizol and two zirconium beads were added. At 4°C, the tissue was homogenized at 65 - 70 HZ for 30 s, and this was repeated 3 - 5 times. Subsequently, it was left to stand overnight in a 4°C refrigerator. 0.2 mL of chloroform was added, vortexed for 15 s, and then incubated at room temperature for 15 min until layered. Centrifuged at 12000×g for 15 min at 4°C. At this time, the RNA was contained in the colorless aqueous phase in the upper layer. The upper aqueous phase (containing RNA) was transferred to a new tube, and 1 volume of isopropanol pre-cooled to 4°C was added. After shaking well, it was left to stand at -20°C for more than 30 min to precipitate the RNA. Centrifuged at 12000×g for 10 min at 4°C. At this time, the total RNA would exist as a white gelatinous precipitate at the bottom of the EP tube. The supernatant was aspirated with a pipette, and the precipitate was retained. 1 mL of pre-cooled 75% ethanol (prepared with DEPC water) was added to wash the precipitate, and it was left to stand at room temperature for 5 min. The precipitate was gently vortexed and then centrifuged at 12000 rpm / min for 5 min at 4°C, and the supernatant was discarded completely. The RNA tube was dried in a vacuum or in air for 5 - 10 min until the RNA became translucent. 20 - 50 μL of DEPC water was added to resuspend the RNA, and it was shaken up and down. Finally, the resuspended solution was incubated at 55 - 60°C for 10 - 15 min, and then immediately placed on ice. The obtained total RNA solution should be stored at -80°C.

[0074] RNA quality assessment and concentration determination were performed using a NanoDrop 2000 ultra - micro spectrophotometer. The RNA purity (A260 / A280) should be between 1.8 - 2.0. Subsequently, it was reverse - transcribed into cDNA using a Novizan RNA reverse transcription kit, and real - time quantitative PCR reactions were carried out. The samples were mixed with the fluorescent dye ChamQ Universal SYBR qPCR Master Mix. The qPCR system was as follows: 5 μL of Mix, 1 μL of cDNA, 0.5 μL of forward primer, 0.5 μL of reverse primer, and made up to a total volume of 10 μL with ddH2O. The thermal cycling protocol included an initial denaturation at 95°C for 30 s, 40 denaturation cycles at 95°C for 5 s, and annealing / extension at 60°C for 30 s. After PCR amplification, a melting curve analysis (range from 65°C to 95°C, increment of 0.5°C) was performed to verify the specificity of the amplified fragment. Detection was carried out on a real - time fluorescence quantitative gene amplification instrument CFX384 Real - Time System (Bio - Rad, USA). Three parallel wells were set up for each sample, and the housekeeping gene GAPDH was used as an internal reference. Through 2 -ΔΔCt Calculate the relative change level of the target gene, where ΔΔCt=(Ct 目的基因 -Ct 管家基因 ) 实验组 -(Ct 目的基因-Ct 管家基因 ) 对照组 , Table 2 lists the sequences of related primers.

[0075] Table 2 Primer sequences of mouse rhythm genes

[0076] Primer Name Sequence (3’-5’) GAPDH-F CAAGGAGTAAGAAACCCTGGA GAPDH-R CGAGTTGGGATAGGGCCTCT Bmal1-F CTCCAGGAGGCAAGAAGATTC Bmal1-R ATAGTCCAGTGGAAGGAATG Per3-F GAGAGGCACACTAAGCCCAG Per3-R GCCGCGAAGGTATCTGTGTT Cry1-F CCCAGGCTTTTCAAGGAATGGA Cry1-R GCAGGGAGTTTGCATTCATTCG

