Burkholderia ZL31 with disease inhibiting and growth promoting functions and application of burkholderia ZL31

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to Burkholderia sp.ZL31 with a disease inhibiting and growth promoting function and application of the Burkholderia sp.ZL31, the Burkholderia sp.ZL31 is preserved in the China Center for Type Culture Collection on September 10, 2024, and the preservation number is CCTCC NO: M 20241950. The Burkholderia sp. ZL31 provided by the invention has antagonistic activity on tomato root rot and a variety of plant pathogenic fungi, shows broad-spectrum bacteriostatic activity, and has good application potential in prevention and treatment of tomato root rot and important fungal diseases of a variety of crops. Meanwhile, the strain has very good inorganic phosphorus dissolving capacity, can generate indole-3-acetic acid (IAA), siderophores and cellulase auxin, can promote tomato growth, provides a good biocontrol resource for prevention and treatment of diseases caused by tomato pathogenic fungi, and has very good application value.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly to a Burkholderia sp. ZL31 with disease inhibition and growth promotion functions and its application. Background Art

[0002] Disclosing the information of this background art section is only intended to increase the understanding of the overall background of the present invention, and it is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Tomato root rot is one of the root infectious diseases with a wide range of damage areas and great impacts on tomatoes, and it is one of the main reasons for tomato yield reduction. This disease mainly harms the roots of tomatoes. On the epidermis of the tomato root infected with root rot, brown or dark brown rot will appear, which is one of the main characteristics of root rot. After the tomato is infected, the plant grows slowly, the lower leaves turn yellow first and gradually develop upward, the leaves wilt, resembling the state of water shortage. When the disease is severe, the whole plant's leaves turn yellow and wither, and the roots rot, ultimately leading to the death of the plant. The pathogen of tomato root rot has a wide host range, and the pathogen has strong survival ability in the soil. Once the disease occurs, it will seriously affect the growth of tomatoes and reduce the yield of tomatoes.

[0004] At present, the prevention and control of tomato root rot in production mainly rely on chemical control and agricultural control. However, the long-term and large-scale use of chemical agents has increasingly prominent problems such as pesticide residues, environmental pollution, enhanced pathogen resistance, and reduced control effects. Therefore, people have gradually turned their attention to other control means. As a green and environmentally friendly control method, biological control is considered to have great development potential. With the increasing harm of tomato root rot, which poses a huge threat to tomato production, screening out biological control strains with good control effects on tomato root rot is an important direction for preventing and controlling tomato root rot, and it is of crucial significance for ensuring the sustainable development of the tomato industry. Summary of the Invention

[0005] In view of this, the present invention provides a Burkholderia sp. ZL31 with disease inhibition and growth promotion functions and its application. Specifically, the present invention isolates a Burkholderia sp. Burkholderia sp. ZL31 from the root soil of a pear tree in Leiyang, determines its taxonomic status through 16S rDNA sequencing, and discovers through antibacterial activity and growth promotion activity that this bacterium has inhibitory effects on various plant pathogenic bacteria such as Alternaria alternata ( Alternaria alternata ), Fusarium oxysporum f. sp. vasinfectum ( Fusarium falciforme ), Neocosmospora ( Neocosmospora rubicola ), Fusarium equiseti ( Fusarium equiseti ), Fusarium oxysporum ( Fusarium oxysporum ), Fusarium solani ( Fusarium solani ), Fusarium fujikuroi (Fusarium fujikuroi It exhibits broad-spectrum antibacterial activity. At the same time, Burkholderia sp. ZL31 of the present invention has strong growth-promoting characteristics, has the ability to dissolve inorganic phosphorus, produce indole-3-acetic acid (IAA), produce siderophores and produce cellulase, and can promote the growth of tomatoes. Based on the above research results, the present invention is completed.

[0006] To achieve the above technical objectives, the present invention provides the following technical solutions: In the first aspect of the present invention, a strain of Burkholderia sp. ZL31 is provided. Burkholderia Burkholderia sp. ZL31 was deposited at the China Center for Type Culture Collection on September 10, 2024, with the deposit number CCTCC NO: M 20241950.

[0007] In the second aspect of the present invention, a derivative of Burkholderia sp. ZL31 is provided, including one or more of its live bacteria, inactivated bacteria, fermentation broth, exosomes or metabolites.

[0008] In the third aspect of the present invention, a microbial agent is provided, including an active ingredient, and the active ingredient includes Burkholderia sp. ZL31 or its derivative.

[0009] Further, the microbial agent includes Burkholderia sp. ZL31 and its fermentation broth.

[0010] In the fourth aspect of the present invention, a preparation method of the above microbial agent is provided. The preparation method includes: inoculating the Burkholderia into an LB liquid medium and fermenting it in a shaker at 30°C, and the culture conditions are pH 7.0±0.2 and the rotation speed is 170-190 r·min -1 , and the fermentation time is 24-48 h.

[0011] In the fifth aspect of the present invention, the application of Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above microbial agent in any one or more of the following is provided: (a) Inhibiting tomato root rot; (b) Inhibiting plant pathogenic bacteria or diseases caused by plant pathogenic bacteria; (c) Promoting the growth of tomatoes; (d) Hydrolyzing inorganic phosphorus; (e) Producing indole-3-acetic acid, siderophores and cellulase; Among them, the plant pathogenic bacteria are Alternaria sp. ( Alternaria alternata ), Fusarium oxysporum f. sp. vasinfectum ( Fusarium falciforme ), Neocosmospora sp. ( Neocosmospora rubicola ), Fusarium equiseti ( Fusarium equiseti), Fusarium solani Fusarium solani ), Fusarium fujikuroi Fusarium fujikuroi ); The tomato root rot refers to the tomato root rot caused by Fusarium oxysporum f. sp. lycopersici Fusarium oxysporum ).

