Application of reagent for detecting phosphorylation level of ADSL T350 in preparation of triple negative breast cancer diagnosis and prognosis product

Abstract

The invention belongs to the technical field of breast cancer diagnosis products, and particularly relates to application of a reagent for detecting the phosphorylation level of ADSL T350 in preparation of triple negative breast cancer diagnosis and prognosis products. Starting from analysis of a mechanism that an innate immune signal channel in triple negative breast cancer (TNBC) is inhibited, it is found that a key metabolic enzyme adenylate succinate lyase (ADSL) in purine nucleotide de novo synthesis shows high expression in TNBC, and IKKbeta-mediated ADSL T350 is phosphorylated due to hypoxia stimulation; and phosphorylation of ADSL T350 is a main reason for inhibition of the STING-mediated innate immune signal pathway in TNBC. The phosphorylation level of ADSL T350 is in negative correlation with the activation level of STING in a breast cancer sample and the infiltration degree of cytotoxic immune cells, and it is indicated that prognosis of a breast cancer patient is poor.

Description

Technical Field

[0001] The present invention belongs to the technical field of breast cancer diagnostic products, and particularly relates to the application of a reagent for detecting the phosphorylation level of ADSL T350 in the preparation of diagnostic and prognostic products for triple-negative breast cancer. Background Art

[0002] Triple-Negative Breast Cancer (TNBC) is a subtype of breast cancer. Triple-negative means that estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER-2) are negative. Compared with other breast cancer subtypes, TNBC usually shows stronger aggressiveness, faster growth rate, easier metastasis, and an extremely high recurrence rate. Since TNBC does not express ER, PR, or HER-2, commonly used targeted therapies (such as endocrine therapy or HER2-targeted therapy) are difficult to be effective for it. Therefore, the treatment of TNBC usually relies on chemotherapy, but the curative effects vary, making the development of new TNBC treatment strategies extremely urgent.

[0003] STING (Stimulator of interferon genes) is a key receptor protein in the innate immune response signaling pathway. STING can recognize cyclic dinucleotides (CDN) in the cytoplasm and activate the innate immune response. Cyclic dinucleotides mainly come from 2’3’-cGAMP synthesized by the mammalian cytoplasmic DNA receptor cGAS (Cyclic GMP-AMP synthase). After 2’3’-cGAMP binds to STING, it causes a conformational change in STING, and then STING is transported from the endoplasmic reticulum to the Golgi apparatus. STING recruits the TBK1 kinase and the IRF3 transcription factor in the Golgi apparatus, promoting the phosphorylation and dimer formation of IRF3. IRF3 transfers to the nucleus, inducing the expression of type I interferon (Type I IFN) and inflammatory factors, thereby activating the innate immune response. Some studies have shown that STING activation can enhance the function of tumor-specific T cells and improve the immune response of tumor-infiltrating lymphocytes, which is of great significance in tumor immunotherapy.

[0004] Hypoxia is a prominent feature of the tumor microenvironment and a hallmark of many solid tumors. Oxidative stress-induced mitochondrial DNA leakage is an important source of cytoplasmic dsDNA accumulation in tumor cells. Although tumor cells produce high levels of cytoplasmic DNA during tumorigenesis, many cancers, including TNBC, have evolved inactivation of the STING signaling pathway to evade the immune surveillance mechanisms triggered by the inherent activation of STING within tumor cells, which greatly limits the clinical application of STING agonists in immunotherapy. Currently, the mechanism of STING signaling pathway inactivation in TNBC remains unknown. The present invention discovers that in normal breast epithelial cells, the cGAS-STING signaling pathway is activated in response to hypoxia stimulation, while the activation level of the STING signaling pathway in TNBC is significantly reduced. Therefore, revealing the mechanism by which the innate immune signaling pathway is inhibited in TNBC, which is different from normal breast epithelial cells, is of great significance for the research and development of anti-cancer drugs targeting the tumor immune microenvironment. Summary of the Invention

[0005] The object of the present invention is to provide the use of a reagent for detecting the phosphorylation level of ADSL T350 in the preparation of products for the diagnosis and prognosis of triple-negative breast cancer.

[0006] The technical solution of the present invention is as follows: The present invention provides the use of a reagent for detecting the phosphorylation level of ADSL T350 in the preparation of a product for the diagnosis of triple-negative breast cancer.