[0077] Bmal1, Per3, and Cry1 are key components of the core clock transcription / translation feedback loop. The normal expression of these genes plays an important role in the balance of circadian rhythm and the maintenance of the host's learning and memory ability. Related studies have shown that the deletion of Bmal1 in the forebrain impairs the function of the hippocampus, leading to short-term and long-term memory function defects. Mutations and abnormal expressions of Per3 and Cry1 can affect the transcription and translation of other core clock genes, resulting in severe circadian rhythm disorders, causing sleep decline and cognitive impairment. The qPCR results are as Figure 1 shown. Compared with the blank control group, the mRNA expression level of Bmal1 in the ileum of the sleep deprivation model group decreased significantly by 37.00% (p < 0.001), the mRNA expression level of Per3 increased significantly by 70.49% (p < 0.001), and the mRNA expression level of Cry1 increased significantly by 27.55% (p < 0.01); the mRNA expression level of Bmal1 in the hypothalamus increased significantly by 25.96% (p < 0.05), the mRNA expression level of Per3 increased significantly by 36.34% (p < 0.05), and the mRNA expression level of Cry1 decreased significantly by 34.13% (p < 0.01). It can be seen from this that the abnormal expressions of Bmal1, Per3, and Cry1 genes in the ileum and hypothalamus after sleep deprivation indicate circadian rhythm disorders in mice. After intervention with GDMCC No: 65850, compared with the model group, the mRNA expression level of Bmal1 in the ileum increased by 51.32% (p < 0.01), the mRNA expression level of Per3 decreased by 76.61% (p < 0.001), and the mRNA expression level of Cry1 decreased by 67.74% (p < 0.001); the mRNA expression level of Bmal1 in the hypothalamus decreased by 20.34% (p < 0.05), the mRNA expression level of Per3 decreased by 9.72%, but there was no significance, and the mRNA expression level of Cry1 increased by 48.76% (p < 0.05). Therefore, GDMCC No: 65850 can inhibit central and peripheral rhythm disorders caused by sleep deprivation and improve the cognition of mice.

[0078] After melatonin intervention ( Figure 1) Compared with the model group, the mRNA expression level of Bmal1 in the ileum increased by 132.22% (p < 0.001), the mRNA expression level of Per3 decreased by 78.36% (p < 0.001), and the mRNA expression level of Cry1 decreased by 55.20% (p < 0.001); the mRNA expression level of Bmal1 in the hypothalamus decreased by 38.25% (p < 0.001), the mRNA expression level of Per3 decreased by 46.75% (p < 0.001), and the mRNA expression level of Cry1 increased by 46.74% (p < 0.05). Especially for the expression of the Cry1 gene in the ileum and hypothalamus, GDMCC No: 65850 had an equivalent regulatory effect to melatonin. The results showed that GDMCC No: 65850 and melatonin exhibited similar rhythm regulatory effects and could both regulate the expression of rhythm genes in the ileum and hypothalamus to a certain extent.

[0079] Example 2: Bifidobacterium longum GDMCC No: 65850 can improve the cognitive and memory behaviors of sleep-deprived mice

[0080] An animal model was established according to the method of Example 1, and mouse behavioral tests were performed on the 15th day after sleep deprivation. The open field test and elevated plus maze were used to evaluate the anti-anxiety characteristics of mice, and the water maze and Y maze were used to evaluate the cognitive function of mice. All mice were transferred to the behavioral test room at least 30 minutes before the start of the test to adapt to the conditions of the behavioral test room. All tests were carried out between 8:00 and 17:00.

[0081] (1) Water maze

[0082] The water maze was used to evaluate the spatial learning and memory ability of mice. The water maze test was carried out in a circular bucket with a diameter of 120 cm and a height of 35 cm. The water maze was divided into four quadrants. A platform was placed in the center of the first quadrant of the maze and hidden 1 cm below the water surface. Milk powder was added to the water to make it opaque. The water maze experiment included a continuous 5-day place navigation experiment and a 1-day spatial exploration experiment. In the place navigation experiment, each mouse was trained 2 times a day, with an interval of 2 - 3 h between each trial. Each mouse was placed in the water from different quadrants each time, and the time (escape time) it took for each mouse to find the hidden platform within 60 s was recorded. If the mouse could not find the platform within 60 s, the escape time for that time was recorded as 60 s, and at the same time, the mouse was guided to the platform and observed standing on the platform for 10 s. On the 6th day, the hidden platform was removed for the spatial exploration experiment to conduct a memory retention test. Each mouse was placed in the water from the third quadrant, and the movement path of the mouse within 60 s, the time (escape time) it took to reach the center of the original platform for the first time, and the residence time at the position and in the quadrant where the original platform was located were recorded.