[0012] Further, the promotion of tomato growth is specifically manifested as an increase in the plant length, root length, wet weight, and dry weight of tomato plants.

[0013] In the sixth aspect of the present invention, a method for controlling plant diseases is provided. The method includes spraying or drenching a plant with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned bacterial agent. The plant diseases are caused by Alternaria alternata Alternaria alternata ), Fusarium falciforme Fusarium falciforme ), Neocosmospora Neocosmospora rubicola ), Fusarium equiseti Fusarium equiseti ), Fusarium solani Fusarium solani ), Fusarium fujikuroi Fusarium fujikuroi ); The plant is tomato.

[0014] In the seventh aspect of the present invention, a method for controlling tomato root rot is provided. The method includes spraying or drenching a tomato plant with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned bacterial agent. The tomato root rot refers to the tomato root rot caused by Fusarium oxysporum f. sp. lycopersici Fusarium oxysporum ).

[0015] In the eighth aspect of the present invention, a method for promoting the growth of tomato plants is provided. The method includes soaking seeds and drenching with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned bacterial agent.

[0016] The beneficial technical effects of the above one or more technical solutions: Compared with the prior art, Burkholderia sp. ZL31 provided by the present invention has antagonistic activity against tomato root rot and various phytopathogenic fungi in production, showing broad-spectrum antibacterial activity. In addition, Burkholderia sp. ZL31 provided by the present invention has good ability to dissolve inorganic phosphorus and can produce indole-3-acetic acid (IAA), siderophores and cellulase auxin. Therefore, Burkholderia sp. ZL31 provided by the present invention has good application potential in preventing and controlling tomato root rot and important fungal diseases of various crops. At the same time, Burkholderia sp. ZL31 described in the present invention can promote plant growth, providing good biological control resources for the prevention and control of diseases caused by tomato pathogenic fungi, and also providing reference for the prevention and control of diseases caused by various pathogenic fungi such as peppers and potatoes, laying a foundation for the research and development of new microbial agents, providing new materials for biological control, and having good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0018] Figure 1 It is the colony morphology diagram and microscopic morphology diagram (100x) of Burkholderia sp. ZL31 in Example 1 of the present invention.

[0019] Figure 2 It is the Neighbor-Joining phylogenetic tree constructed based on the 16S rRNA gene sequence alignment results of Burkholderia sp. ZL31 in Example 2 of the present invention.

[0020] Figure 3 It is the antagonistic effect diagram of Burkholderia sp. ZL31 against Fusarium oxysporum f. sp. lycopersici in Example 4 of the present invention.

[0021] Figure 4 It is the antagonistic effect and antibacterial spectrum of Burkholderia sp. ZL31 against various phytopathogenic fungi in Example 5 of the present invention; wherein, A is the phenotype diagram of the Burkholderia sp. ZL31 treatment group and the control group, and B is the antibacterial rate of the Burkholderia sp. ZL31 treatment group.

[0022] Figure 5 It is the qualitative detection phenotype diagram of indole-3-acetic acid (IAA) produced by Burkholderia sp. ZL31 compared with the negative control group and the positive control group in Example 6 of the present invention.

[0023] Figure 6This is the result graph of the growth promotion characteristics of Burkholderia sp. ZL31 on tomato seedlings in Example 6 of the present invention; among them, A is the qualitative detection of inorganic phosphorus solubilizing ability, B is the qualitative detection of cellulase production ability, C is the qualitative detection of siderophore secretion ability, and D is the qualitative detection of indole-3-acetic acid (IAA) production.

[0024] Figure 7 This is the comparison of the growth promotion of Burkholderia sp. ZL31 on tomato seedlings in Example 7 of the present invention; among them, A are the plant seedlings in the Burkholderia sp. ZL31 treatment group, B are the control group seedlings, and C is the comparison after taking pictures after pulling out the seedlings. The two on the left are the control group, and the two on the right are the Burkholderia sp. ZL31 treatment group. Detailed implementation manners

[0025] It should be noted that the following detailed descriptions are all exemplary and are intended to provide further explanations of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs. Unless otherwise stated, the experimental methods disclosed in the present invention all adopt conventional techniques in the art, and the reagents and raw materials used in the examples can be purchased from the market.

[0026] It should be noted that the terms used here are only for describing specific implementation manners and are not intended to limit the exemplary implementation manners according to the present invention application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the term "comprises" or "includes" is used in this specification, it indicates the presence of features, steps, operations, devices, components, or combinations thereof.

[0027] In a typical specific implementation manner of the present invention, a strain of Burkholderia sp. ZL31 is provided. Burkholderia sp. ZL31 was deposited at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on September 10, 2024, and the deposit number is CCTCC NO: M 20241950.

[0028] In another specific implementation manner of the present invention, a derivative of Burkholderia sp. ZL31 is provided, including one or more of its live bacteria, inactivated bacteria, fermentation broth, exosomes or metabolites.

[0029] In the present invention, the term "metabolite" refers to primary metabolites or secondary metabolites produced during the metabolism of microorganisms. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the outside world and generate substances and energy for maintaining life activities through catabolism and anabolism. The products of primary metabolism are primary metabolites, such as monomers like monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, etc., and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, lipids, etc. Secondary metabolism refers to the process by which microorganisms synthesize some substances with no clear function for the life activities of microorganisms during a certain growth period, using primary metabolites as precursors. The products of secondary metabolism are secondary metabolites, mostly compounds with relatively complex molecular structures.

