Cell lines with krt31 gene knockout and their use in promoting picornaviridae virus replication and / or producing picornaviridae virus vaccines

By targeting and knocking out the KRT31 gene using CRISPR/Cas9 technology, a cell line with the KRT31 gene-encoded protein losing its function was constructed. This solved the problem of inefficient replication of Picornaviridae viruses and achieved a significant increase in viral titer and antigen yield, making it suitable for the production of Picornaviridae virus vaccines.

CN120053629BActive Publication Date: 2026-06-05LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510187942.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2026-06-05
Estimated Expiration
2045-02-20

Smart Images

  • Figure CN120053629B_ABST
    Figure CN120053629B_ABST
Patent Text Reader

Abstract

The application provides a KRT31 gene knockout cell line and its application in promoting replication of viruses of the Picornaviridae family and / or production of vaccines of viruses of the Picornaviridae family, and belongs to the technical field of genetic engineering. The application provides an application of a KRT31 gene or a coded protein thereof as a target in preparation of a product for regulating replication of viruses of the Picornaviridae family and / or vaccine production. Up-regulation of the expression level of the KRT31 gene can inhibit replication of viruses of the Picornaviridae family, and down-regulation of the expression level of the KRT31 gene can promote replication of viruses of the Picornaviridae family. The application adopts sgRNA to knockout the KRT31 gene to prepare a cell line with lost function of a gene coded protein, so as to promote replication of viruses of the Picornaviridae family, improve virus titer and antigen yield, and help to efficiently prepare vaccines of viruses of the Picornaviridae family.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to KRT31 gene knockout cell lines and their application in promoting the replication of microRNAviridae viruses and / or producing microRNAviridae virus vaccines. Background Technology

[0002] Foot-and-mouth disease virus (FMDV) belongs to the genus FMDV in the family Picornaviridae. It is the pathogen that causes foot-and-mouth disease (FMD), severely affecting cloven-hoofed animals such as pigs, cattle, and sheep. FMDV has 17 serotypes: O, A, C, SAT1, SAT2, SAT3, and Asia. There is no cross-immunity between these serotypes, and developing highly effective vaccines remains the most effective measure for controlling the disease. Screening for cell lines that efficiently replicate the virus is helpful in preparing highly effective vaccines, and related work is urgently needed.

[0003] Senecavirus A (SVA) belongs to the family Picornaviridae and the genus Senecavirus. It is a pathogen that causes vesicular disease in pigs and acute death in newborn piglets. Currently, there is no commercially available SVA vaccine.

[0004] KRT31 (Keratin 31) is a keratin gene belonging to the type I acidic keratin family. It is an important component of intermediate filament proteins, participating in cytoskeleton formation and maintaining the mechanical strength and integrity of epithelial cells. However, to date, there have been no reports on the role of the KRT31 gene in regulating small RNA virus replication. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide the application of the KRT31 gene or its encoded protein as a target in the preparation of products that regulate the replication of microRNAviridae viruses and / or in vaccine production. Upregulating the expression level of the KRT31 gene can inhibit the replication of microRNAviridae viruses, while reducing the expression level of the KRT31 gene can promote the replication of microRNAviridae viruses. Using sgRNA to knock out the KRT31 gene to prepare a cell line with loss of gene-encoded protein function can be used for the production of microRNAviridae viruses and their vaccines, promoting the replication of microRNAviridae viruses and increasing viral titer and antigen yield.

[0006] To achieve the above objectives, the present invention provides an application of the KRT31 gene or its encoded protein as a target in the preparation of products that regulate the replication of microRNAviridae viruses and / or in vaccine production.

[0007] Preferably, the nucleotide sequence of the KRT31 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the KRT31 gene is shown in SEQ ID NO.2; the regulation is to promote or inhibit; upregulating the expression level of the KRT31 gene can inhibit the replication of Picornaviridae viruses, and reducing the expression level of the KRT31 gene can promote the replication of Picornaviridae viruses.

[0008] Preferably, the product that upregulates the expression level of the KRT31 gene includes plasmids or cell lines that overexpress the KRT31 gene; the product that reduces the expression level of the KRT31 gene includes reagents that interfere with or knock out the KRT31 gene.

