Bacillus mycoides strain and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and relates to a bacillus mycoides strain and application thereof, the Latin name of the strain is Bacillus mycoides P291, the strain is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC M 20242535; the preservation time is November 12, 2024. A bacillus mycoides strain is separated and screened from sludge, mineralization of coal gangue and humification of a soil matrix can be accelerated, microbial fertilizer can be directly absorbed and utilized by plants, and the bacillus mycoides strain can be used for efficient degradation of the coal gangue and promotion of development and utilization of the coal gangue and can also promote growth of the plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and relates to a Bacillus mycoides strain and its uses. Background Art

[0002] Coal gangue is a solid waste discharged during the coal mining process and the coal washing process. It is a black-gray rock with a lower carbon content and harder than coal, which is associated with the coal seam during the coal formation process. Due to a large amount of coal mining and processing, coal gangue has become one of the industrial solid wastes with the largest output. For the treatment of coal gangue, the traditional method is to stack it disorderly, which will occupy a large amount of land. Moreover, coal gangue contains dust and harmful components, which will pollute water and soil and damage the ecological environment.

[0003] In recent years, the main utilization methods of coal gangue are: replacing coal or mixing with coal as fuel and being used as building materials; however, when used as fuel, due to the too low carbon content of coal gangue, the combustion efficiency is low; when used as building materials, due to the oxidation of sulfur, organic matter, etc. in coal gangue, bulging and powdering phenomena will occur, and components such as sulfur, phosphorus, and nitrogen will also affect the strength and quality of coal gangue products. Therefore, new treatment ways for coal gangue are sought.

[0004] With the proposal of the concept of green ecology, coal gangue also contains abundant elements such as nitrogen, phosphorus, potassium, and calcium required for plant growth. Therefore, by adding exogenous microorganisms to treat coal gangue, the nutrient content of coal gangue is improved through the self-metabolism of microorganisms and the interaction between microorganisms and coal gangue, so as to prepare the raw material of microbial mineral fertilizer from coal gangue. For example: Phosphorus-solubilizing bacteria are a general term for bacteria that can secrete extracellular phosphatase and organic acids, which can release insoluble inorganic phosphorus and potassium in coal gangue, thereby promoting the absorption and utilization of plants; treating coal gangue with phosphorus-solubilizing bacteria and potassium-solubilizing bacteria can significantly improve its nutrient content. Although existing microbial strains can degrade coal gangue to prepare microbial fertilizers, since most of the phosphorus, potassium, and other components contained in coal gangue exist in the form of insoluble minerals, the degree of humification of coal gangue is not high, resulting in the microbial fertilizers prepared cannot be directly absorbed and utilized by plants, and further leading to the difficulty in the development and reuse of coal gangue. Summary of the Invention

[0005] Based on the technical problem that the degree of humification of coal gangue degraded by microbial strains in the above background art is not high, resulting in the microbial fertilizers prepared cannot be directly absorbed and utilized by plants, and further leading to the difficulty in the development and reuse of coal gangue, the present invention provides a Bacillus mycoides strain and its uses.

[0006] The present invention isolates and screens a Bacillus mycoides strain from sludge, which can accelerate the mineralization of coal gangue and the humification of soil matrix, enabling microbial fertilizers to be directly absorbed and utilized by plants. It can not only be used for the efficient degradation of coal gangue, but also promote plant growth and the development and utilization of coal gangue.

[0007] A Bacillus mycoides strain with the Latin name Bacillus mycoides P291 has been deposited in the China Center for Type Culture Collection, with the deposit number CCTCC M 20242535; the deposit date is November 12, 2024.

[0008] Further defined, the colony of the Bacillus mycoides strain is a white, regularly shaped, and shiny surface bacterial community.

[0009] Further defined, the sequence of the Bacillus mycoides strain is as shown in SEQ No.1.

[0010] Application of the described Bacillus mycoides strain in the degradation of coal gangue.

[0011] Application of the described Bacillus mycoides strain in promoting plant growth.

[0012] Application of the described Bacillus mycoides strain in promoting plant growth by accelerating the mineralization of soil matrix.