[0030] In the present invention, the metabolite can be obtained from the culture of Burkholderia sp. ZL31. The metabolite can be the sterile metabolite of Burkholderia sp. ZL31 or the metabolite containing the bacteria of Burkholderia sp. ZL31. The sterile metabolite of Burkholderia sp. ZL31 can be prepared by the following method: culturing Burkholderia sp. ZL31 in a liquid medium and filtering out Burkholderia sp. ZL31 in the liquid culture (fermentation broth), thus obtaining the sterile metabolite of Burkholderia sp. ZL31. The metabolite containing the bacteria of Burkholderia sp. ZL31 can be specifically prepared by the following method: culturing Burkholderia sp. ZL31 in a liquid medium and collecting the fermentation broth, which is the metabolite containing the bacteria of Burkholderia sp. ZL31.

[0031] In a specific embodiment of the present invention, the medium can specifically be an LB medium, and no specific limitation is made here.

[0032] In another specific embodiment of the present invention, a bacterial agent is provided, which includes an active ingredient, and the active ingredient includes Burkholderia sp. ZL31 or its derivatives. The active ingredient of the bacterial agent may also contain other biological components or / and non-biological components. Those skilled in the art can determine other active ingredients of the bacterial agent according to the antibacterial effect, disease resistance effect, plant growth promotion effect, and plant seed germination promotion effect.

[0033] Furthermore, the bacterial agent includes Burkholderia sp. ZL31 and its culture.

[0034] In the above-mentioned bacterial agent, the bacterial agent can be a plant pathogen inhibitor, a plant disease inhibitor, a bacterial agent for promoting plant growth, or a biocontrol and growth-promoting bacterial agent.

[0035] In the above-mentioned bacterial agent, the plant pathogen inhibitor can act against Alternaria sp. ( Alternaria alternata ) and Fusarium oxysporum f. sp. vasinfectum ( Fusarium falciforme ), Neocosmospora ( Neocosmospora rubicola), Fusarium equiseti ( Fusarium equiseti ), Fusarium oxysporum ( Fusarium oxysporum ), Fusarium solani ( Fusarium solani ), Fusarium fujikuroi ( Fusarium fujikuroi ), and has an inhibitory effect on the plant disease, which can be tomato root rot.

[0036] In the above microbial agent, in addition to the active ingredient, the microbial agent also contains a carrier. The carrier can be a carrier commonly used in the pesticide field and biologically inert. No specific limitation is made here.

[0037] In the above microbial agent, the dosage form of the microbial agent can be various dosage forms, such as liquid agent, emulsion, suspension, powder, granule, wettable powder or water dispersible granule.

[0038] In another specific embodiment of the present invention, a preparation method of the above microbial agent is provided, and the preparation method includes: inoculating the Burkholderia sp. into an LB liquid medium, fermenting it in a shaker at 30 °C, and the culture conditions are pH 7.0 ± 0.2 and the rotation speed is 170 - 190 r·min -1 , and the fermentation time is 24 - 48 h.

[0039] In the fifth aspect of the present invention, an application of Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above microbial agent in any one or more of the following is provided: (a) Inhibiting tomato root rot; (b) Inhibiting plant pathogenic bacteria or diseases caused by plant pathogenic bacteria; (c) Promoting the growth of tomatoes; (d) Hydrolyzing inorganic phosphorus; (e) Producing indole - 3 - acetic acid, siderophore and cellulase; Among them, the plant pathogenic bacteria are Alternaria alternata ( Alternaria alternata ), Fusarium falciforme ( Fusarium falciforme ), Neocosmospora ( Neocosmospora rubicola ), Fusarium equiseti ( Fusarium equiseti ), Fusarium solani ( Fusarium solani ), Fusarium fujikuroi ( Fusarium fujikuroi ); the tomato root rot refers to the tomato root rot caused by Fusarium oxysporum f. sp. lycopersici ( Fusarium oxysporum ).

[0040] Furthermore, the promotion of tomato growth is specifically manifested as increasing the plant length, root length, wet weight and dry weight of tomato plants.

[0041] In yet another specific embodiment of the present invention, a method for controlling plant diseases is provided. The method includes spraying or drenching a plant with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned microbial agent. The plant diseases are plant diseases caused by Alternaria sp. ( Alternaria alternata ), Fusarium oxysporum f. sp. vasinfectum ( Fusarium falciforme ), Neocosmospora sp. ( Neocosmospora rubicola ), Fusarium equiseti ( Fusarium equiseti ), Fusarium solani ( Fusarium solani ), Fusarium fujikuroi ( Fusarium fujikuroi ); and the plant is tomato.

[0042] In yet another specific embodiment of the present invention, a method for controlling tomato root rot is provided. The method includes spraying or drenching a tomato plant with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned microbial agent. The tomato root rot refers to tomato root rot caused by Fusarium oxysporum f. sp. lycopersici ( Fusarium oxysporum ).

[0043] In yet another specific embodiment of the present invention, a method for promoting the growth of tomato plants is provided. The method includes seed soaking and drenching with Burkholderia sp. ZL31 or a derivative of Burkholderia sp. ZL31 or the above-mentioned microbial agent.

[0044] The present invention will be further explained and illustrated by the following examples, which do not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0045] The formula of the LB medium described in the following examples is: tryptone 10 g, yeast extract 5 g, NaCl 10 g, adjust the pH to 7.0 with 5 mol / L NaOH, and make up the volume to 1 L with deionized water.