[0009] Preferably, the reagent for knocking out the KRT31 gene includes sgRNA; the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the target sequence of KRT31-sgRNA1 is shown in SEQ ID NO.3; the target sequence of KRT31-sgRNA2 is shown in SEQ ID NO.4.

[0010] Preferably, the microRNAviridae virus includes foot-and-mouth disease virus and / or Seneca virus.

[0011] The present invention also provides an sgRNA for knocking out the KRT31 gene, wherein the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2;

[0012] The target sequence of the KRT31-sgRNA1 is shown in SEQ ID NO.3;

[0013] The target sequence of the KRT31-sgRNA2 is shown in SEQ ID NO.4.

[0014] Preferably, KRT31-sgRNA1 is a double-stranded fragment formed by annealing KRT31-sgRNA1-F and KRT31-sgRNA1-R; and KRT31-sgRNA2 is a double-stranded fragment formed by annealing KRT31-sgRNA2-F and KRT31-sgRNA 2-R.

[0015] The sequence of the KRT31-sgRNA1-F is shown in SEQ ID NO.5;

[0016] The sequence of the KRT31-sgRNA1-R is shown in SEQ ID NO.6;

[0017] The sequence of the KRT31-sgRNA2-F is shown in SEQ ID NO.7;

[0018] The sequence of the KRT31-sgRNA2-R is shown in SEQ ID NO.8.

[0019] The present invention also provides an expression vector comprising the sgRNA.

[0020] The present invention also provides a method for preparing the expression vector, comprising the following steps: ligating the sgRNA to a Cas9 vector plasmid to obtain an expression vector plasmid containing sgRNA.

[0021] The present invention also provides the application of the sgRNA, the expression vector, and the expression vector obtained by the preparation method in the preparation of a cell line encoding a KRT31 gene protein that has lost its function.

[0022] The present invention also provides a KRT31 gene knockout cell line, wherein the cell line is obtained by knocking out the KRT31 gene in the host cell using the sgRNA, the expression vector, or the expression vector obtained by the preparation method.

[0023] This invention also provides the application of any one of the following S1-S4 in promoting the replication of Picornaviridae viruses or in the production of Picornaviridae virus vaccines:

[0024] S1. The sgRNA;

[0025] S2. The expression vector;

[0026] S3. The expression vector obtained by the preparation method described above;

[0027] S4. The cell line.

[0028] Preferably, the microRNAviridae virus includes foot-and-mouth disease virus and / or Seneca virus.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention provides the application of the KRT31 gene or its encoded protein as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or in vaccine production. Overexpression of KRT31 in host cells can inhibit the replication of Picornaviridae viruses, while inhibiting the expression of the KRT31 gene in host cells can promote viral replication. A sgRNA targeting the KRT31 gene is provided. The sgRNA can target the KRT31 gene, and an expression vector containing the sgRNA constructed using CRISPR / Cas9 technology can achieve the knockout of the KRT31 gene in host cells, with accurate targeting and high knockout efficiency. The KRT31 gene knockout cell line prepared by this invention can significantly promote the replication of Picornaviridae viruses, thereby increasing viral titer and antigen yield. It can be used as a production cell line for Picornaviridae viruses or viral vaccines, producing highly effective vaccines, and has broad application prospects. Attached Figure Description

[0031] Figure 1 The results of Western blot analysis of FMDV replication by KRT31 overexpression in Example 1 are shown.

[0032] Figure 2 This is a schematic diagram of the sgRNA targeting the KRT31 genomic region in Example 2.

[0033] Figure 3 The results of Western blot detection of KRT31 expression in knockout cells in Example 2 are shown.

[0034] Figure 4 The results of KRT31-KO cell viability assay in Example 3 are shown, where ns represents no significant difference.

[0035] Figure 5 The results of Western blot analysis in Example 4 show the difference in viral protein levels between FMDV-infected KRT31-KO cells and control cells.

[0036] Figure 6 The results of RT-qPCR detection of the difference in mRNA levels between FMDV-infected KRT31-KO cells and control cells in Example 4 are shown. ** indicates P < 0.01, and *** indicates P < 0.001.

[0037] Figure 7 The results of virus titer detection in FMDV-infected KRT31-KO cells and control cells in Example 4 are shown. * indicates P < 0.05, and ** indicates P < 0.01.

