DNA (deoxyribonucleic acid) drug delivery platform of ultrahigh-dose load compressed nucleic acid, preparation method and application of DNA drug delivery platform

Abstract

A preparation method of a DNA drug delivery platform for ultrahigh-dose load compressed nucleic acid comprises the following steps: selecting a CpG type according to disease types, mixing a DNA template with a phosphorylated 5'end and containing a CpG sequence with a first primer solution, adding a T4 ligase buffer solution and ultrapure water, mixing to form a cyclization system, and heating and annealing in a PCR (Polymerase Chain Reaction) instrument; adding a T4DNA ligase solution, reacting overnight, and inactivating the ligase after the reaction is finished, so as to obtain a circular DNA template; the method comprises the following steps: adding phi29 DNA polymerase, a 10 * phi29 buffer solution, a mixed solution of dATP, dTTP, dCTP and dGTP and Milli-Q into a circular DNA template, mixing to form a reaction solution, and putting the reaction solution into a constant-temperature uniform mixing instrument for reaction; then, adding a second primer and a third primer, and carrying out constant-temperature reaction to form a DNA drug delivery platform; and after the reaction is finished, inactivating the polymerase, and terminating the reaction. The invention also provides application of the DNA drug delivery platform in preparation of drugs for treating cancers or inflammatory diseases. The device can be used for super-compressing and efficiently loading nucleic acid drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a drug delivery platform, specifically a DNA drug delivery platform for ultra-high dose loading of compressed nucleic acids, a preparation method thereof, and an application thereof. Background Art

[0002] Currently, nucleic acids (DNA or RNA) are used as drugs for gene therapy or immunotherapy due to their unique advantages and are widely applied to tumors, genetic diseases, and preventive infectious diseases, etc. For example, in the field of tumor treatment, DNA drugs composed of non-coding, unmethylated cytosine-phosphate-guanine oligodeoxynucleotides (abbreviated as CpG ODNs) can be recognized by toll-like receptor 9 (TLR9) in the endosomes of antigen-presenting cells (APCs), induce cellular and humoral immunity, enhance the body's immune response, and have become a very promising nucleic acid drug.

[0003] So far, more than a dozen DNA drugs based on CpG ODNs have officially entered human clinical trials as vaccine adjuvants, anti-allergens, and cancer immunotherapeutic agents. However, all nucleic acid-based therapies (including CpG ODNs) have chemical instability under physiological conditions and are easily digested by nucleases in the body, resulting in rapid degradation, which severely limits their potency in the body and greatly hinders clinical translational applications.

[0004] Currently, in CpG-mediated immunotherapy, in order to alleviate the degradation problem, natural DNA with a traditional phosphodiester bond backbone is replaced with a phosphorothioate bond. Since the phosphorothioate-modified phosphate backbone is not a substrate for nucleases, it can resist nuclease degradation. However, phosphorothioate-modified DNA can only be obtained by de novo chemical synthesis, its length is limited to about 100 bases, and the synthesis cost is relatively high. More importantly, different from natural DNA, phosphorothioate-modified CpG drugs are not natural substrates of any metabolic pathway and have obvious in vivo toxic and side effects. Repeated injection of high-dose phosphorothioate CpG will trigger acute toxicity in the body, cause dose-dependent splenomegaly, lead to kidney damage, and cause other immune-related toxicity manifestations of over-activation and even death.

[0005] Nucleic acids (DNA / RNA), as the endogenous genetic material that constitutes living organisms and also a kind of polymer material, not only have excellent biocompatibility but also possess precise molecular manipulation and sequence programmability. Through the on-demand design of their base sequences, they can be precisely functionalized, efficiently realizing properties such as drug loading and intelligent response-controlled release, and are an ideal drug carrier. In the past few decades, targeted therapies based on nucleic acid materials as carriers (such as DNA hydrogels, DNA tetrahedrons, spherical nucleic acids, etc.) have been developed for the research and exploration of diseases such as cancer and have attracted extensive attention. The precise programmability and endogeneity of nucleic acids make them have significant advantages as drug carriers, showing great clinical application value. Summary of the Invention

[0006] In view of the above technical problems in the prior art, the present invention provides a DNA drug delivery platform for compressing nucleic acids with ultra-high dose loading, a preparation method thereof, and an application thereof. The DNA drug delivery platform for compressing nucleic acids with ultra-high dose loading, the preparation method thereof, and the application thereof are to solve the technical problems of low nucleic acid drug loading efficiency, large side effects, easy degradation, and easy generation of cytotoxicity in the prior art.