[0046] The formula of the PDA medium described in the following examples is: potato 200 g, glucose 20 g, agar 18 g, distilled water 1000 mL.

[0047] The formula of the cellulose detection medium described in the following examples is: potassium dihydrogen phosphate 2 g, ammonium sulfate 4 g, magnesium sulfate heptahydrate 0.5 g, CMC-Na 10 g, sodium chloride 0.5 g, peptone 1 g, agar 15 g, distilled water 1000 mL.

[0048] The formula of the siderophore detection medium (CAS) described in the following examples is: Chrome Azurol-S 60.5 mg, Cetyltrimethylammonium Bromide 72.9 mg, Ferric Chloride Hexahydrate 2.645 mg, Sodium Dihydrogen Phosphate Dihydrate 295.25 mg, Disodium Hydrogen Phosphate Dodecahydrate 1213.5 mg, Ammonium Chloride 125 mg, Potassium Dihydrogen Phosphate 37.5 mg, Sodium Chloride 62.5 mg, Agar 9 g, Distilled Water 1000 mL, pH adjusted to 6.8 ± 0.1.

[0049] The formula of the mid-iron SA liquid medium for quantitative detection of siderophore ability described in the following examples is: Sucrose 20.0 g, L-Asparagine 2.0 g, K 2 HPO 4 0.5 g, Magnesium Sulfate Heptahydrate MgSO 4 ·7H 2 O 0.5 g, 1000 mL of distilled water, sterilized at 121 °C for 20 min.

[0050] The formula of the IAA detection medium described in the following examples is: Mannitol 10 g, Dipotassium Hydrogen Phosphate 0.5 g, Magnesium Sulfate Heptahydrate 0.2 g, Sodium Chloride 0.1 g, Yeast Extract 1 g, Ammonium Nitrate 1 g, L-Tryptophan 0.1 g, 2.5 g / L Congo Red Solution 1%, Distilled Water 1000 mL, pH 7.0.

[0051] The formula of the inorganic phosphorus solubilizing medium described in the following examples is: Glucose 10.0 g, Ammonium Sulfate 0.5 g, Sodium Chloride 0.3 g, Magnesium Sulfate 0.3 g, Manganese Sulfate 0.03 g, Potassium Sulfate 0.3 g, Ferrous Sulfate 0.03 g, Calcium Phosphate 5.0 g, Agar 15.0 g, Distilled Water 1000 mL, pH value is 7.0 - 7.5.

[0052] The formula of the CAS siderophore detection dye solution described in the following examples is: Dissolve 0.079 g of CAS in 50 mL of deionized water, then add 10 mL of 1 mmol / L FeCl 3 solution (containing 12 mmol / L HCl) to obtain solution A; dissolve 0.069 g of Cetyltrimethylammonium Bromide (HDTMA) in 40 mL of deionized water to obtain solution B; slowly add solution A along the wall of the beaker to solution B and stir well to obtain 100 mL of CAS blue detection solution.

[0053] The formula of the Salkowski colorimetric solution described in the following examples is: 18 mol / L H 2 SO 4150 mL of double-distilled water and 250 mL of 0.5 mol / L FeCl 3 7.5 mL.

[0054] The formula of the improved vanadium molybdenum yellow color developing solution described in the following examples is as follows: Prepare a color developing solution by mixing ammonium molybdate solution at 100 g / L, ammonium metavanadate solution at 2.35 g / L, and nitric acid solution (concentrated nitric acid: water = 1:2) in a volume ratio of 1:1:2, and use 0.25 mol / L sodium acetate solution as a buffer.

[0055] Burkholderia in the examples Burkholderia sp. ZL31, abbreviated as: Burkholderia ZL31.

[0056] Example 1 Isolation and screening of strains 1. Sample source The sample soil is from the soil at the root of pear trees in Leiyang, Hunan.

[0057] 2. Screening of strains Take 10 g of rhizosphere soil sample in a conical flask, add 90 mL of sterilized water and several glass beads for shaking and mixing. After mixing at 200 r / min and 37°C for 30 min, use the gradient dilution method to dilute the rhizosphere soil suspension into 5 concentration gradients (1×10 -2 g / mL, 1×10 -3 g / mL, 1×10 -4 g / mL, 1×10 -5 g / mL, 1×10 -6 g / mL). Use a pipette to aspirate 100 μL of the suspension of each gradient for plate coating. Set three replicates for each gradient plate and incubate it upside down in an incubator at 30°C for 3 - 5 d. Select a suitable dilution concentration based on size, color, and morphology as the selection criteria, and pick 6 typical single colonies of different strains. After purifying 3 generations by the three-zone streaking method on LB medium, preserve the screened strains with 25% glycerol and number them. Store them at -20°C for further use.

[0058] 3. Re-screening of antagonistic strains Use the plate confrontation culture method to screen for Fusarium oxysporum Fusarium oxysporum inhibiting bacteria. Place the pathogenic Fusarium oxysporum Fusarium oxysporum fungus cake in the center of the PDA medium. Taking the position of Fusarium as the center, spot 10 μL of different bacterial solutions at a distance of 2.5 cm. Drop 10 μL of LB liquid medium at one place as a blank control group. After the liquid dries, seal it and incubate it upside down at 30°C for 5 d, observe, and select the one that inhibits Fusarium oxysporum Fusarium oxysporum) The strain with better growth results was named strain ZL31, and strain ZL31 was stored at -80℃ for future use.