[0038] Figure 8 The results are fluorescence analysis of SVA-infected KRT31-KO cells and control cells in Example 5. Detailed Implementation

[0039] This invention provides the application of the KRT31 gene or its encoded protein as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or in vaccine production. In this invention, the nucleotide sequence of the KRT31 gene is shown in SEQ ID NO. 1; the amino acid sequence of the protein encoded by the KRT31 gene is shown in SEQ ID NO. 2. In this invention, the regulation is either promotion or inhibition; upregulating the expression level of the KRT31 gene can inhibit the replication of Picornaviridae viruses, while decreasing the expression level of the KRT31 gene can promote the replication of Picornaviridae viruses. In this invention, the product for upregulating the expression level of the KRT31 gene includes plasmids or cell lines overexpressing the KRT31 gene. The plasmid preferably includes the pcDNA3.1 / myc vector plasmid. This invention does not have a specific limitation on the source of the pcDNA3.1 / myc vector plasmid; any preparation method known in the art or a commercially available product can be used.

[0040] In this invention, the product for reducing the expression level of the KRT31 gene includes reagents for interfering with or knocking out the KRT31 gene. Preferably, the reagent for knocking out the KRT31 gene expression level comprises sgRNA and a Cas9 vector plasmid; the sgRNA comprises KRT31-sgRNA1 and / or KRT31-sgRNA2; the target sequence of KRT31-sgRNA1 is shown in SEQ ID NO. 3; the target sequence of KRT31-sgRNA2 is shown in SEQ ID NO. 4. In this invention, the interference is performed using RNAi technology to interfere with the expression of the KRT31 gene, and the knockout is performed using gene editing technology to silence the expression of the KRT31 gene. The gene editing technology preferably includes CRISPR, and more preferably CRISPR / Cas9 technology. In this invention, the microRNAviridae virus is preferably foot-and-mouth disease virus and / or Seneca virus.

[0041] This invention involves the preparation of products regulating the replication of microRNAviridae viruses, including the preparation of products that inhibit the replication of microRNAviridae viruses and products that promote the replication of microRNAviridae viruses. The product that inhibits the replication of microRNAviridae viruses includes cell lines overexpressing the KRT31 gene or the protein encoded by the KRT31 gene and / or drugs or inhibitors against microRNAviruses. The product that promotes the replication of microRNAviridae viruses includes cell lines in which the protein encoded by the KRT31 gene is lost or inhibited.

[0042] This invention provides an sgRNA for knocking out the KRT31 gene, wherein the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the target sequence of KRT31-sgRNA1 is: TTGGGCAGGCAGAAGCTGTA (SEQ ID NO.3); the target sequence of KRT31-sgRNA2 is: CCAGCTGGAGCGGGACAACG (SEQ ID NO.4). In this invention, KRT31-sgRNA1 is a double-stranded fragment formed by annealing KRT31-sgRNA1-F and KRT31-sgRNA1-R; KRT31-sgRNA2 is a double-stranded fragment formed by annealing KRT31-sgRNA2-F and KRT31-sgRNA2-R; KRT31-sgRNA1-F: 5'-CACCGTTGGGCAGGCAGAAGCTGTA-3' (SEQ ID NO.5); KRT31-sgRNA1-R: 5'-AAACTACAGCTTCTGCCTGCCCAAC-3' (SEQ ID NO.6); KRT31-sgRNA2-F: 5'-CACCGCCAGCTGGAGCGGGACAACG-3' (SEQ ID NO.7); KRT31-sgRNA2-R: 5'-AAACCGTTGTCCCGCTCCAGCTGGC-3' (SEQ ID NO.8). The sgRNA described in this invention can specifically target the KRT31 gene, and when combined with CRISPR / Cas9 technology, it can knock out the KRT31 gene in the host cell, resulting in the loss of function of the protein encoded by the KRT31 gene.

[0043] This invention provides an expression vector containing the sgRNA. The expression vector containing the sgRNA is prepared by ligating the sgRNA into a Cas9 vector plasmid. The expression vector of this invention has the effect of causing the loss of function of the protein encoded by the KRT31 gene in host cells. Preferably, the Cas9 vector plasmid includes the PX459 vector plasmid. This invention does not have a particular limitation on the source of PX459; any preparation method known in the art or a commercially available product can be used.