[0007] When the phosphorylation level of ADSL T350 is higher than the reference level, it indicates that the patient has invasive cancer or the invasive cancer is in the advanced stage, and the reference level is from the level of non-cancer cells or early cancer cells.

[0008] The phosphorylation level of ADSL T350 is negatively correlated with the STING activation level and the degree of infiltration of cytotoxic immune cells in triple-negative breast cancer patient samples.

[0009] The present invention also provides the use of a reagent for detecting the phosphorylation level of ADSL T350 in the preparation of a product for the prognosis of triple-negative breast cancer.

[0010] The phosphorylation level of ADSL T350 is positively correlated with the poor prognosis of triple-negative breast cancer patients.

[0011] The reagent includes a first antibody and a second antibody. The first antibody includes an antibody against the phosphorylation of ADSL T350, and the second antibody is an antibody homologous to the first antibody and labeled with horseradish peroxidase.

[0012] Compared with the prior art, the beneficial effects of the present invention are: The present invention discovers that the key metabolic enzyme adenylosuccinate lyase (ADSL) in de novo purine nucleotide synthesis is highly expressed in triple-negative breast cancer. The hypoxic tumor microenvironment can induce the phosphorylation of ADSL at T350 by IKKβ to drive its translocation to the endoplasmic reticulum and interact with STING, thereby inhibiting the activation of the STING-IRF3 innate immune signaling pathway. Importantly, the phosphorylation level of ADSL at T350 is negatively correlated with the activation level of the STING pathway and the infiltration degree of immune cells in breast cancer samples, and predicts poor prognosis of breast cancer patients. Blocking the phosphorylation of ADSL (T350A) can significantly promote the activation of the STING pathway and induce the secretion of type I interferon, inhibiting tumor growth by increasing the infiltration and activation levels of immune cells such as CD8 + T and natural killer (NK) in the tumor microenvironment. Brief Description of the Drawings