[0059] Example 2 Identification of strains 1. Morphological identification of strains The strain ZL31 preserved in 25% glycerol was inoculated on the LB medium plate by streak method and cultured at 30℃ for 24h, and then the morphological characteristics of the colonies were observed. Figure 1 .

[0060] Figure 1 The results showed that the colony of strain ZL31 was light yellow and opaque, with raised edges and neat but irregular margins. After Gram staining of strain ZL31, it was found under a microscope that strain ZL31 was a Gram-negative bacterium with a short rod shape.

[0061] 2. Molecular Biological Identification The genome of strain ZL31 was extracted using a genomic DNA extraction kit, and the 16S rRNA gene of strain ZL31 was amplified by PCR using bacterial 16S rDNA universal detection primers (27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1); 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID NO.1)). After identification by agarose gel electrophoresis, it was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The 16S rRNA sequencing sequence was submitted to the GenBank database for BLAST comparison analysis. The phylogenetic tree was constructed using MEGA software, and its phylogenetic tree is shown in Figure 2 .

[0062] The 16S rDNA gene sequence of the strain ZL31 is shown in SEQ ID NO.3.

[0063]

[0064] The results showed that the strain ZL31 obtained by primary screening belongs to the same branch as Burkholderia and has the closest genetic relationship. The strain ZL31 was identified as a new species of the genus Burkholderia, Burkholderia Burkholderia sp. ZL31. Burkholderia ZL31 was deposited at the China Center for Type Culture Collection on September 10, 2024, with the deposit number: CCTCC NO: M 20241950, and the deposit address is Wuhan University, Wuhan, China.

[0065] Example 3 Preparation of the bacterial agent of Burkholderia ZL31 The above-mentioned Burkholderia ZL31 was inoculated into LB liquid medium and fermented in a shaker at 30 °C. The culture conditions were pH 7.0 ± 0.2 and the rotation speed was 170 - 190 r·min -1 , and the fermentation time was 24 - 48 h to obtain the fermentation broth of Burkholderia ZL31 (concentration: 1×10 8 - 1×10 9 CFU / mL), which is the bacterial agent and is stored at 4 °C for later use.

[0066] Example 4 Determination of the antagonistic activity of Burkholderia ZL31 against Fusarium oxysporum f. sp. lycopersici A mycelial cake of Fusarium oxysporum f. sp. lycopersici ( Fusarium oxysporum ) was placed on a PDA medium. After the mycelium covered the entire plate, a mycelial cake was taken from the plate with a 5 mm diameter puncher and placed face-down in the center of the PDA medium containing the plate. With the position of Fusarium oxysporum f. sp. lycopersici as the center, 10 μL of the bacterial solution of Burkholderia ZL31 was spot-inoculated at a distance of 2.5 cm. At one place, 10 μL of LB liquid medium was dropped as a blank control group. After the liquid dried, it was sealed, with 3 replicates set, and cultured in an incubator at 30 °C for 5 - 7 d, and the antibacterial situation was observed and recorded.

[0067] Inhibitory rate of mycelial growth (%) = (control colony diameter - treated colony diameter) / (control colony diameter - 6) × 100%.

[0068] In the formula, the unit of each colony diameter is "cm"; "6" is the initial diameter of the treated colony.

[0069] The antagonistic diagram of Burkholderia ZL31 against Fusarium oxysporum f. sp. lycopersici is as Figure 3 shown, and the antibacterial effect is shown in Table 1.

[0070] Table 1 Antibacterial effect of Burkholderia ZL31 against Fusarium oxysporum f. sp. lycopersici

[0071] The results showed that Burkholderia sp. ZL31 exhibited strong inhibitory activity, with an average antibacterial rate of 67.27 ± 0.7%, indicating that Burkholderia sp. ZL31 had a significant antagonistic effect against Fusarium oxysporum f. sp. lycopersici.

[0072] Example 5 Determination of the broad-spectrum antibacterial spectrum of Burkholderia sp. ZL31 Using the plate confrontation culture method, Alternaria sp. ( Alternaria alternata ), Fusarium falciforme ( Fusarium falciforme ), Neocosmospora ( Neocosmospora rubicola ), Fusarium equiseti ( Fusarium equiseti ), Fusarium fujikuroi ( Fusarium fujikuroi ), and Fusarium solani ( Fusarium solani ) were cultured on PDA medium respectively. After the mycelium covered the entire plate, a mycelial block was punched out on the plate with a 5 mm diameter puncher. One of the mycelial cakes was taken and inoculated face-down onto the center of a new PDA plate. With the position of the mycelial cake as the center, 10 μL of the bacterial solution of Burkholderia sp. ZL31 was spot-inoculated at a distance of 2.5 cm. At one place, 10 μL of LB liquid medium was dropped as a blank control group. After the liquid dried, it was sealed. Three replicates were set and cultured in an incubator at 30 °C for 5 - 7 d, and the antibacterial situation was observed and recorded. The results are shown in Figure 4 . The relative antibacterial rates of Burkholderia sp. ZL31 against each pathogen are shown in Table 2.