[0044] This invention provides a method for preparing the expression vector, comprising the following steps: ligating the double-stranded sgRNA to a Cas9 vector plasmid to obtain an expression vector plasmid containing sgRNA. As one possible implementation, the expression vector is obtained by annealing the sgRNA to form a double strand and ligating it to a PX459 plasmid. The expression vector plasmid can simultaneously express the Cas9 protein and the targeting sgRNA sequence. In this invention, when preparing the expression vector, the PX459 vector plasmid is linearized by digestion with a restriction endonuclease to obtain a linearized PX459 fragment; the restriction endonuclease is preferably BbsI. In this invention, when annealing the sgRNA and ligating it to the PX459 plasmid, the linearized PX459 fragment and the annealed double-stranded sgRNA are ligated using a T4 ligase.

[0045] This invention provides the application of the sgRNA, the expression vector, or the expression vector obtained by the preparation method in the preparation of KRT31 gene knockout cell lines.

[0046] This invention provides a KRT31 gene knockout cell line, obtained by knocking out the KRT31 gene in host cells using the sgRNA, the expression vector, or an expression vector prepared by the method described above. As one possible implementation, the host cells preferably include PK-15 cells. As another possible implementation, the cell line is a KRT31 gene knockout PK-15 cell line. Knocking out the KRT31 gene has the effect of causing the loss of function of the KRT31 gene-encoded protein in host cells, which can promote the replication of Picornaviridae viruses or the production of Picornaviridae virus vaccines. As one possible implementation method, the construction method of the KRT31 gene knockout PK-15 cell line includes the following steps: (1) preparing sgRNA that knocks out the KRT31 gene; (2) annealing the sgRNA prepared in step (1) and ligating it into the PX459 plasmid to obtain a recombinant vector that simultaneously expresses Cas9 protein and the target sgRNA sequence; (3) transfecting the recombinant vector prepared in step (2) into PK-15 cells and screening them with puromycin antibiotic to obtain the KRT31 gene knockout PK-15 cell line.

[0047] This invention provides the application of any one of the following S1-S4 in promoting the replication of Picornaviridae viruses and / or producing Picornaviridae virus vaccines:

[0048] S1. The sgRNA;

[0049] S2. The expression vector;

[0050] S3. The expression vector obtained by the preparation method described above;

[0051] S4. The cell line.

[0052] In this invention, the microRNAviridae virus is preferably foot-and-mouth disease virus and / or Seneca virus.

[0053] In this invention, the sgRNA, the expression vector, the expression vector obtained by the preparation method, or the cell line can all inhibit the expression of the KRT31 gene in host cells, significantly promote the replication of foot-and-mouth disease virus and Seneca virus of the Picornaviridae family, thereby increasing viral titer and antigen yield, and can be used as a production cell line for Picornaviridae virus and Picornaviridae virus vaccines.

[0054] In this invention:

[0055] The term "loss of protein function" refers to a frameshift mutation in a protein-encoding protein caused by knocking out, mutating, or inserting a portion of the gene into the protein-encoding gene segment, resulting in the protein's inability to perform its normal biological function. This invention achieves loss of function of the KRT31 gene-encoding protein by targeting and knocking out the KRT31 gene in host cells, thereby constructing a cell line with loss of KRT31 gene-encoding protein function, which is then used for vaccine production against viruses such as FMDV and SVA. However, this invention is not limited to KRT31 gene knockout; other techniques can also be used to achieve loss of function of the KRT31 gene-encoding protein and construct cell lines with loss of KRT31 gene-encoding protein function.

[0056] The term "gene editing" refers to targeted transgenic technology that uses site-specific homologous recombination of DNA to change the genetic information of cells or organisms. This mainly includes gene knockout, gene inactivation, gene knock-in, point mutation, deletion mutation, and large-segment deletion of the chromosome. "Gene knockout" specifically refers to the experimental deletion or inactivation of a particular gene in an organism's genome, preventing its expression or production of functional proteins. This invention uses gene knockout technology to knock out the KRT31 gene in host cells. The resulting monoclonal cell lines with loss of KRT31 gene-encoded protein function can promote the replication levels of viruses such as FMDV and SVA. This invention can also construct cell lines with loss of KRT31 gene-encoded protein function by mutating or inserting gene fragments into the KRT31 gene in host cells, causing frameshift mutations in the KRT31 gene-encoded protein.