[0013] Figure 1 For the immunoblot analysis of Example 1, the phosphorylation levels of key proteins in the cGAS-STING signaling pathway were detected in MCF-10A, HMEC, BT-549, and MDA-MB-231 cell lines with or without hypoxic stimulation; Figure 2 For the immunoblot analysis of Example 1, the expression levels of ADSL were detected in MCF-10A, HMEC, BT-549, and MDA-MB-231 cell lines respectively; Figure 3 For the bioinformatics analysis of Example 1, using the Cancer Genome Atlas (TCGA) database, the expression differences of ADSL in normal breast tissues and triple-negative breast cancer tissues were detected; Figure 4 For the immunoprecipitation and Coomassie blue experiment analysis of Example 1, the binding of Flag-STING to ADSL in BT-549 cells with or without hypoxic stimulation was detected, and the proteins bound to Flag-STING were detected by mass spectrometry (lower side); Figure 5 For the immunoprecipitation analysis of Example 1, the interaction between STING and ADSL was detected in MCF-10A, HMEC, BT-549, and MDA-MB-231 cell lines with or without hypoxic stimulation; Figure 6For the immunoprecipitation assay in Example 2, in the presence or absence of hypoxia stimulation, BT-549 cells were pretreated with U0126 (10 μM), SB203580 (10 μM), SP600125 (25 μM), or BAY 11-7082 (10 μM) inhibitors, and the interaction between STING and ADSL was detected; Figure 7 For the in vitro kinase assay in Example 2, the phosphorylation of ADSL by IKKβ in vitro was detected; Figure 8 For the immunofluorescence assay in Example 2, in BT-549 cells with endogenous ADSL knocked down and ADSL WT and phosphorylation-inactive mutant (T350A) re-expressed respectively, the co-localization of ADSL and endoplasmic reticulum was detected in the presence or absence of hypoxia stimulation (left), and the co-localization coefficient was analyzed (right). Calnexin: endoplasmic reticulum Marker; Figure 9 For the immunoprecipitation assay in Example 2, in BT-549 and MDA-MB-231 cells with endogenous ADSL knocked down and ADSL WT, phosphorylation-inactive mutant (T350A), and phosphorylation-mimicking mutant (ADSL T350D) re-expressed respectively, the endoplasmic reticulum accumulation level of ADSL and the interaction between ADSL and STING were detected in the presence or absence of hypoxia stimulation; Figure 10 For the immunoblot analysis in Example 3, in BT-549 and MDA-MB-231 cells recombinantly expressing ADSL WT and T350A, the activation of the STING signaling pathway was detected in the presence or absence of hypoxia stimulation; Figure 11 For the immunofluorescence analysis in Example 3, in BT-549 and MDA-MB-231 cells recombinantly expressing ADSL WT and T350A, the nuclear localization of IRF3 protein was detected in the presence or absence of hypoxia stimulation. Scale bar: 20 μm; Figure 12 For the luciferase reporter gene assay in Example 3, in BT-549 and MDA-MB-231 cells recombinantly expressing ADSL WT and T350A, the activity of the IFN-β reporter gene was detected in the presence or absence of hypoxia stimulation; Figure 13 For the real-time fluorescence quantitative PCR assay in Example 3, in BT-549 and MDA-MB-231 cells recombinantly expressing ADSL WT and T350A, the mRNA expression levels of IRF3 target genes (IFNB1, CXCL10, IFNA4, and CCL5) were detected in the presence or absence of hypoxia stimulation; Figure 14For the detection results of the subcutaneous tumor size of the mice in Example 4, 4T-1 cells with endogenous ADSL knocked down and respectively complemented with the expression of ADSL WT and phosphorylation-inactivated mutant (T350A) were injected into the mammary fat pads of immunocompetent BALB / c mice (6 mice in each group). 25 days after injection, the mice were euthanized and the tumor growth was examined; Figure 15 For the tumor weight measurement results of Example 4; Figure 16 For the immunohistochemical analysis of the indicated tumors in Example 4, the left side shows representative staining pictures, and the right side counts the Ki-67 positive cells; Figure 17 For the immunohistochemical analysis of the indicated tumors in Example 4, the left side shows representative staining pictures, and the right side counts the TUNEL positive cells; Figure 18 For the immunohistochemical staining of the indicated tumors in Example 5, the figure shows representative staining pictures; Figure 19 For the flow cytometry sorting experiment of Example 5, on the 25th day after inoculating 4T-1 cells with endogenous ADSL knocked down and respectively complemented with the expression of ADSL WT and phosphorylation-inactivated mutant (T350A) into BALB / c mice, CD45 in the tumors was detected by flow cytometry + , CD4 + T, CD8 + T and the percentages of NK cells; Figure 20 For the immunohistochemical staining of Example 6, immunohistochemical staining was performed on human triple-negative breast cancer samples with high or low expression of ADSL pT350 (upper side), and quantitative analysis of IHC positive cells of CD3, CD4, CD8 and CD16 was performed (lower side); Figure 21 For the immunohistochemical staining of Example 6, 84 human triple-negative breast cancer samples were analyzed by immunohistochemistry, and representative staining pictures are shown; Figure 22 For the immunohistochemical correlation analysis of Example 6, human triple-negative breast cancer samples were stained and scored by immunohistochemistry (IHC) using corresponding antibodies, and then correlation analysis was performed; Figure 23 For the high expression of the phosphorylation level of ADSL T350 in Example 6 vs Low expression survival curves. According to the high expression (staining score, 4 - 8) and low expression (staining score, 0 - 3) of ADSL pT350, Kaplan-Meier curve analysis was performed on the overall survival rate of 84 triple-negative breast cancer patients. Detailed implementation manners

[0014] In order to make the objectives and technical solutions of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings. The experimental methods described in the following experiments are all conventional methods unless otherwise specified; for those technical or conditions not specified in the experiments, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications; the reagents and materials, unless otherwise specified, can be obtained from commercial channels.

[0015] I. Materials used in the embodiments: 1. Cell types: The MDA-MB-231, BT-549, MCF-10A, HMEC, 4T-1 and 293T cell lines were purchased from the American Type Culture Collection (ATCC).

[0016] 2. The shRNA sequences used for gene knockdown are as follows: ADSL-shRNA1 (human): 5'- CCACATTAGGTTTCACACATT -3'; ADSL-shRNA2(human): 5'- GCAGAACATTTCTGAAGGATT -3'; ADSL-shRNA1 (mouse): 5'-CCTGCTATGTCGGAGACAATA -3'; ADSL-shRNA2 (mouse): 5'- GACCTGATTATTCTGAGAAAT -3'.