[0073] Table 2 Antibacterial effects of Burkholderia sp. ZL31 against 6 plant pathogenic fungi

[0074] The results are as shown in Figure 4 A and B in. Burkholderia sp. ZL31 showed the most significant inhibitory activity against the pathogenic fungi Fusarium falciforme and Fusarium fujikuroi, with relative antibacterial rates of 67.06% and 64% respectively. In addition, the relative antibacterial rate of Burkholderia sp. ZL31 against Alternaria sp. was 46.45%, the relative antibacterial rate of Burkholderia sp. ZL31 against Neocosmospora was 47.05%, the relative antibacterial rate of Burkholderia sp. ZL31 against Fusarium equiseti was 59.5%, and the relative antibacterial rate of Burkholderia sp. ZL31 against Fusarium solani was 59.48%. This indicated that Burkholderia sp. ZL31 had a good antagonistic effect against these 6 pathogenic fungi. Burkholderia sp. ZL31 might directly damage the integrity of the fungal cell membrane or interfere with its metabolic pathway by secreting secondary metabolites (such as antibiotics, lipopeptides) or competitive inhibition (such as siderophore deprivation).

[0075] Example 6 Determination of the growth-promoting characteristics of Burkholderia sp. ZL31 The inorganic phosphorus solubilization, cellulase production, siderophore secretion and indole-3-acetic acid (IAA) production activities of Burkholderia sp. ZL31 were determined by the plate method, and the inorganic phosphorus solubilization, siderophore secretion and indole-3-acetic acid (IAA) production of Burkholderia sp. ZL31 were quantitatively determined.

[0076] (1) Determination of inorganic phosphorus solubilization ability: Burkholderia sp. ZL31 was inoculated onto an inorganic phosphorus solid medium and cultured in an incubator at 30 °C for 2 - 5 d. Colonies with clear zones were selected for observation and recording. The single colonies formed on the medium were subcultured on the inorganic phosphorus medium three times consecutively to obtain primary strains. The soluble index SI = d / D was calculated, where d is the diameter of the halo and D is the diameter of the colony. The criteria for judging phosphorus solubilization ability were as follows: low (SI < 2), medium (2 < SI < 3), and high (SI > 3). The results are shown in Table 3 and Figure 6 as shown in A of

[0077] Quantitative detection of inorganic phosphorus solubilization ability: The detection solution was a modified vanadomolybdophosphoric yellow colorimetric solution. Preparation of the phosphorus standard curve: A stock solution of a phosphorus standard solution at 100 μg / mL was prepared using dried potassium dihydrogen phosphate, and then diluted into phosphorus standard solutions at 5, 20, 35, 50, 65, 80, and 95 μg / mL, respectively. The standard solution was prepared once for each experiment and used immediately. Detection was carried out using the vanadomolybdophosphoric yellow method. 1 mL of the test sample, 2 mL of the colorimetric solution, and 1 mL of the sodium acetate buffer solution were mixed well and allowed to stand for 10 min. Then, the absorbance value at OD415 was measured using a UV-visible spectrophotometer. The standard curve was plotted with the OD415 value as the abscissa and the phosphorus content (μg / mL) as the ordinate. Among them, the standard curve was y = 123.46x - 12.889, and R2 was 0.9998, indicating that the detection method had high feasibility.

[0078] The activated Burkholderia sp. ZL31 was inoculated into LB medium and placed on a shaker for shaking culture at 30 °C and 200 r / min for 72 h. The bacterial solution of Burkholderia sp. ZL31 was centrifuged at 4 °C and 12,000 rpm for 5 min to collect the supernatant. 1 mL of the supernatant, 2 mL of the colorimetric solution, and 1 mL of the sodium acetate buffer solution were mixed well and allowed to stand for 10 min for the color reaction. The OD415 value was measured using a UV-visible spectrophotometer. The phosphorus content in the fermentation broth per unit volume was calculated through the obtained standard curve equation. After determination, the OD415 value of Burkholderia sp. ZL31 was 0.588, and substituting it into the standard curve, the phosphorus content was 59.704 μg / mL. This performance was superior to previously reported Burkholderia strains in terms of phosphorus solubilization ability.

[0079] Burkholderia sp. ZL31 can decompose insoluble tricalcium phosphate in the culture medium into inorganic phosphorus (such as phosphate ions) that can be utilized by plants. By detecting the change in the concentration of inorganic phosphorus in the culture solution, the phosphorus-solubilizing ability of Burkholderia sp. ZL31 can be effectively evaluated. The increase in the concentration of inorganic phosphorus in the culture solution is positively correlated with the phosphorus-solubilizing ability of Burkholderia sp. ZL31. The more the inorganic phosphorus concentration increases, the stronger the phosphorus-solubilizing ability indicates.

[0080] (2)Determination of cellulase production ability: Inoculate Burkholderia sp. ZL31 onto the cellulose detection medium and place it in an incubator at 30 °C. After colonies grow on the medium, add 1 mg / mL congo red and stain for 10 - 15 minutes, then wash with 1 mol / L sodium chloride 2 - 3 times, and observe whether a clear zone appears. The result is as Figure 6 shown in B of []. After 3 washes, a clear zone appears around the colonies of Burkholderia sp. ZL31, indicating the ability to produce cellulase.

[0081] (3)Determination of siderophore production ability: Use the spot inoculation method to inoculate Burkholderia sp. ZL31 on the CAS detection plate and culture at 30 °C for 48 h. If the strain has the ability to produce siderophores, then on the CAS detection plate, an obvious orange-yellow clear zone will appear around the colonies. Record the size, color, and morphological characteristics of the orange-yellow halo produced. At the same time, calculate the halo ratio, i.e., the solubility index SI. Solubility index SI = d / D (SI ≥ 1.5 is determined as a strong siderophore-producing strain). Among them, d is the halo diameter and D is the colony diameter. The results are shown in Table 3 and Figure 6 C of []. An obvious orange-yellow clear zone appears around the colonies of Burkholderia sp. ZL31, indicating the ability to produce siderophores, and the solubility index SI is 3.0, which is a strong siderophore-producing strain.