[0057] The term "sgRNA" stands for single-stranded guide RNA, a key component of the CRISPR / Cas9 gene editing system. It guides the Cas9 nuclease to target sites in the genome through its specific sequence, enabling precise gene editing.

[0058] This invention utilizes CRISPR / Cas9 gene editing technology to specifically knock out the KRT31 gene by designing sgRNAs that target it. The method for KRT31 gene knockout is detailed using PK-15 cells as an example. Although this invention only knocks out the KRT31 gene in PK-15 cells to obtain KRT31 gene knockout cells, the method described herein can be extrapolated and extended to knocking out the KRT31 gene in other host cells, constructing gene knockout cell lines that enhance viral replication and antigen expression of viruses such as FMDV and SVA.

[0059] CRISPR / Cas9 gene editing technology achieves targeted gene recognition and cleavage through sgRNA and Cas9. sgRNA determines the targeting and cleavage activity of Cas9. By designing sgRNAs that target specific genes, Cas9 protein is guided to bind to specific sequence positions within those genes, cleaving the DNA double strand and causing a double-strand break. Under the cell's own repair mechanisms, random mutations occur; nucleotide deletions or insertions alter the gene's reading frame, ultimately leading to the loss of function of the gene-encoded protein and obtaining a cell line with this loss-of-function protein. This invention utilizes CRISPR / Cas9 gene editing technology to screen for sgRNA sequences targeting the KRT31 gene in vitro and in vivo, achieving accurate and efficient knockout of the KRT31 gene. This results in a KRT31 gene knockout cell line that promotes viral replication and antigen expression, such as FMDV and SVA, thus providing new strategies and material support for the production of small RNA virus vaccines like FMDV.

[0060] In the following embodiments of the present invention, the FMDV (O / BY / CHA / 2010 strain) used was deposited by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs; the recombinant Seneca virus Re-SVA-EGFP labeled with EGFP was constructed and preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences; the preparation method was as follows: using gene synthesis technology, the EGFP gene was fused with the Teschovirus 2A gene (T2A) to obtain the EGFP-T2A gene fragment, and the EGFP-T2A fusion gene was inserted between the Seneca virus genes 2A and 2B of the eukaryotic transcription plasmid prSVV / FJ-M (the eukaryotic transcription plasmid prSVV / FJ-M is disclosed in the authorized invention patent "A recombinant nucleic acid of Seneca virus, a recombinant vaccine strain and its preparation method and application", ZL202010212460.6), and the detailed preparation method was obtained according to the corresponding preparation method in the reference: Chen Z. et al (2016). "Construction and characterization of a full-length cDNA infectiousclone of emerging porcine Senecavirus A".Virology.2016,497:111-124)

[0061]

[0062] Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.

[0063] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0064] Example 1: Effect of KRT31 overexpression on FMDV replication

[0065] 1.1 Construction of KRT31 eukaryotic expression plasmid

[0066] The KRT31 gene sequence was retrieved from the NCBI database, and primers were designed as follows: KRT31-NheI-F (SEQ ID NO.11): CGTCTA GCTAGC ATGCCTTACAGCTTCTGCCTGCCC (underlined is the NheI restriction site); KRT31-HindIII-R (SEQ ID NO. 12): CCC AAGCTT GCGCACAAAGGAGCTGCAGGG (underlined indicates HindIII restriction site). RNA was extracted from PK-15 cells, reverse transcribed into cDNA, and used as a template to amplify the KRT31 gene (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2). The amplified fragment was recovered by nucleic acid electrophoresis and double-digested with NheI and HindIII restriction endonucleases. At the same time, the pcDNA 3.1 / myc vector plasmid was double-digested with the same restriction endonucleases. The KRT31 gene and the linearized pcDNA3.1 / myc vector fragment were purified and recovered, respectively. They were ligated overnight at 4°C using T4 ligase, transformed into DH5α competent cells, and the plasmid was extracted and sequenced. The successfully constructed plasmid was named KRT31-Myc.