[0083] AsFigure 2 As shown in A, after 5 consecutive days of positioning navigation experiments, the time for each group of mice to find the platform became shorter and shorter. Among them, on the 5th day, compared with the model group, the escape time of the GDMCC No: 65850 intervention group was significantly reduced by 71.96% ( Figure 2 A, p < 0.001), indicating that the intervention of GDMCC No: 65850 can significantly improve the decline in spatial learning ability caused by rhythm disorder in mice. In the spatial exploration test on the 6th day, compared with the blank group of mice, the model group of mice needed a longer path ( Figure 2 B) and time ( Figure 2 C, p < 0.001, blank 4.27 ± 2.14 s vs model 35.40 ± 5.50 s) to find the center of the original platform, and the exploration time in the third quadrant where the original platform was located was also significantly less than that of the blank group ( Figure 2 D, p < 0.05, blank 32.67 ± 2.03% vs model 15.67 ± 4.93%). After the intervention of GDMCC No: 65850, the speed and accuracy of the mice to find the original platform position were significantly improved, manifested as a significantly shorter path ( Figure 2 B) and a significantly reduced escape time ( Figure 2 C, p < 0.01, GDMCC No: 65850 12.20 ± 8.40 s vs model 35.40 ± 5.50 s). The exploration time in the third quadrant ( Figure 2 D, p < 0.05, GDMCC No: 65850 34.57 ± 8.45% vs model 15.67 ± 4.93%) was significantly increased, indicating that the intervention of GDMCC No: 65850 can improve the decline in spatial learning and cognitive ability caused by rhythm disorder.

[0084] (2) Open field

[0085] The open field test was used to evaluate the exploratory activities and anxiety-like behaviors of mice. The mice were placed in the center of an open field (50 × 50 cm, 30 cm high) and allowed to freely explore for 8 min. The number of explorations, exploration time in the middle area (33 × 33 cm), and exploration path in the whole field of the mice were recorded.

[0086] The results of the open field test are as Figure 3 shown. As can be seen from Figure 3 A, the activity paths of the model group mice were mainly around the open field, while the mice in the blank group and the GDMCC No: 65850 intervention group were more willing to move in the middle area of the open field. The percentages of the residence time of the three groups of mice (blank group, model group, GDMCC No: 65850 intervention group) in the central area of the open field were 44.84 ± 5.15%, 30.35 ± 4.57%, and 44.28 ± 5.87% respectively (Figure 3 B), compared with the model group, the proportion of time spent in the middle area of the open field in the GDMCC No: 65850 intervention group (p < 0.05) was significantly increased, indicating that GDMCC No: 65850 can relieve the anxiety caused by rhythm disorder.

[0087] (3) Y maze

[0088] Mice were individually placed in the center of the Y maze (3 arms, each arm 30 cm long, spaced 120° apart), and allowed to freely explore for 5 min. The number of times each mouse entered all arms and the frequency of alternation between the three arms were recorded. Only when the mouse completely entered one of the arms was it recorded as entering once.

[0089] The results of the Y maze experiment are as Figure 4 shown in A. The percentages of time spent in the central area of the open field for the three groups of mice (blank group, model group, GDMCC No: 65850 intervention group) were 59.75 ± 2.89%, 46.96 ± 4.61%, and 57.08 ± 2.05% respectively. Compared with the model group, the proportion of time spent in the middle area of the open field in the GDMCC No: 65850 intervention group (p < 0.01) was significantly increased, indicating that GDMCC No: 65850 can relieve the decline in spatial memory and cognitive ability caused by rhythm disorder.

[0090] (4) Elevated plus maze

[0091] The elevated plus maze was in a "+" structure, consisting of two open arms (25 × 5 × 0.5 cm), two closed arms (25 × 5 × 16 cm), and a central platform (5 × 5 × 0.5 cm). Each mouse was placed in the central platform area, facing one of the open arms, and allowed to freely move for 5 min. The number of times the mouse entered the open arms and the percentage of time spent on the open arms (when the mouse's nose tip entered an arm, it was recorded as entering that arm once) were recorded.

[0092] The results of the elevated plus maze experiment are as Figure 4 shown in B. The percentages of time spent in the central area of the open field for the three groups of mice (blank group, model group, GDMCC No: 65850 intervention group) were 25.65 ± 2.07%, 17.07 ± 0.28%, and 29.97 ± 5.19% respectively. Compared with the model group, the proportion of time spent in the open arms of the elevated plus maze in the GDMCC No: 65850 intervention group (p < 0.01) was significantly increased, indicating that GDMCC No: 65850 can relieve the anxiety-like behavior of mice caused by rhythm disorder.