[0082] Table 3 Colony size, halo diameter of Burkholderia sp. ZL31 for dissolving inorganic phosphorus and producing siderophores

[0083] Quantitative detection of siderophore production ability: The medium is iron-limited SA liquid medium, and the detection solution is CAS siderophore detection dye solution. Inoculate the strain into the iron-limited SA liquid medium and culture it at 37 °C with shaking at 180 rpm for 48 h. After centrifuging the bacterial liquid at 10,000 rpm for 10 min, take the supernatant, mix it with the freshly prepared CAS detection solution in equal volume, invert it several times to mix thoroughly, let it stand in the dark for 1 h, and then measure the absorbance at 630 nm (As). Set three replicates and take the average value of the measurement results. Zero with double-distilled water as a control, and take the absorbance value measured by mixing the blank iron-limited liquid medium and the CAS detection solution in equal volume as the reference value Ar. The formula for calculating the siderophore activity unit is: Su (%) = [(Ar - As) / Ar] × 100).

[0084] The absorbance value Ar of the blank SA liquid medium was 0.334. The A630 nm value was positively correlated with the siderophore content. The siderophore activity was calculated to be 85.84% according to the formula using the measured values. As / Ar was 0.142, indicating a strong siderophore secretion ability.

[0085] (4)Indole-3-acetic acid (IAA) determination method: Burkholderia sp. ZL31 was inoculated onto the IAA solid detection medium and cultured in an incubator at 28 °C for 2 - 5 d, then observed and recorded. The single colonies formed on the medium were successively subcultured 3 times on the IAA detection medium to obtain the primary strain. The Salkowski colorimetric method was used to determine the IAA production ability of the strain. The purified Burkholderia sp. ZL31 was cultured overnight in LB liquid medium to prepare a fermentation broth. 0.5 mL of the fermentation broth was inoculated into 50 mL of LB medium containing 3 mmol / L L-tryptophan and cultured on a shaker at 30 °C and 180 rpm for 48 h. 1 mL of the fermentation broth was centrifuged at 4 °C and 10,000 r / min for 5 min. 300 μL of the supernatant was taken into a 2 mL centrifuge tube, and 300 μL of Salkowski color reagent was added for color reaction. A 300 μL of 60 mg / L IAA standard solution was used as a positive control, and LB medium without bacterial solution was used as a negative control. It was left to stand at room temperature in the dark for 30 min, and the color change was observed. The results were as Figure 5 shown. The color of the LB medium added with the Burkholderia sp. ZL31 bacterial solution turned red, indicating that Burkholderia sp. ZL31 had the ability to produce IAA.

[0086] IAA quantitative detection: The detection solution was Salkowski colorimetric solution. Drawing of the IAA standard curve: 10 mg of IAA was accurately weighed. The sample was first dissolved in a small amount of ethanol and then made up to 100 mL with distilled water to prepare a stock solution with a concentration of 100 μg / mL for standby. Then the stock solution was diluted into a series of standard solutions with concentrations of 0 (blank), 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, 25.0 μg / mL. The standard solution was prepared once for each experiment and used immediately after preparation. 1 mL of the IAA standard solution was added successively and mixed with 4 mL of Salkowski reaction reagent, and incubated at 40 °C for 30 min. Heating was to accelerate the color development. The absorbance value of the reaction solution at a wavelength of 530 nm was measured. With the OD530 value as the abscissa and the IAA concentration (μg / mL) as the ordinate, a standard curve was drawn, and the equation y = 67.567x - 0.3845, R2 = 0.9996 was obtained. The activated bacteria were inoculated into LB medium supplemented with L-tryptophan (final concentration 500 μg / mL). The control was LB medium containing 500 μg / mL L-tryptophan without inoculation. The mixture was placed on a shaker and cultured at 30 °C and 200 r / min for 48 h. The bacterial solution was centrifuged at 4 °C and 10,000 rpm for 10 min, and the supernatant was collected. The supernatant was mixed with an equal volume of Salkowski colorimetric solution, and the mixture was allowed to stand in the dark for 30 min for color development reaction. The OD530 value was measured. Using the blank LB liquid medium and Salkowski colorimetric solution mixed in equal volume as the control, the relative content was calculated based on the IAA content standard curve. After measurement, the OD530 value of Burkholderia sp. ZL31 was 0.318. Substituting it into the formula, the IAA content was 21.102 μg / ml.

[0087] In summary, Burkholderia sp. ZL31 has the ability to dissolve inorganic phosphorus, produce cellulase, secrete siderophores and indole-3-acetic acid (IAA); its strong ability to dissolve inorganic phosphorus (transparent circle diameter 4.4 mm > 4 mm) indicates that it can activate soil-insoluble phosphates, may perform prominently in phosphorus-deficient soils, and improve phosphorus availability; its strong siderophore secretion ability (soluble index SI is 3.0 ≥ 1.5) reflects its strong competitive absorption mechanism for iron elements, with dual functions of nutrient supply and pathogen inhibition; the production of cellulase and IAA confirms its ability to decompose organic matter and stimulate plant root development. Burkholderia sp. ZL31 exhibits high plant growth-promoting potential through multiple synergistic mechanisms of phosphorus dissolution, siderophore production, IAA and cellulase.