[0067] 1.2 Effect of KRT31 overexpression on FMDV replication

[0068] PK-15 cells were seeded into 6-well plates and cultured at 37°C in a 5% CO2 cell incubator until the cell density reached approximately 70%. Cells were then transfected with different doses of the KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 1 μg, 2 μg) constructed in section 1.1. After 24 h of culture, the cells were infected with FMDV and Western blot analysis was performed. The results showed that overexpression of KRT31 in PK-15 cells inhibited the abundance of FMDV viral proteins in a dose-dependent manner. Figure 1 ).

[0069] Example 2: Construction of KRT31 gene knockout PK-15 cell line

[0070] 2.1 Design of sgRNA targets

[0071] Based on the KRT31 gene sequence in the NCBI database, two sgRNA sequences, KRT31-sgRNA1 and KRT31-sgRNA2, were designed at positions 117 and 335 of the first exon region of the KRT31 gene, respectively. (See schematic diagram below.) Figure 2 .

[0072] The target sequence of KRT31-sgRNA1 is: TTGGGCAGGCAGAAGCTGTA (SEQ ID NO.3);

[0073] KRT31-sgRNA1-F: 5'-CACCGTTGGGCAGGCAGAAGCTGTA-3' (SEQ ID NO.5) and KRT31-sgRNA1-R: 5'-AAACTACAGCTTCTGCCTGCCCAAC-3' (SEQ ID NO.6) were synthesized based on the targeting sequence of KRT31-sgRNA1.

[0074] The target sequence for KRT31-sgRNA2 is: CCAGCTGGAGCGGGACAACG (SEQ ID NO.4);

[0075] KRT31-sgRNA2-F: 5'-CACCGCCAGCTGGAGCGGGACAACG-3' (SEQ ID NO.7) and KRT31-sgRNA2-R: 5'-AAACCGTTGTCCCGCTCCAGCTGGC-3' (SEQ ID NO.8) were synthesized based on the targeting sequence of KRT31-sgRNA2.

[0076] 2.2 Construction of PX459-KRT31-sgRNA recombinant plasmid

[0077] The synthesized sgRNA upstream and downstream sequences were diluted to 10 μmol / L, and 22.5 μL of each were taken. 5 μL of 10×PCR buffer was added to prepare a 50 μL system, which was then annealed at 95℃ for 5 min to allow the upstream and downstream primers to form double strands. The PX459 vector plasmid was digested with restriction endonuclease BbsI. After 1% agarose gel electrophoresis, the linearized vector fragment was recovered from the gel and ligated with the double-stranded sgRNA using T4 ligase. The ligation was performed on transformed *E. coli* DH5α competent cells. Single colonies were picked and cultured with shaking. Plasmids were extracted and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The positive recombinant plasmids identified by sequencing were named PX459-KRT31-sgRNA1 and PX459-KRT31-sgRNA2, respectively.

[0078] 2.3 Cell transfection and screening

[0079] Press Polyplus According to the transfection reagent instructions, PK-15 cells were transfected with the recombinant sgRNA plasmids PX459-KRT31-sgRNA1 and PX459-KRT31-sgRNA2, respectively. After 24-48 hours of transfection, when the cells had grown into a confluent monolayer, they were passaged with trypsin and puromycin was added to a final concentration of 2 μg / mL. The cells were selected for 3 consecutive days, and then the medium was replaced with complete medium. When the cells grew to about 70%, they were digested with trypsin and counted. The cells were diluted with complete medium containing puromycin and seeded into 96-well cell plates, with 1 cell per well. The cells were cultured at 37°C in a 5% CO2 incubator for 7 days. The wells with single clones of cells in good growth status were observed and labeled, and the cells were passaged into 48-well and 24-well plates for expansion culture.