[0093] Melatonin can reduce the exploration path ( Figure 2 B) and the localization time ( Figure 2C, 7.4 ± 2.42 s, p < 0.001), increased the time of mice in the central area of the open field ( Figure 3 , 43.71 ± 1.74%, p < 0.05) and the exploration time of the open arms of the elevated plus maze ( Figure 4 B, 33.28 ± 2.86%, p < 0.001), as well as increased the alternation frequency of mice in the Y maze ( Figure 4 A, 59.25 ± 1.85%, p < 0.01). In the water maze, Y maze, elevated plus maze, and open field tests conducted, GDMCC No: 65850 showed similar effects in improving cognitive ability and relieving anxiety as melatonin. Therefore, GDMCC No: 65850 has the potential to replace the drug (melatonin) in relieving rhythm disorders and the induced cognitive decline.

[0094] Example 3: Bifidobacterium longum GDMCC No: 65850 can improve the gut microbiota of sleep - deprived mice

[0095] An animal model was established according to the method of Example 1. Fresh feces of mice were collected at the end of the 5th week. The total DNA in the fecal samples of mice was extracted using the MP fecal kit. The specific operation steps mainly referred to the kit instructions. Using the total DNA of each sample as a template, the V3 - V4 region was amplified by PCR according to the primers (341F: 5’ - CCTAYGGGRBGCASCAG - 3’, 806R: 5’ - GGACTACNNGGGTATCTAAT - 3’). The PCR system (50 μL) was: 2 μL DNA template, 1.5 μL 341F, 1.5 μL 806R, 20 μL ddH2O, and 25 μL Taq mix. The PCR program was: 95°C, 5 min; 95°C, 30 s; 50°C, 30 s; 72°C, 30 s, for 30 cycles; 72°C, 10 min. A 2.0% agarose gel was prepared and electrophoresed at 120 V for 30 - 40 min. After electrophoresis, the target bands were recovered from the gel according to the QIAquick Gel Extraction Kit instructions, and the concentration and purity of the gel - recovered DNA were measured and recorded using a NanoDrop 2000 ultra - micro spectrophotometer. The library was constructed according to the TurSeq DNA LT Sample Preparation Kit and its instructions, and finally sequenced on an Illumina Miseq sequencer according to the MiSeq Regent Kit and its instructions. The downloaded data was processed for sequence data using the QIIME2 analysis pipeline, and principal coordinates analysis (PCoA) was performed using the LC - Bio cloud website (https: / / www.omicstudio.cn / tool).

[0096] Alpha diversity and beta diversity were used to evaluate the changes in the diversity of fecal microbiota ( Figure 5 ). Among them, alpha diversity was characterized by the Shannon index, and the results showed ( Figure 5 A) that the Shannon index of the model group was significantly increased (p < 0.001), which might be related to the proliferation of conditional pathogenic bacteria in the intestine. After the intervention of GDMCC No: 65850, the Shannon index was significantly decreased to near the normal level (p < 0.001). Beta diversity was evaluated by PCoA, and the results showed ( Figure 5 B) that there were significant differences among the blank group, the model group and the GDMCC No: 65850 intervention group (p < 0.001). From the perspective of the relative abundance changes at the phylum level, the relative abundance of Proteobacteria in the model group was significantly higher than that in the blank group (p < 0.001). Proteobacteria included a variety of pathogenic bacteria such as Escherichia coli, Salmonella, and Vibrio cholerae. After the intervention of GDMCC No: 65850, the relative abundance of Proteobacteria decreased significantly (p < 0.001), indicating that GDMCC No: 65850 could reduce the relative abundance of harmful bacteria in the intestine, improve the intestinal microbiota disorder caused by dysrhythmia, and restore the health of the intestinal microbiota.