[0017] II. Detection methods used in the embodiments: 1. Detection of protein levels: First, proteins are extracted from the cells, and then the corresponding antibodies are used to react with the proteins in an antigen-antibody reaction, and the expression and function of the specific target protein are determined by substrate color development.

[0018] The detection system for protein levels used in the present invention includes: immunoprecipitation, immunoblotting, immunohistochemical assay.

[0019] Antibodies used: CD3 (ab16669), CD4 (ab133616), CD8 (ab101500), CD16 (ab183354), Ki-67 (ab21700) were purchased from Abcam. Antibodies against TBK1 pS172 (#5483), TBK1 (#3504), STING pS366 (#19781), STING (#13647), IRF3 pS396 (#37829), IRF3 (#11904), Hif 1α (#14179), IKKβ (#2678), IκBα (#9242), IκBα pS32 / S36 (#9246) were purchased from Cell Signaling Technology (Danvers, MA). Normal mouse IgG (sc-2025), normal rabbit IgG (sc-2027), ADSL (sc-365623) and tubulin (sc-8035) antibodies were purchased from Santa Cruz Biotechnology. [γ-32P] ATP was purchased from PerkinElmer. SP600125, U0126, SB203580, BAY 11-7082, His-IKKβ (14-485), mouse anti-Flag (F1804), rabbit anti-Flag (F7425) and STING pS365 (SAB5701942) antibodies were purchased from Sigma-Aldrich. ADSL (NBP2-03107) antibody was purchased from Novus Biologicals. ADSL-pT350 antibody was purchased from ABclonal. ADSL (A304-778A), STING pS366 (PA5-105674), TBK1 pS172 (PA5-105919) and Calnexin (MA3-027) antibodies were purchased from Thermo Fisher Scientific. IRF3 pS396 (OABF01188) was purchased from Aviva Systems Biology. 2. Immunofluorescence Detection and Analysis The treated cells were fixed with 4% paraformaldehyde (PFA), treated with 0.1% Triton X-100 for 5 minutes, blocked in 3% bovine serum albumin (BSA) for 1 hour, and incubated with primary antibody, fluorescent dye-conjugated secondary antibody and DAPI at a dilution ratio of 1:100. Immunofluorescence microscopic images of the cells were obtained and observed and photographed using a confocal microscope (Leica TCS-SP8). Finally, the Pearson correlation coefficient was calculated using the Coloc 2 plugin in Image J for the acquired images to quantify the co-localization of proteins.

[0020] Antibodies used: The ADSL (NBP2-89878) antibody was purchased from Novus Biologicals. The Calnexin (ab22595) antibody was purchased from Abcam. The IRF3 (SAB1406043) antibody was purchased from Sigma-Aldrich. 6-diamidino-2-phenylindole (DAPI), Alexa Fluor 488 goat anti-rabbit (A11008), Alexa Fluor 594 goat anti-rabbit (A11012), Alexa Fluor 488 goat anti-mouse (A11029) and Alexa Fluor 594 goat anti-mouse antibodies (A11005) were purchased from Thermo Fisher Scientific.

[0021] 3. Real-time fluorescence quantitative PCR Cellular RNA was extracted using the TRIzol method. 1 μg of RNA was taken from each sample and cDNA was synthesized using the TaqMan Reverse Transcription Kit (Applied Biosystems). Real-time fluorescence quantitative PCR was performed on a 7500 Real-Time PCR System (Applied Biosystems), and the reaction system used the SYBR Premix Ex Taq Real-Time PCR Kit (Takara). In this experiment, GAPDH was used as the internal reference gene. The primers used for qRT-PCR were as follows: CXCL10, 5’-GGAACCTCCAGTCTCAGCACC-3’ and 5’- GGCAGTGGAAGTCCATGAAGTAA-3’; CCL5, 5’- TCATTGCTACTGCCCTCTGC -3’ and 5’-TACTCCTTGATGTGGGCACG -3’; IFNB1, 5’- CTAACTGCAACCTTTCGAAGC-3’ and 5’-CTAGTGTCCTTTCATATGCAG-3’; IFNA4, 5’- GTTCCAGAAGGCTCAAGCCATC-3’ and 5’-TAGGAGGCTCTGTTCCCAAGCA-3’; GAPDH, 5’-AGCCACATCGCTCAGACAC-3’ and 5’-GCCCAATACGACCAATCC-3’.