[0013] Application of the described Bacillus mycoides strain in promoting plant growth by accelerating the humification of soil matrix.

[0014] Further defined, the soil matrix is formed by mixing coal gangue and sandy soil in a mass ratio of 1:1.

[0015] Compared with the prior art, the beneficial effects of the present invention are:

[0016] 1. The present invention isolates and screens a Bacillus mycoides strain from sludge, which can convert the insoluble components in coal gangue from the invalid state and slow-acting state to the effective state and fast-acting state, and can be used for the efficient degradation of coal gangue to promote the development and utilization of coal gangue.

[0017] 2. The Bacillus mycoides strain isolated and screened by the present invention can accelerate the mineralization and humification of soil matrix, secrete phytase, degrade most of the phytates in the soil matrix, and then produce auxin to stimulate the plant growth rate and improve the survival rate and emergence rate of plant seeds.

[0018] 3. The Bacillus mycoides of the present invention can form a probiotic environment in the soil matrix, promote the formation of aggregate structure, improve the fertilizer retention and water retention capacity of the soil matrix, increase the looseness of the soil matrix, and thus promote the growth of plant roots. Description of the Drawings

[0019] Figure 1 Colony morphology of strain P291;

[0020] Figure 2 Gram staining result of strain P291;

[0021] Figure 3 Phylogenetic tree of strain P291;

[0022] Figure 4 Bacterial growth curve of strain P291;

[0023] Figure 5 Germination situation diagram of plants by strain P291;

[0024] Figure 6 Germination rate comparison diagram of plants by strain P291;

[0025] Figure 7 Above-ground height comparison diagram of plants by strain P291;

[0026] Figure 8 Fresh weight comparison diagram of plants by strain P291;

[0027] Figure 9 Root length comparison diagram of plants by strain P291. Detailed implementation mode

[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0029] Unless otherwise defined, the technical terms or scientific terms used in the present invention shall have the ordinary meanings understood by those of ordinary skill in the art to which the present invention belongs.

[0030] For technologies, methods and equipment known to those of ordinary skill in the relevant fields, they may not be discussed in detail, but where appropriate, the said technologies, methods and equipment shall be regarded as part of the specification.

[0031] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art. These other embodiments are also covered by the protection scope of the present invention.

[0032] The instruments adopted in the present invention are as follows.

[0033] HH.S11-4 type constant temperature water bath, Beijing Chang'an Scientific Instrument Factory; DHG-9053AS type electrothermal constant temperature forced air drying oven, Shendang Zhongxin Electric Appliance Factory in Shanghai Economic Zone; AMA440N type automatic high-pressure sterilizer, Astell in the United States; PYX-DHS type water-separated electrothermal constant temperature incubator, Shanghai Yuejin Medical Machinery Factory; TGL-20M type bench-top high-speed refrigerated centrifuge, Changsha Xiangyi Beck Instrument Co., Ltd. in the High-tech Development Zone; TC-412 type PCR instrument, Techne in the United Kingdom; YCP-33A type electrophoresis tank, Beijing Liuyi Instrument Factory; UV2000 type ultraviolet-visible spectrophotometer, Unico Shanghai Instrument Co., Ltd.; 6400A type flame photometer, Shanghai Precision Scientific Instrument Co., Ltd.

[0034] The culture media used in the present invention include: insoluble inorganic phosphorus solid medium (PVK), insoluble inorganic phosphorus liquid medium, Alexander solid medium, Alexander liquid medium, and LB solid medium. The formulations of each culture medium are as follows.

[0035] 1. Insoluble inorganic phosphorus solid medium (PVK solid medium)

[0036] Glucose 10 g, (NH 4 )SO 4 0.5 g, NaCl 0.3 g, KCl 0.3 g, Mg 2 SO 4 ·H 2 O 0.3 g, FeSO 4 ·7H 2 O 0.03 g, MnSO 4 ·H 2 O 0.03 g, Ca 3 (PO 4 ) 2 10 g, agar 15 - 20 g, distilled water 1000 mL, pH value 7.0 - 7.2.