[0097] Example 4: Bifidobacterium longum GDMCC No: 65850 can improve the synthesis of intestinal metabolites in sleep-deprived mice

[0098] An animal model was established according to the method of Example 1. Fresh feces of mice at the end of the 5th week were collected, and a pre-cooled (-20 °C) mixed solution of methanol-acetonitrile-water (2:2:1, v / v / v) and two zirconia beads were added, and vortexed for 30 s. Then, tissue disruption was carried out at 4 °C and 65 - 70 HZ for 30 s, and repeated 3 - 5 times. Ultrasonic extraction was performed in an ice-water bath for 20 min, and then left standing at -20 °C for 30 min. Then, centrifugation was carried out at 13000 rpm / min at 4 °C for 15 min, and finally 200 μL of the supernatant was taken for LC-MS analysis. Chromatographic column conditions: ACQUITY UPLC BEH Amide column (Water, 1.7 μm, 2.1 mm × 100 mm), mobile phases A and B were aqueous phase and acetonitrile respectively. The eluent in the positive mode was 0.01% acetic acid + H 2 2O (mobile phase A), and the eluent in the negative mode was 50% ACN + 50% IPA (mobile phase B). The temperature was 35 °C, the flow rate was 0.3 mL / min, and the injection volume was 2 μL. The processing of the original data was completed using Compound Discover software, and then data analysis was carried out using the metabolic analysis website (https: / / www.metaboanalyst.ca).

[0099] Volcano plot analysis showed that there were 60 metabolites with significant differences between the blank group and the model group (FC > 1.5 or < 0.67, and p < 0.05). Sleep deprivation-induced circadian rhythm disorders caused a decrease in 43 metabolites including 2'-deoxyguanosine and phenylacetaldehyde, and an increase in 17 metabolites including sphingosine ( Figure 6 A). However, intervention with GDMCC No: 65850 could reduce the level of sphingosine and increase the levels of 2'-deoxyguanosine and phenylacetaldehyde ( Figure 6 B). Studies have shown that excessive accumulation of sphingosine has neurotoxicity and can damage the cognitive function of the host. 2'-Deoxyguanosine is one of the precursor substances for DNA synthesis, participates in the process of DNA replication and repair, and plays a crucial role in maintaining the normal physiological functions of cells. These indicate that circadian rhythm disorders can lead to changes in the levels of intestinal metabolites in mice, and intervention with GDMCC No: 65850 can regulate these metabolic changes, thereby promoting host health. In addition, compared with the model group, intervention with GDMCC No: 65850 can also increase the levels of adenosine, guanosine, inosine, and N,N-dimethylglycine ( Figure 6 B). Adenosine can integrate the cues between sleep / wake behavior and circadian rhythm, and the adenosine signaling pathway is related to the repair of damaged intestinal barriers. Guanosine, inosine, and N,N-dimethylglycine have anti-inflammatory and immunomodulatory effects, can reduce the inflammatory response, and protect the nervous system function. In summary, it can be seen that intervention with GDMCC No: 65850 can promote the generation of neuroprotective metabolites and reduce the decline in cognitive ability caused by circadian rhythm disorders.

[0100] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A strain of Bifidobacterium longum GDMCC No: 65850, characterized in that: The Bifidobacterium longum was deposited in the Guangdong Provincial Microbiological Culture Collection Center on January 23, 2025, with a collection number of GDMCC No: 65850, and the collection address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. A microbial preparation containing the Bifidobacterium longum GDMCC No: 65850 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that In the microbial preparation, the number of cells of Bifidobacterium longum GDMCC No: 65850 is not less than 5×10 9 CFU / g or 5×10 9 CFU / mL.

4. A product containing Bifidobacterium longum GDMCC No: 65850 according to claim 1 or the microbial preparation according to claim 2 or 3, characterized in that: The products include food, medicine or health products.

5. Use of the Bifidobacterium longum GDMCC No: 65850 according to claim 1 or the microbial preparation according to claim 2 or 3 in the preparation of a drug having a circadian rhythm regulating effect.

6. The use according to claim 5, characterized in that The medicine is used for treating circadian rhythm disorder caused by insomnia.

7. The use according to claim 5 or 6, characterized in that: The medicine further contains a drug carrier and / or a pharmaceutical excipient.

8. The use according to any one of claims 5 to 7, characterized in that: The drug has at least one of the following functions: (a) Regulate biological circadian rhythms; (b) Improve anxiety-like emotions caused by circadian rhythm disorders; (c) Improve the decline in exploration and memory abilities caused by circadian rhythm disorders.

9. A drug for regulating circadian rhythm, characterized in that: Contains the Bifidobacterium longum GDMCC No: 65850 described in claim 1.

10. Use of the Bifidobacterium longum GDMCC No: 65850 of claim 1 in the preparation of a health product that helps improve memory loss caused by insomnia or in the preparation of a health product that helps improve sleep.

Images