[0022] 4. Luciferase assay analysis The IFN-β luciferase activity in cell lysates was measured using a luciferase assay system. First, BT-549 and MDA-MB-231 cells, as well as the designated clones expressing different ADSL mutants, were seeded in 24-well plates and transfected with 0.1 μg of the IFN-β luciferase reporter gene and 0.075 μg of β-galactosidase. After 24 hours of transfection, the cells were treated under hypoxic or normoxic conditions for 8 hours, and then the activities of luciferase and β-galactosidase in the cell lysates were detected.

[0023] 5. TCGA Analysis A total of 113 normal samples from TCGA (The Cancer Genome Atlas) and 195 triple-negative breast cancer (TNBC) samples classified according to the Lehmann molecular subtype were used. Gene expression data were downloaded from the Genomic Data Commons platform (https: / / portal.gdc.cancer.gov). The statistical hypothesis testing method wilcox.test was used to evaluate the significance of the expression differences between normal samples and TNBC samples.

[0024] 6. Flow Cytometry The tumor cells were digested into single-cell suspensions, washed, and then resuspended in flow cytometry staining buffer, which contained the following components: specific antibodies against cell surface proteins, the fixable viability dye eFluor 506 (eBioscience, used to distinguish live cells from dead cells), and purified rat anti-mouse CD16 / CD32 blocking antibody (Biolegend, used to block non-specific antibody binding). The cells were incubated on ice in the dark for 30 minutes for surface staining. Then, the surface-stained cells were washed twice and subjected to flow cytometry analysis. For intracellular cytokine staining, the surface-stained cells were fixed with fixation buffer at room temperature in the dark for 30 minutes, followed by permeabilization and intracellular staining with the designated antibodies. Data were collected using a CytoFLEX LX flow cytometer, and data analysis was performed using FlowJo software.

[0025] Antibodies used: FITC-CD4 (#116004), APC-CD8 (#100712), PerCP-CD45 (#103130), APC-NKp46 (137608) were purchased from Biolegend. CD16 / CD32 antibody (#553142) was purchased from BD Bioscience. Ghost Dye™ Violet 450 (#13-0863) was purchased from Tonbo Biosciences.

[0026] 7. Acquisition and Analysis of Mouse Tumor Samples: 4T-1 cells (1×10 6were injected into the mammary fat pads of 6-week-old male BALB / c nude mice. The mice were divided into two groups, with each experimental group consisting of six mice, which were used to monitor tumor growth and perform specified immunohistochemistry (IHC) and immunostaining analyses. Twenty-five days after injecting 4T-1 cells, the tumors were removed, fixed with 4% formaldehyde, and embedded in paraffin. The tumor volume was measured using the formula V = 1 / 2a 2 b, where V represents volume, a represents the shortest diameter, and b represents the longest diameter. The handling of animals complied with the guidelines and regulations of relevant institutions and countries. The use of animals was approved by the Institutional Review Board of the Second Affiliated Hospital of Zhejiang University School of Medicine.

[0027] Example 1 ADSL highly expressed in breast cancer cells interacts with STING and inhibits its activation MCF-10A, HMEC, BT-549, and MDA-MB-231 cells were treated for 6 hours under normoxic and hypoxic stimulation conditions. The results of immunoblot analysis showed that hypoxic stimulation significantly activated the cGAS-STING pathway in normal MCF-10A and HMEC cells, as evidenced by a substantial increase in the phosphorylation levels of TBK1 S172, STING S366, and IRF3 S396. However, in BT-549 and MDA-MB-231 breast cancer cells, this activation effect was significantly weakened ( Figure 1 )

[0028] In addition, immunoblot analysis found that the expression level of ADSL in breast cancer cells was much higher than that in normal cells ( Figure 2 ), and analysis based on The Cancer Genome Atlas (TCGA) dataset showed that the expression level of ADSL in triple-negative breast cancer (TNBC) tissues was significantly upregulated compared with that in adjacent normal tissues ( Figure 3 )

[0029] BT-549 cells overexpressing Flag-STING were treated for 6 hours under hypoxic and normoxic stimulation conditions respectively. Immunoprecipitation experiments were performed using Flag antibody, and the samples obtained by immunoprecipitation were further separated by SDS-PAGE and stained with Coomassie Brilliant Blue. As Figure 4 shown, after hypoxic treatment, an obvious differential protein band was obtained by immunoprecipitation. This protein band was identified as ADSL by subsequent mass spectrometry detection.