[0037] 2. Insoluble inorganic phosphorus liquid medium

[0038] Glucose 10 g, (NH 4 )SO 4 0.5 g, NaCl 0.3 g, KC1 0.3 g, Mg 2 SO 4 ·H 2 O 0.3 g, FeSO 4 ·7H 2 O 0.03 g, MnSO 4 ·H 2 O 0.03 g, Ca 3 (PO 4 )2 10 g, 1000 mL of distilled water, pH value 7.0 - 7.2.

[0039] 3. Alexander solid medium

[0040] 5 g of glucose, 0.5 g of ammonium sulfate, 0.5 g of yeast powder, 0.3 g of magnesium sulfate, 2 g of disodium hydrogen phosphate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, potassium feldspar (K 2 O·Al 2 O 3 ·6SiO 2 ) 2 g, 15 g of agar.

[0041] 4. Alexander liquid medium

[0042] 5 g of glucose, 0.5 g of ammonium sulfate, 0.5 g of yeast powder, 0.3 g of magnesium sulfate, 2 g of disodium hydrogen phosphate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, potassium feldspar (K 2 O·Al 2 O 3 ·6SiO 2 ) 2 g, 1000 mL of distilled water.

[0043] 5. LB solid medium

[0044] 5 g of peptone, 5 g of sodium chloride, 1 g of beef extract, 2 g of yeast extract, 15 g - 20 g of agar, 1000 mL of distilled water, pH value 7.4.

[0045] It should be noted that, unless otherwise specified, the chemical drugs, reagents, etc. used in the following examples are all commercially available products known in the art.

[0046] Example 1

[0047] This example mainly extracts, isolates, cultivates, and screens Bacillus mycoides strains from sludge.

[0048] Preferably, the sludge is obtained from a sewage treatment plant in Xi'an, Shaanxi Province.

[0049] In this example, the method for isolating and screening Bacillus mycoides strains includes the following steps:

[0050] Weigh 10 g of sludge and add it to 90 mL of sterile water. Mix well (at 30 °C, 160 r / min), let it stand for 30 min, and dilute it step - by - step with sterile water to 10 -2 10 -3 10 -4 10 -5 10 -6, 0.1 mL of the bacterial liquid was pipetted from each dilution gradient and added to the PVK solid medium and the Alexander solid medium. The bacterial liquid was evenly spread using a spreading rod to culture the bacteria by the spread plate method. Strains with good phosphorus and potassium solubilizing effects were selected and the strains were preserved. The preservation method was to inoculate the strains on the LB solid medium and culture them in a constant temperature incubator at 37 °C for 18 h to 24 h.

[0051] The above-selected strain was designated as strain P291, and morphological analysis was performed on the obtained strain P291. The results are shown in Figure 1 and Figure 2 .

[0052] From Figure 1 the colony morphology, it can be seen that the colonies of strain P291 are white, regular in shape, and shiny on the surface.

[0053] From Figure 2 the Gram staining diagram, it can be seen that strain P291 is Gram-positive.

[0054] Furthermore, 16S rDNA sequencing was used to sequence and identify strain P291.

[0055] The specific identification method was as follows: The DNA of strain P291 was extracted using a rapid non-toxic DNA extraction kit. Using specific primer sequences, the target fragment was amplified by PCR technology. The amplification result was sequenced, and the sequencing result was compared with the NCBI gene bank. The phylogenetic tree was drawn using MEGA6.06, and finally the target strain, that is, strain P291, was confirmed according to the similarity.

[0056] The primer information used for PCR technology amplification is as follows:

[0057] 27F (5’-AGA GTT TGA TCC TGG CTC AG-3’); 1492R (5’-AAG GAG GTG ATC CAGCCG CA3-’).

[0058] The program used for PCR technology amplification was as follows: 95 °C, 5 min; 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min; 30 cycles; 72 °C, 10 min.