[0007] The present invention provides a preparation method for a DNA drug delivery platform for compressing nucleic acids with ultra-high dose loading, comprising the following steps:

[0008] 1) Select the CpG type according to the disease type, mix the DNA template phosphorylated at the 5' end and containing the CpG sequence with the first primer solution, add 10×T4 ligase buffer and Milli-Q ultrapure water to form a cyclization system, and perform heat annealing in a PCR instrument.

[0009] 2) Add T4 DNA ligase solution to step 1), react overnight at 4°C. After the reaction ends, inactivate the ligase to finally obtain a circular DNA template.

[0010] 3) Add phi29 DNA polymerase, 10×phi29 buffer, and a mixed solution of dATP, dTTP, dCTP, and dGTP to the circular DNA template, and mix with Milli-Q to form a reaction solution. Place the reaction solution in a thermostatic mixer and react at 37°C.

[0011] 4) Then, design the second primer and the third primer according to the sequence of the circular DNA template, and add the second primer and the third primer to the reaction solution in step 3)

[0012] and react at a constant temperature of 37°C to form a DNA drug delivery platform; after the reaction ends, inactivate the polymerase to terminate the reaction.

[0013] In step 1), the temperature program for amplification in the PCR instrument is 2 min at 95°C, followed by a 1°C decrease every 1 min. After 91 cycles, it reaches 4°C.

[0014] In step 1), the DNA template concentration is 500 nM and the primer 1 concentration is 500 nM.

[0015] In step 2), the T4 DNA ligase concentration is 10 U / μL.

[0016] In step 3), the phi29 DNA polymerase concentration is 0.1 U / μL.

[0017] In step 4), the primer 2 and primer 3 concentrations are 50 μM.

[0018] The DNA template sequence is:

[0019] 5’-phosphateTAGTTTTCCATGACGTTCCTGACGTTAAGCAGTATTATGAACTCTCCATGAGCTTCCTGAGCTTGATGTTCCTAACCTACCA.

[0020] The first primer sequence is: 5’-GTCATGGAAAACTATGGTAGGTTAGGAAC.

[0021] The second primer sequence is: 5’-AAGCAGTATTATGAACTC.

[0022] The third primer sequence is: 5’-TGGTAGGTTAGGAACATC.

[0023] The present invention also provides a DNA drug delivery platform obtained by the above method.

[0024] The present invention also provides the application of the above DNA drug delivery platform in the preparation of drugs for treating cancer or inflammation.

[0025] Further, the cancer is triple-negative breast cancer.

[0026] The present invention also provides the use of the above DNA drug delivery platform as a drug carrier.

[0027] A DNA drug delivery platform for super-condensing ultra-high dose nucleic acids (Super-condensed ultra-high dose DNA, named scudDNA) of the present invention is composed of ultra-long DNA chains, which are formed by rolling circle amplification enzymatic reaction (Rolling circle amplification, RCA) and multi-primed chain amplification enzymatic reaction (multi-primed chain amplification, MCA). The long DNA chains formed by RCA and MCA amplification self-condense and super-compress to form dense scudDNA through physical entanglement and the action of magnesium pyrophosphate generated in situ. Its particle size is 100 nm to 2.5 μm, and it is spherical flower-shaped, and can carry any type of nucleic acid drugs such as CpG, siRNA, ASO, etc.