[0030] To further prove the interaction between ADSL and STING under hypoxic conditions, we treated BT-549 cells for 2 hours under hypoxic and normoxic stimulation conditions, and performed immunoprecipitation experiments using endogenous ADSL and STING antibodies. As Figure 5As shown, it was found that the binding level of endogenous ADSL to endogenous STING in BT-549 and MDA-MB-231 cells under hypoxic stimulation conditions was significantly higher than that in MCF10A and HMEC cells.

[0031] Conclusion: In breast cancer cells, ADSL is highly expressed and interacts with STING under hypoxic conditions.

[0032] Example 2 IKKβ phosphorylates the T350 site of ADSL, causing its translocation to the endoplasmic reticulum BT-549 cells were pretreated with or without inhibitors U0126 (10 μM), SB203580 (10 μM), SP600125 (25 μM), and BAY 11-7082 (10 μM) for 30 min. Subsequently, immunoprecipitation experiments were performed after treatment for 6 hours with or without hypoxic stimulation. As Figure 6 shown, BAY 11-7082 inhibited the hypoxia-induced interaction between ADSL and STING.

[0033] Furthermore, the kinase-active His-IKKβ protein was incubated in vitro with prokaryotically purified His-ADSL WT and His-ADSL T350A proteins, as Figure 7 shown, and Western blot experiments showed that treatment with BAY 11-7082 or the His-ADSL T350A mutation eliminated IKKβ-mediated phosphorylation of ADSL T350 in in vitro experiments.

[0034] In BT-549 cells with endogenous ADSL knocked down and ADSL WT and phosphorylation-inactive mutant (T350A) re-expressed respectively, they were treated for 6 hours under hypoxic or normoxic conditions. Immunofluorescence and Western blot analyses were performed using the indicated antibodies, as Figure 8 and Figure 9 shown, and the results showed that the ADSL T350A mutant blocked hypoxia-induced translocation of ADSL to the endoplasmic reticulum (ER) and its binding to STING.

[0035] Conclusion: IKKβ-mediated phosphorylation of ADSL T350 is crucial for the ER translocation of ADSL and its binding to STING.

[0036] Example 3 Phosphorylation of ADSL T350 inhibits hypoxia-induced activation of STING After treating the BT-549 and MDA-MB-231 cell lines recombinantly expressing ADSL WT and T350A with or without hypoxia stimulation, immunoblot analysis revealed enhanced phosphorylation of TBK1 pS172, STING pS366, and IRF3 pS396 under hypoxia stimulation ( Figure 10 ); immunofluorescence analysis showed a significant increase in IRF3 nuclear translocation under hypoxia stimulation in cells expressing T350A ( Figure 11 ).

[0037] Plasmids containing β-galactosidase and an IFN-β-driven luciferase reporter were co-expressed in the BT-549 and MDA-MB-231 cell lines recombinantly expressing ADSL WT and T350A. After transfection for 24 h, the cells were treated with or without hypoxia stimulation, and the activity of the IFN-β reporter gene was measured. As Figure 12 shown, hypoxia treatment increased the transcriptional activity of IRF3. Similarly, the BT-549 and MDA-MB-231 cell lines recombinantly expressing ADSL WT and T350A were treated with or without hypoxia stimulation for 12 h, and the mRNA expression levels of IRF3 target genes (IFNB1, CXCL10, IFNA4, and CCL5) were detected by fluorescence quantitative PCR. The results showed that the mRNA expression of IRF3 downstream target genes was significantly upregulated in cells expressing T350A under hypoxia stimulation ( Figure 13 ).

[0038] Conclusion: Phosphorylation of ADSL T350 inhibits hypoxia-induced activation of STING. Example 4 Phosphorylation of ADSL at the T350 site mediated by IKKβ promotes the growth of breast cancer 4T-1 cells expressing Flag-rmADSL WT and Flag-rmADSL T350A mutants after endogenous ADSL knockdown by ADSL shRNA and then re-supplemented were intraperitoneally injected into the mammary fat pads of 6-week-old male athymic BALB / c nude mice. After 25 days, the tumor size was measured. As Figure 14 shown, the right side is the statistical result of tumor volume, Figure 15 and this is the statistical result of tumor weight. Compared with the tumors expressing Flag-rmADSL WT, the tumors expressing the T350A mutant were significantly smaller.