[0080] 2.4 Identification of Monoclonal Cell Lines

[0081] Different cell clones were collected and identified at both the gene and protein levels. DNA was extracted from the monoclonal cell lines to be identified according to the instructions of the genomic DNA extraction kit. Identification primers were used: KRT31-F: 5'-TATAAATGCTCCCTAGAAGCT-3' (SEQ ID NO. 9); KRT31-R: 5'-GACATATAAAGGCATTGACT-3' (SEQ ID NO. 9). NO.10); Fragments containing sgRNA target sites were amplified, and after 1% agarose gel electrophoresis, the amplification products were recovered from the gel and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were analyzed, and cell lines with frameshift mutations such as gene sequence deletions and insertions were labeled as PK-15-KRT31-KO and named PK-15-KRT31-KO-1, PK-15-KRT31-KO-3, PK-15-KRT31-KO-4, PK-15-KRT31-KO-5 (labeled as KRT31-KO-1, KRT31-KO-3, KRT31-KO-4, KRT31-KO-5, obtained by transfection with recombinant plasmid PX459-KRT31-sgRNA2), and PK-15-KRT31-KO-2 (labeled as KRT31-KO-2, obtained by transfection with recombinant plasmid PX459-KRT31-sgRNA1). Western blot analysis was used to identify the knockout effect of KRT31 at the protein level, confirming the effect in the cell line. Rabbit anti-KRT31 polyclonal antibody was purchased from Abmart. Results are as follows: Figure 3 As shown, no KRT31 protein expression was detected in PK-15-KRT31-KO cells. These results indicate that the KRT31 gene knockout PK-15 cell line was successfully constructed.

[0082] Example 3 Viability assay of KRT31-KO cell line

[0083] The KRT31 gene knockout PK-15 cells (PK-15-KRT31-KO-1, PK-15-KRT31-KO-2) and wild-type control cells (PK-15-KRT31-WT) prepared in Example 2 were digested with trypsin. The cell suspension density was adjusted, and the cells were seeded into 96-well cell culture plates (100 μL / well) and cultured at 37°C in a 5% CO2 incubator for 8 h. Then, 10 μL of CCK-8 solution was added to each well, and the cells were cultured for another 4 h. The OD value at 450 nm was measured using a microplate reader, and the data were analyzed. The results are as follows: Figure 4 As shown, there was no significant difference in cell viability between the KRT31 gene knockout PK-15 cells (PK-15-KRT31-KO-1 and PK-15-KRT31-KO-2) and wild-type control cells, indicating that the knockout of the KRT31 gene does not affect the normal growth characteristics of cells.

[0084] Example 4: Effect of KRT31 gene knockout on FMDV replication

[0085] The effect of KRT31 gene knockout on FMDV replication was investigated using the KRT31 gene knockout PK-15-KRT31-KO-2 cell line prepared in Example 2.

[0086] 4.1 Western blot analysis

[0087] FMDV was used to infect the KRT31 gene knockout PK-15 cell line KRT31-KO and wild-type control cells (PK-15-KRT31-WT), respectively. Protein samples were prepared from the cells at 7 h and 14 h. Rabbit anti-KRT31 antibody, rabbit anti-O type FMDV antibody, and mouse anti-β-Actin antibody were used as primary antibodies, and HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG antibodies were used as secondary antibodies. Western blot analysis was performed. The results showed that the abundance of FMDV viral protein in KRT31 knockout cells was significantly higher than that in wild-type control cells. Figure 5 ).

[0088] 4.2 RT-qPCR Detection and Analysis

[0089] FMDV was used to infect the KRT31 knockout PK-15 cell line KRT31-KO and wild-type control cells (PK-15-KRT31-WT), respectively. Cell samples were collected at 7 h and 14 h. Total RNA was extracted with Trizol and reverse transcribed. GAPDH was used as an internal control gene, and the relative mRNA level of FMDV was quantitatively detected by qPCR. The results showed that at different time points after FMDV infection, the mRNA level of FMDV in the KRT31 knockout cells was significantly increased compared with that in the wild-type control cells. Figure 6 ).

[0090] 4.3TCID 50 Measurement

[0091] FMDV was used to infect KRT31 knockout PK-15 cells and wild-type control cells (PK-15-KRT31-WT). Virus was collected at 7 and 14 hours, and the samples were subjected to three freeze-thaw cycles. The samples were serially diluted 10-fold using DMEM medium and seeded into 96-well plates containing a confluent monolayer of BHK-21 cells, with eight wells per dilution. The plates were incubated at 37°C with 5% CO2 for 3 days. Cytopathic effects were observed, and the TCID of the virus was calculated using the Reed-Muench method. 50 The result is as follows Figure 7The results showed that at different time points, the viral titer of FMDV in KRT31-KO KRT31 knockout PK-15 cells was significantly higher than that in wild-type control cells, indicating that the replication level of FMDV in KRT31 knockout cells was significantly increased compared with wild-type cells.