[0028] Compared with the existing technologies, the technological progress of the present invention is remarkable. The scudDNA of the present invention innovatively super-concentrates millions of copies (doses) of CpG motifs into a nano-drug, and the degree of its compression is similar to that of 3 chromosomes in which DNA is super-compressed by histones. By optimizing the reaction conditions, the size of scudDNA can be precisely regulated to achieve precise control of the number of DNA drugs carried. scudDNA is an immune cell-targeted self-release system, and does not cause any measurable toxicity, can induce enhanced or weakened macrophage immune responses in vitro, and significantly inhibit tumor growth or achieve the treatment of inflammatory diseases in vivo. The scudDNA platform can carry any combination of ultra-high doses of different CpG motifs, or any therapeutic nucleic acid drug, providing a general delivery platform for all nucleic acid-based drug therapies. Brief Description of the Drawings

[0029] Figure 1 It is a polyacrylamide gel electrophoresis characterization diagram of a circular template and a rolling circle amplification product.

[0030] Figure 2 It is a scanning electron microscope characterization diagram of scudDNA.

[0031] Figure 3 It is a confocal fluorescence microscope observation characterization diagram of the uptake of scudDNA by RAW264.7 cells;

[0032] Figure 4 It is a scanning electron microscope diagram of the release of scudDNA in different pH buffers.

[0033] Figure 5 It is a scanning electron microscope characterization of scudDNA incubated in pH 7.4 and pH 4.0 buffers.

[0034] Figure 6It is to measure the concentrations of inflammatory cytokines TNF-α and IL-6 in macrophages stimulated by scud DNA by ELISA.

[0035] Figure 7 It is scud DNA +CpG Inhibitory effect on tumor proliferation in triple-negative breast cancer mice Specific implementation manners

[0036] The following further illustrates the present invention in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention rather than to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are carried out according to conventional methods and conditions, or are selected according to the product specifications.

[0037] Example 1 Synthesis and characterization of DNA circular templates

[0038] Synthesis: For triple-negative breast cancer, DNA templates and primer 1 were designed (see Table 1). First, 2.5 μL of 10 μM 5'-end phosphorylated single-stranded DNA template solution, 2.5 μL of 10 μM primer 1 solution, 5 μL of 10×T4 ligase buffer, and 40 μL of Milli-Q ultrapure water were mixed to form a 50 μL circularization system. Subsequently, the circularization system was placed in a PCR instrument and the temperature program was executed: 2 min at 95 °C, then cooled by 1 °C per minute, and after 91 cycles, it reached 4 °C.

[0039] Then, 1.25 μL of 400 U / μL T4 DNA ligase solution and 1.25 μL of 50 mM ATP solution were added to the 50 μL circularization system, and the reaction was carried out overnight at 4 °C. After the reaction ended, the ligase was inactivated at 65 °C for 10 min, and finally circular DNA (cirDNA) was obtained and stored in a 4 °C refrigerator for later use.

[0040] Next, 5 μL of cirDNA, 5 μL of 10×phi29 buffer, 6 μL of 100 mM dNTP mix (1.25 μL of 100 mM each of dATP, dTTP, dCTP, dGTP), 1 μL of 100 mM DTT, 0.5 μL of 10 U / μL phi29 DNA polymerase, and 33.5 μL of Milli-Q were mixed to form a 50 μL reaction solution. The reaction solution was placed in a constant temperature mixer, and the reaction was carried out at 37 °C for 4 h for RCA amplification.

[0041] The DNA template and primer 1 are listed as DNA ID NO:1 to DNA ID NO:2 respectively.

[0042] Characterization: Through 8% polyacrylamide gel electrophoresis (PAGE), according to the different band positions of DNA with different molecular weights in the gel, the successful formation of circDNA and RCA products was proved. AsFigure 1 As shown, the band shifted backward after the formation of circDNA, and the band was in the well after the formation of RCA products.

[0043] Table 1 DNA sequences involved in the examples

[0044]

[0045]

[0046] Synthesis and characterization of the end product scudDNA in Example 2

[0047] Synthesis: DNA primers 2 and 3 were designed according to the sequence of the circular template. Then, 50 μM primers 2 and 3 were added to the RCA product, and incubated at 37 °C for 16 h to form scudDNA. After the reaction, the polymerase was inactivated at 65 °C for 10 min to terminate the reaction.