[0039] As Figure 16 shown, the corresponding mouse tumor tissues were cut into 5-μm-thick sections, and the proliferation ability of tumor cells was detected with Ki-67 and quantitatively analyzed. It was found that the expression of Ki-67 in the tumors expressing the T350A mutant decreased.

[0040] As Figure 17As shown, the corresponding mouse tumor tissues were cut into 5-μm-thick sections, and apoptotic cells were stained and quantitatively analyzed using the DeadEnd Colorimetric TUNEL System (Promega). Increased apoptosis was found in tumor tissues expressing the T350A mutation.

[0041] Conclusion: Phosphorylation of ADSL T350 promotes the occurrence and development of breast cancer.

[0042] Example 5: Phosphorylation of ADSL T350 inhibits immune cell infiltration, leading to immune escape of breast cancer Mouse tumor samples were immunohistochemically stained with antibodies against IkBα pS32 / S36, ADSL pT350, TBK1 pS172, STING pS365, and IRF3 pS396. Results analysis showed that the expression of ADSL T350A increased the phosphorylation levels of TBK1, STING, and IRF3 ( Figure 18 )

[0043] 4T-1 cells expressing ADSL WT and ADSL T350A proteins were inoculated into the mammary fat pads of BALB / c mice. On day 25, the mice were euthanized and the tumors were removed. CD45 in the tumors was measured by flow cytometry + , CD4 + T, CD8 + T, and NK cell percentages. Results analysis found that compared with tumor tissues expressing ADSL WT, the expression of ADSL T350A increased the infiltration of immune cells in the tumors ( Figure 19 )

[0044] Conclusion: Phosphorylation of ADSL T350 inhibits immune cell infiltration, leading to immune escape of breast cancer.

[0045] Example 6: Phosphorylation of T350 in ADSL is associated with poor prognosis in breast cancer patients Immunohistochemical analysis was performed on clinical triple-negative breast cancer tissues and adjacent tissue samples with high or low expression of ADSL pT350 Figure 20 Results showed that the phosphorylation level of ADSL T350 was positively correlated with the level of IkBα pS32 / pS36, while negatively correlated with the infiltration of CD3 + T cells, CD4 + T cells, CD8 + T cells, and CD16 + NK cells.

[0046] Immunohistochemical staining and scoring were performed on 84 human triple-negative breast cancer tissue samples using antibodies against IkBα pS32 / S36, ADSL pT350, TBK1 pS172, STING pS366, and IRF3 pS396. The results of correlation analysis showed that the activity of the cGAS-STING pathway (reflected by TBK1 pS172, STING pS366, and IRF3 pS396) was negatively correlated with the phosphorylation level of ADSL T350 and the level of IkBα pS32 / S36 ( Figure 21 and Figure 22 ).

[0047] In 84 human triple-negative breast cancer patient samples, they were divided into high expression (staining score, 4 - 8) and low expression (staining score, 0 - 3) according to the phosphorylation level of ADSL T350, and the Kaplan-Meier plot of overall survival time was drawn. The results were as Figure 23 shown. The phosphorylation level of ADSL T350 was positively correlated with the poor prognosis of triple-negative breast cancer patients.

[0048] Conclusion: The phosphorylation level of T350 of ADSL is positively correlated with the poor prognosis of triple-negative breast cancer patients.

[0049] Of course, the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of reagents for detecting the phosphorylation level of ADSL T350 in the preparation of diagnostic products for triple-negative breast cancer.

2. The use according to claim 1, characterized in that When the ADSL T350 phosphorylation level is higher than the reference level, it means that the patient has invasive cancer or invasive cancer is in an advanced stage.

3. The use according to claim 2, characterized in that The reference level is a level from non-cancerous cells or a level from early stage cancer cells.

4. The use according to claim 3, characterized in that ADSL T350 phosphorylation levels were negatively correlated with STING activation levels and cytotoxic immune cell infiltration in samples from patients with triple-negative breast cancer.

5. Application of reagents for detecting ADSL T350 phosphorylation levels in the preparation of triple-negative breast cancer prognosis products.

6. The use according to claim 5, characterized in that ADSL T350 phosphorylation level is positively correlated with poor prognosis in patients with triple-negative breast cancer.

Images