[0059] The sequencing result of the 16S rDNA sequence of strain P291 was as follows:

[0060] CGGGGGTGCTATACATGCAGTCGAGCGAATGGATTAAGAGCTTGCTCTTAT

[0061] GAAGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCATAAGA

[0062] CTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATAACATTTTGAACCG

[0063] CATGGTTCGAAATTGAAAGGCGGCTTCGGCTGTCACTTATGGATGGACCCG

[0064] CGTCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGT

[0065] AGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCA

[0066] GACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTC

[0067] TGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTC

[0068] TGTTGTTAGGGAAGAACAAGTGCTAGTTGAATAAGCTGGCACCTTGACGG

[0069] TACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATA

[0070] CGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGT

[0071] GGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATT

[0072] GGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGAATTCATGTGGTA

[0073] GCGTTAAATGCGGTAGAGATTGGAGGACACCAGTGGCGAAGGCGACTTTT

[0074] CTGTCTGTACTGACCATGAGGCCGAAAGCGTGGGGAGCAAACAGATTAGA

[0075] TACCTGGTAGTTCCCGCCGTAAACGATGAGGGCAAGTTTAGAGGGTTTCCC

[0076] CCCTTTAGGTGCTAAAGTTACGCATTTAGCACTCCGCCTGGGGAGTACGGC

[0077] CGCAAGGCTGAAACTCAAAGGAATTGACGGGGGCCCGCCCCAGCGGTGG

[0078] AGCCTGTGGTTTAATTTGAAGCAACGCGAAGAACCTTACCCGGTTCTGACC

[0079] TCCTTTGACAACCCTAGAGATAGGGCTTTTCCTTTGGGAGCCGAATGACCG

[0080] GTGGTGCATGGTTGTTGTCAGCTTGTGTTGTGAGATGTTGGGTTAAGTTCC

[0081] GCAACGAGCGCCACCCTTGATTTTAGTTGCCCTCCTTTAATTGGGCCATTTA

[0082] AGGTGACTGCCGGTGACCAACCGGAGGAAAGGGGGGAAGGCGTCAAATC

[0083] CTCCTGCCCCTTATGACCTGGGGTACCCCCGTGGTTCCATGGGCGGTACAA

[0084] AGAGGTGCAAGGCCCGGAGGGGGAAGTAATTTCATAAAACCGTTTTCAGT

[0085] TTGGATTGTAGGGTGCAAATTGCCTACCAGAAGCCGGAATCGCTTGTAATC

[0086] GCGGATCAGCCAGCCGCGGGGAATACGTTCCCGGGCCTTGTACCCCCCCC

[0087] CCGTCCCCCCCCGAGAATTTGGAACCCCCGAAGTCGGTGGGGTAACCCTT

[0088] TTGGAGCCAGCCGCAA

[0089] From Figure 3 The phylogenetic tree shows that strain P291 is on the same branch as Bacillus pseudomycoides BS6 (KU141362.1) and has the closest genetic relationship. Therefore, strain P291 was identified as Bacillus mycoides, with the Latin name Bacillus mycoides P291.

[0090] The P291 strain screened in the present invention has been deposited in the China Center for Type Culture Collection, with the deposit number CCTCC M 20242535; the deposit date is November 12, 2024.

[0091] The P291 strain provided in this example can form a probiotic environment in the soil matrix, promote the formation of aggregate structures, improve the fertilizer and water retention capabilities of the soil matrix, increase the looseness of the soil matrix, and promote root growth. Specifically, it accelerates the mineralization of nutrients in the soil matrix, converting nutrients from the ineffective and slow-acting states to the effective and quick-acting states. At the same time, it accelerates the humification of nutrients in the soil matrix, secretes phytase to degrade most of the phytates in the soil, and produces auxin to stimulate crop growth and improve the survival rate and emergence rate of seeds.

[0092] In this example, the bacterial growth curve of strain P291 is as Figure 4 shown.

[0093] See Figure 4 , strain P291 is in the lag phase from 0 h to 10 h, in the logarithmic phase from 10 h to 30 h, in the stationary phase from 30 h to 50 h, and in the decline phase after 50 h.

[0094] Example 2

[0095] This example mainly examines the degradation of coal gangue by strain P291.