[0048] Characterization: The reaction solution was centrifuged at 10,000 rpm for 5 min, and the lower precipitate was retained. After washing 3 times with Milli-Q, it was dispersed in Milli-Q solution and stored at 4 °C. The morphology and size of scudDNA were characterized by scanning electron microscopy (SEM). As Figure 2 shown, scudDNA was spherical flower-shaped with a size of about 1.3 μm.

[0049] Table 2 DNA sequences involved in the examples

[0050] Name Sequence (5’-3’) Number Primer 2 5’-AAGCAGTATTATGAACTC SEQ ID NO:3 Primer 3 5’-TGGTAGGTTAGGAACATC SEQ ID NO:4

[0051] Observation of the uptake behavior of ScudDNA by macrophages Raw264.7 in Example 3

[0052] Raw264.7 cells were cultured in 400 μL DMEM medium containing 10% fetal bovine serum. The culture conditions were: 37 °C, 5% CO 2 , saturated humidity. The Raw264.7 cells were seeded at 1.7×10 5Cells were seeded at a density of [number] cells / well in 4-well glass slides (ThermoFisher Scientific) and allowed to adhere overnight. Cy3-labeled scudDNA ([amount]) was added to the 4-well glass slides and incubated at 37 °C or 4 °C for 8 h. Then, the cells were washed three times with 500 μL of PBS and fixed with PBS containing 4% paraformaldehyde for 15 minutes. After incubation in PBS containing 0.1% Triton-X-100 for 4 minutes, the cells were stained with Alexa-488 phalloidin (Life Technologies) for filamentous actin on the cell membrane. Then, the glass slides were incubated with DAPI to stain the cell nuclei. After sealing the glass slides with nail polish, imaging was performed using an LSM710 confocal microscope (Carl Zeiss).

[0053] Results: After incubation for 8 h, the fluorescence intensity of ScudDNA in cells incubated at 37 °C was significantly higher than that incubated at 4 °C. Confocal fluorescence microscopy imaging of cells showed Figure 3 .

[0054] Example 4 Release of scudDNA in different pH buffers

[0055] ScudDNA was incubated in 100 mM PBS buffer at pH 7.4, 6.5, and 6.0 or 100 mM sodium acetate buffer at pH 5.5, 5.0, 4.5, and 4.0 at 37 °C for 2 h. After centrifugation of the solution, the remaining scudDNA was collected. The released DNA was quantified by measuring the absorbance of the supernatant at 260 nm. In addition, SEM was used to image and characterize scudDNA incubated in pH 7.4 and pH 4.0 buffers.

[0056] Results: As the solution was acidified, DNA was gradually released from scudDNA. Low pH dissolved magnesium pyrophosphate in scudDNA, exposing the therapeutic CpG motif. The absorbance results of incubation in different pH buffers are shown in Figure 4 , and the SEM characterization results of incubation in pH 7.4 and pH 4.0 buffers are shown in Figure 5 .

[0057] Example 5 Evaluation of the in vitro immunostimulatory effect of scudDNA

[0058] Mouse macrophage Raw264.7 cells were seeded at a density of 1.6×10 5 cells / well in a 48-well cell culture plate and allowed to adhere overnight. ScudDNA loaded with different concentrations of CpG (named scudDNA +CpGTreat macrophages for 8 h and 24 h respectively as the experimental group. The control group is the uncompressed short-chain CpG sequence named shortDNA +CpG . Use ELISA to measure the concentrations of TNF-α and IL-6 in the cell supernatant

[0059] Results: As Figure 6 shown, as the number of CpGs carried by scudDNA increases, the concentrations of TNF-α and IL-6 also increase, indicating that scudDNA can successfully stimulate and regulate the immune response

[0060] Example 6 Verification of the therapeutic effect of scudDNA on breast cancer mice