[0088] Example 7 Growth-promoting effect of Burkholderia sp. ZL31 The treatment method of seed soaking with the bacterial agent containing Burkholderia sp. ZL31 prepared in Example 3 and 7-day root irrigation was used in this experiment. Tomato seeds of the same size and plumpness were selected, disinfected with 75% ethanol for 1 min, rinsed with sterile water 2 - 3 times, disinfected with 3% sodium hypochlorite solution for 10 min, rinsed with sterile water multiple times and then soaked in sterile water. After taking them out after 24 h at 28 °C, they were ready for use. The tomato seeds were soaked in the Burkholderia sp. ZL31 bacterial agent for 5 h and subjected to seed soaking in a constant temperature incubator at 30 °C, with sterile water soaking as the control group. After the seed soaking was completed, the tomato seeds were transplanted into a seedling tray containing sterilized soil, covered with a small amount of sterile soil on the surface of the seeds, and placed in a constant temperature light incubator for cultivation at 26 - 28 °C with 16 h of light. On the 7th day of tomato seedling growth, 2 mL of the Burkholderia sp. ZL31 bacterial agent was added to the roots of the seedlings in the treatment group, and 2 mL of sterile water was added to the roots of the seedlings in the control group. After 30 days of cultivation, the growth conditions of the seedlings in the Burkholderia sp. ZL31 bacterial agent group and the control group were as shown in Figure 7 A and B in the figure, and after the seedlings were dug out and rinsed with tap water, as shown inFigure 7 As shown by C in [reference], the surface moisture was blotted with sterilized filter paper to determine the fresh weight, and the plant length and root length were measured. Then the whole plant was dried at 80 °C for 48 h to determine the dry weight. The relevant data were statistically analyzed, and the results are shown in Table 4.

[0089] Table 4 Effects of Burkholderia sp. ZL31 inoculant on the growth of tomato seedlings

[0090] As can be seen from Table 4, by using the treatment methods of soaking seeds with Burkholderia sp. ZL31 inoculant and irrigating roots for 7 days, the plant length, root length, fresh weight and dry weight of tomato seedlings were all significantly increased. It shows that Burkholderia sp. ZL31 inoculant can promote the growth of tomato seedlings.

[0091] In summary, Burkholderia sp. ZL31 provided by the present invention has a significant antagonistic effect against tomato root rot, has antagonistic activity against a variety of phytopathogenic fungi, has good ability to dissolve inorganic phosphorus, and can produce indole-3-acetic acid (IAA), siderophores and cellulase. It can promote the growth of tomato seedlings, providing a new path and resource for the biological control of tomato root rot and various crop fungal diseases, and also providing an optional strain for the control of other important diseases and the research and development of new biocontrol bacterial preparations, contributing to the development of the biological control field.

[0092] It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the given examples, those of ordinary skill in the art can modify or equivalently replace the technical solutions of the present invention as needed, without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A strain of Burkholderia ZL31, Burkholderia Burkholderia sp.ZL31 was deposited in the China Center for Type Culture Collection on September 10, 2024, with the deposit number CCTCC NO:M 20241950.

2. A derivative of Burkholderia ZL31 according to claim 1, characterized in that Including one or more of its live bacteria, inactivated bacteria, fermentation broth, exosomes or metabolites.

3. A bacterial agent, characterized in that: The invention comprises an active ingredient, wherein the active ingredient comprises the Burkholderia ZL31 according to claim 1 or the derivative according to claim 2.

4. The bacterial agent according to claim 3, characterized in that The bacterial agent comprises Burkholderia ZL31 and fermentation broth thereof.

5. The method for preparing the bacterial agent according to claim 3 or 4, characterized in that: The preparation method comprises: inoculating the Burkholderia into LB liquid culture medium, placing the culture medium in a shaking incubator at 30°C for fermentation, the culture conditions being pH 7.0±0.2, and the rotation speed being 170-190 r·min -1 The fermentation time is 24~48 hours.

6. Use of the Burkholderia ZL31 of claim 1 or the derivative of claim 2 or the bacterial agent of any one of claims 3 to 4 in any one or more of the following: (a) Inhibit tomato root rot; (b) suppressing plant pathogens or diseases caused by plant pathogens; (c) promoting tomato growth; (d) hydrolysis of inorganic phosphorus; (e) production of indole-3-acetic acid, siderophores and cellulases; in, The plant pathogen is Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti )、Fusarium solani( Fusarium solani )、Fusarium fusariotii( Fusarium fujikuroi ); The tomato root rot refers to tomato root rot caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.

7. The use according to claim 6, characterized in that The tomato growth promotion is specifically manifested in increasing the plant length, root length, wet weight and dry weight of the tomato plants.

8. A method for preventing and controlling plant diseases, characterized in that: The method comprises spraying or root irrigation treatment on plants using the Burkholderia ZL31 according to claim 1 or the derivative according to claim 2 or the bacterial agent according to claims 3-4, wherein the plant disease is caused by Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti )、Fusarium solani( Fusarium solani )、Fusarium fusariotii( Fusarium fujikuroi ) Plant diseases caused by The plant is tomato.

9. A method for preventing and controlling tomato root rot, characterized in that: The method comprises spraying or root irrigation treatment on tomato plants with Burkholderia ZL31 described in claim 1 or the derivative described in claim 2 or the bacterial agent described in claims 3-4, wherein the tomato root rot refers to tomato root rot caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.

10. A method for promoting the growth of tomato plants, characterized in that: The method comprises using the Burkholderia ZL31 described in claim 1 or the derivative described in claim 2 or the bacterial agent described in claims 3-4 for seed soaking and root irrigation treatment.

Images