[0096] In this example, the coal gangue used comes from the coal gangue yard of Zhongmei Shaanxi Yulin Dahaize Coal Industry Co., Ltd. The main components are: SiO 2 59.66 wt%, Al 2 O 3 22.78 wt%, CaO 5.09 wt%, Fe 2 O 3 3.95 wt%, K 2 O 2.87 wt%, Na 2O 1.85 wt%, MgO 1.23 wt%, N 0.26 wt%, C 17.00 wt%, H 1.34 wt%, S 1.07 wt%, ash 83.88 wt%.

[0097] In this example, the method for P291 strain to degrade coal gangue is as follows:

[0098] S1. Inoculate the P291 strain into LB liquid medium and expand the culture to the logarithmic phase when the bacterial metabolic rate is the fastest. Then inoculate it into the pre-prepared phosphorus-solubilizing liquid medium and place it in a constant-temperature shaker to mix well (30 °C, 160 r / min). Measure the phosphorus-solubilizing ability value on the fourth day of culture.

[0099] S2. Inoculate the bacteria into LB liquid medium and expand the culture to the logarithmic phase when the bacterial metabolic rate is the fastest. Then inoculate it into the pre-prepared Alexander liquid medium and place it in a constant-temperature shaker to mix well (30 °C, 160 r / min). Measure the potassium-solubilizing ability value on the fourth day of culture.

[0100] In this example, the method for determining available phosphorus in coal gangue is the sodium bicarbonate extraction-molybdenum antimony anti-colorimetry method. Specifically: Extracting with sodium bicarbonate solution can not only extract water-soluble phosphorus, but also inhibit the activity of Ca 2+ , and leach out the phosphorus in the Ca-P, Fe-P, and Al-P salts with relatively high activity. The calculation formula for the content of available phosphorus (P) is as follows:

[0101]

[0102] Where:

[0103] ρ—the mass concentration of P in the measured solution obtained by referring to the calibration curve, μg·m L-1 ;

[0104] V—the volume of the solution fixed during color development, mL;

[0105] D—the aliquot multiple, that is, the volume of the extractant / the volume of the extractant absorbed during color development;

[0106] 10 3 and 1000—convert μg to g and g to kg respectively;

[0107] m—the mass of the air-dried sample, g.

[0108] In this example, the method for determining available potassium in coal gangue is the ammonium acetate extraction-flame photometry method. Specifically: K in the sample + exchanges with NH 4+ , and then enters the solution together with water-soluble potassium. The potassium in the leachate can be directly measured with a flame photometer. The calculation formula for available potassium (K) is as follows:

[0109]

[0110] In the formula:

[0111] ω—Available potassium content;

[0112] C—Concentration value of potassium in the test solution obtained by referring to the standard curve or obtaining the regression equation, μg·mL -1 ;

[0113] V—Volume of extraction agent added, mL;

[0114] M—Mass of air-dried sample, g.

[0115] In this embodiment, Bacillus megaterium and Bacillus mucilaginosus were purchased from the market, and then the coal gangue was treated with reference to the above method.

[0116] Before and after the treatment of the above three kinds of bacteria on the coal gangue, the contents of available potassium and available phosphorus in the coal gangue are shown in Table 1.

[0117] Table 1 Results before and after the test of different strains dissociating coal gangue

[0118] Item (mg / kg) Before treatment After treatment with strain P291 After treatment with Bacillus megaterium After treatment with Bacillus mucilaginosus Available phosphorus 7.85 75.81 57.46 46.08 Available potassium 13.56 352.98 252.86 269.38

[0119] It can be seen from the data comparison in Table 1 that by using the Bacillus mycoides (i.e., P291 strain) screened by the present invention, the dissociation rate of available phosphorus and available potassium in the coal gangue can be improved, so that the coal gangue changes from the invalid state and slow-acting state to the available state and available potassium state, and through the dissociated soluble minerals, the mineralization of the coal gangue is accelerated.

[0120] Example 3

[0121] The purpose of this embodiment is to use the P291 strain to promote plant growth.