[0061] Select 6-8-week-old female BALB / c mice to establish a breast cancer animal model. Use depilatory cream to depilate the area near the third pair of mammary glands on the right side of the mice, and use a moist cotton ball to wipe off the shed mouse hair and the remaining depilatory cream. Use surgical scissors to cut open the outer epidermis of the third pair of mammary gland appendages of the mice, and inoculate 4T1 cells (5×10 5 / mouse) into the right third pair of mammary fat pads of the mice. The day of tumor inoculation is recorded as day 0. Randomly divide the tumor-bearing BALB / c mice into 4 groups with 5 mice in each group. When the tumor size grows to 80 mm 3 , the following preparations are used for treatment: PBS, control scudDNA -CpG , control shortDNA +CpG and scudDNA +CpG , where scudDNA +CpG is used as the positive control group. Administer the drug 2 times a week for a total of 5 times, and observe the tumor size of the mice

[0062] Results: As Figure 7 shown, compared with the tumors in the control group, the tumor volume of the mice treated with scudDNA +CpG is significantly smaller, indicating that the proliferation of orthotopic tumors in BALB / c mice is effectively inhibited by scudDNA +CpG

[0063] The above is only the preferred embodiment of the present invention and is not intended to limit the scope of the present invention. The above embodiments of the present invention can be variously changed. That is, all simple, equivalent changes and modifications made according to the claims and the content of the specification of the present invention application fall within the protection scope of the claims of the present invention. What is not described in detail in the present invention is all conventional technical content​

Claims

1. A method for preparing a DNA drug delivery platform for ultra-high-dose loaded compressed nucleic acid, characterized in that The following steps are involved: 1) Select the CpG type according to the disease type, mix the 5'-end phosphorylated DNA template containing the CpG sequence with the first primer solution, add 10×T4 ligase buffer and Milli-Q ultrapure water to form a circularization system, and heat and anneal in a PCR instrument; 2) adding T4 DNA ligase solution to step 1) and reacting at 4°C overnight. After the reaction is completed, inactivating the ligase to finally obtain a circular DNA template; 3) Add phi29 DNA polymerase, 10×phi29 buffer, dATP, dTTP, dCTP, dGTP mixed solution to the circular DNA template, and mix with Milli-Q to form a reaction solution. Place the reaction solution in a constant temperature mixer and react at 37°C. 4) Then, the second primer and the third primer are designed according to the sequence of the circular DNA template, and the second primer and the third primer are added to the reaction solution of step 3) and reacted at 37° C. to form a DNA drug delivery platform; after the reaction is completed, the polymerase is inactivated to terminate the reaction.

2. The method for preparing a DNA drug delivery platform for ultra-high-dose loaded compressed nucleic acid according to claim 1, characterized in that: In step 1), the temperature program for heating annealing in the PCR instrument is 95°C for 2 minutes, followed by a temperature decrease of 1°C per minute, and reaching 4°C after 91 cycles; In step 1), the concentration of the DNA template is 500 nM, and the concentration of primer 1 is 500 nM; The concentration of T4 DNA ligase in step 2) is 10U / μL; The concentration of phi29 DNA polymerase in step 3) is 0.1U / μL; In step 4), the concentration of the second primer and the third primer is 50 μM.

3. The method for preparing a DNA drug delivery platform for ultra-high-dose loaded compressed nucleic acid according to claim 1, characterized in that: The DNA template sequence is: 5'-phosphateTAGTTTTCCATGACGTTCCTGACGTTAAGCAGTATTATGAACTCTCCATGAGCTTCCTGAGCTTGATGTTCCTAACCTACCA.

4. The method for preparing a DNA drug delivery platform for ultra-high-dose loaded compressed nucleic acid according to claim 1, characterized in that: The first primer sequence is: 5'-GTCATGGAAAACTATGGTAGGTTAGGAAC; The second primer sequence is: 5'-AAGCAGTATTATGAACTC; The third primer sequence is: 5'-TGGTAGGTTAGGAACATC.

5. The DNA drug delivery platform obtained by the preparation method according to claim 1.

6. Use of the DNA drug delivery platform according to claim 5 in the preparation of drugs for treating cancer or inflammation.

7. The use according to claim 5, characterized in that: The cancer is triple-negative breast cancer.

8. Use of the DNA drug delivery platform of claim 5 as a drug carrier.

Images