[0092] All of the above results indicate that knocking out the KRT31 gene can significantly promote the replication level of FMDV.

[0093] Example 5: Effect of KRT31 gene knockout on SVA replication

[0094] Recombinant Seneca virus (Re-SVA-EGFP) labeled with EGFP was used to infect the KRT31 gene knockout PK-15 cell line PK-15-KRT31-KO-2 and wild-type control cells (PK-15-KRT31-WT) prepared in Example 2, respectively, and the cells were observed under a fluorescence microscope. The results showed that after infection with Re-SVA-EGFP, the KRT31 gene knockout PK-15 cells (KRT31-KO) exhibited significantly more green fluorescence than the wild-type control cells. Figure 8 This indicates that SVA replication was significantly increased in cells with the KRT31 gene knocked out compared to wild-type cells.

[0095] The results in summary indicate that the KRT31 gene knockout cell line can significantly promote the replication of microRNAviridae viruses FMDV and SVA, and can be used for the production of microRNAviridae virus vaccines.

[0096] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Reduce KRT31 The application of products with high gene expression levels in the preparation of porcine foot-and-mouth disease virus and / or Seneca virus vaccines is characterized by, Reduce the KRT31 Products for gene expression levels include knockout. KRT31 Gene knockout reagent KRT31 The gene reagent includes sgRNA; the sgRNA is KRT31 -sgRNA1 and / or KRT31 -sgRNA2; the KRT31 The target sequence for -sgRNA1 is shown in SEQ ID NO.3; KRT31 The target sequence for -sgRNA2 is shown in SEQ ID NO.

4.

2. The application as described in claim 1, characterized in that, The KRT31 The nucleotide sequence of the gene is shown in SEQ ID NO.1; KRT31 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.

2.

3. Upward adjustment KRT31 The application of the gene expression level product in the preparation of drugs to inhibit porcine foot-and-mouth disease virus and / or Seneca virus is characterized by, The above adjustment KRT31 Products for gene expression levels include overexpression. KRT31 The plasmid or cell line of the gene.

4. The application of the sgRNA described in A1 or A2, the expression vector described in A3, or the expression vector obtained by the preparation method described in A4 in the preparation of porcine foot-and-mouth disease virus and / or Seneca virus vaccines. A1. A type of knockout KRT31 The sgRNA of the gene, said sgRNA includes KRT31 -sgRNA1 and / or KRT31 -sgRNA2; The KRT31 The target sequence for -sgRNA1 is shown in SEQ ID NO.3; The KRT31 The target sequence for -sgRNA2 is shown in SEQ ID NO.4; A2, as described in A1, sgRNA, the KRT31 -sgRNA1 is produced by KRT31 -sgRNA1-F and KRT31 The double-stranded fragment formed by annealing -sgRNA1-R; KRT31 -sgRNA2 is produced by KRT31 -sgRNA2-F and KRT31 -sgRNA2-R annealing forms a double-stranded fragment; The KRT31 The sequence of -sgRNA1-F is shown in SEQ ID NO.5; The KRT31 The sequence of -sgRNA1-R is shown in SEQ ID NO.6; The KRT31 The sequence of -sgRNA2-F is shown in SEQ ID NO.7; The KRT31 The sequence of -sgRNA2-R is shown in SEQ ID NO.8; A3, an expression vector containing the sgRNA described in A1 or A2; A4. The method for preparing the expression vector as described in A3 includes the following steps: The sgRNA described in A1 or A2 is ligated into the Cas9 vector plasmid to obtain an expression vector plasmid containing sgRNA.

5. A kind KRT31 The application of gene knockout cell lines in the preparation of porcine foot-and-mouth disease virus and / or Seneca virus vaccines is characterized by, The cell line is obtained by knocking out the host cell using the expression vector obtained by the method described in claim 4, such as A1 or A2, A3, or A4. KRT31 Gene acquisition.

Citation Information

Patent Citations

  • Recombinant nucleic acid of seneca virus, recombinant vaccine strain as well as preparation method and application thereof

    CN111394367A

  • Biomarkers for treatment of alopecia areata

    CN108449997A