[0122] In this embodiment, the soil for planting and the coal gangue used were collected from Yulin, Shaanxi.

[0123] In this embodiment, the method for the P291 strain to promote plant growth includes the following steps:

[0124] S1. Use a plastic pot with a diameter of 15.5 cm and a height of 10.9 cm. Each pot contains 500 cm 3 (950 g ± 10 g) of soil substrate, which is a mixture of coal gangue and sand in a mass ratio of 1:1.

[0125] S2. Sow clean alfalfa seeds. Sow 40 alfalfa seeds in each pot and conduct the experiment at room temperature. Soak the seeds in advance.

[0126] S3. Remove weeds according to the principles of early, small-scale, and clean removal. Before watering, level the soil to ensure consistent seedling growth. After watering, use a measuring cylinder for quantitative irrigation with a consistent amount of water for each treatment.

[0127] In this embodiment, a blank group and an experimental group were established. The blank group was not added with bacterial liquid; the experimental group was added with 3 ml of bacterial liquid, and 3 parallel samples were set in each group. The bacterial liquid was added during sowing in the experimental group.

[0128] The bacterial liquid was obtained by culturing strain P291 in LB liquid medium for 24 hours and measuring the absorbance at 600 nm with a spectrophotometer to be 1.357.

[0129] In this embodiment, after 15 days of planting, the alfalfa seedlings were uprooted with roots, and the rhizosphere soil was washed away. The germination rate, above-ground height, root length, number of roots, and fresh weight of each single seedling were measured. The results are as Figures 5 to 9 , and the *** on the figure indicates significant differences at the P < 0.001 level.

[0130] See Figures 5 to 9 It can be concluded that the Bacillus mycoides (i.e., strain P291) provided in this embodiment can improve the germination rate, above-ground height, root length, number of roots, and fresh weight of seedlings. It shows that strain P291 can solubilize the insoluble minerals contained in coal gangue in the soil matrix into soluble minerals available for plants, accelerate the mineralization of the soil matrix, change the nutrients in the soil matrix from the ineffective and slow-acting states to the effective and fast-acting states; at the same time, accelerate the humification of the soil matrix, secrete phytase, and degrade most of the phytates in the soil matrix; produce auxin, stimulate crop growth, improve the survival rate and emergence rate of alfalfa seeds, and thus promote plant growth.

[0131] In the above embodiments, the germination and planting of alfalfa seeds were taken as examples. However, the P291 strain screened by the present invention is not limited to promoting the growth of alfalfa. When pouring the bacterial liquid of strain P291 into the soil matrix (coal gangue and sandy soil), it can also promote the growth of other plants, such as Prunus mongolica, Ammopiptanthus mongolicus, Caragana tibetica, and Caryopteris mongholica, etc.; and the growth-promoting effect of strain P291 on these plants is the same as that on alfalfa.

[0132] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify or equivalently replace the technical solutions of the present invention, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A Bacillus mycoides strain, characterized in that The Latin name is Bacillus mycoides P291, which has been deposited in the China Center for Type Culture Collection with the deposit number CCTCC M 20242535; the deposit date is November 12, 2024.

2. The Bacillus mycoides strain according to claim 1, characterized in that The colonies of the Bacillus mycoides strain are white, regularly shaped and glossy on the surface.

3. The Bacillus mycoides strain according to claim 1, characterized in that The sequence of the Bacillus mycoides strain is shown as SEQ No.

1.

4. Use of the Bacillus mycoides strain as claimed in claim 1 in degrading coal gangue.

5. Use of the Bacillus mycoides strain as claimed in claim 1 in promoting plant growth.

6. Use of the Bacillus mycoides strain as claimed in claim 1 in promoting plant growth by accelerating the mineralization of soil matrix.

7. Use of the Bacillus mycoides strain as claimed in claim 1 in promoting plant growth by accelerating the humification of soil substrate.

8. The use according to claim 6 or 7, characterized in that: The soil matrix is ​​formed by mixing coal gangue and sand in a mass ratio of 1:1.

Images