Application of biomarker in preparation of product for predicting nephrotic syndrome relief of MCD patient after glucocorticoid treatment

Abstract

The invention provides application of a reagent for detecting the expression quantity of a biomarker in preparation of a product for predicting nephrotic syndrome relief of an MCD patient after glucocorticoid treatment. The marker is selected from at least one of a specific miRNA and a specific mRNA, the specific miRNA comprises miR-590-3p, miR-4772-5p, miR-582-5p and miR-424-5p, and the specific mRNA comprises ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE and GYPB. The invention further discloses a kit for detecting the miRNA, the kit for detecting the miRNA, the kit for detecting the miRNA, the kit for detecting the miRNA, the kit for detecting the miRNA, the kit for detecting the miRNA and the kit for detecting the miRNA, and the kit for detecting the miRNA. By detecting the expression quantity of the biomarker, accurate prediction of the glucocorticoid treatment effect of patients with minimal lesions can be realized, and a scientific basis is provided for individualized treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of a biomarker in the preparation of a product for predicting the remission of nephrotic syndrome in patients with MCD after glucocorticoid treatment. Background Art

[0002] Minimal change disease (MCD) is an immune-mediated glomerular disease and is one of the most common diseases leading to nephrotic syndrome (NS). Glucocorticosteroid (also known as steroid hormone, English name: glucocorticosteroid, abbreviated as GC / GCs) is commonly used in the treatment of minimal change disease. 90% of patients are sensitive to glucocorticosteroid treatment, but the recurrence rate of this disease is as high as 60%. Although clinical symptoms can provide certain clues, it is not enough to predict the remission of minimal change disease based solely on clinical symptoms. Usually, a combination of various examination methods and detection indicators is required for comprehensive evaluation. There is no effective detection index in the prior art to predict the remission of nephrotic syndrome induced by glucocorticosteroid treatment in patients with minimal change disease. Summary of the Invention

[0003] The purpose of the present invention is to provide a biomarker for predicting the remission of nephrotic syndrome in patients with MCD after glucocorticoid treatment. By detecting the expression level of the biomarker in the serum of the subject, the accurate prediction of the treatment effect of glucocorticosteroid in patients with minimal change disease can be realized, providing a scientific basis for individualized treatment.

[0004] To achieve the above purpose, the present invention provides the application of a reagent for detecting the expression level of a biomarker in the preparation of a product for predicting the remission of nephrotic syndrome in patients with MCD after glucocorticoid treatment. The biomarker is selected from at least one of specific miRNAs and specific mRNAs. The specific miRNAs include miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p. The specific mRNAs include ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB.

[0005] In a specific embodiment, the product includes a kit or a reagent.

[0006] In a specific embodiment, the test sample of the subject is serum.

[0007] In a specific embodiment, when the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p in the serum of a subject are highly expressed relative to the standard expression level, it is predicted that the subject has a high probability of remission of nephrotic syndrome induced by glucocorticoid in patients with minimal change disease, wherein the standard expression level refers to the average expression level before glucocorticoid treatment in patients with minimal change disease.

[0008] In a specific embodiment, the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p are positively correlated with the remission rate of nephrotic syndrome induced by glucocorticoid in a subject with minimal change disease.

[0009] In a specific embodiment, when the expression levels of ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB in the serum of a subject are highly expressed relative to the reference expression level, it is predicted that the subject has a high probability of remission of nephrotic syndrome induced by glucocorticoid in patients with minimal change disease, wherein the reference expression level refers to the average expression level before glucocorticoid treatment in patients with minimal change disease.

[0010] The beneficial effects of the present invention at least include:

[0011] First, the present invention first discovers that after long-term glucocorticoid treatment of MCD patients, there are differential expressions of specific miRNAs (miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p) and specific mRNAs (ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB) in the serum samples of the patients. Thus, the specific miRNAs and specific mRNAs can be used as markers for predicting the remission of nephrotic syndrome in MCD patients after glucocorticoid treatment, to assist in evaluating the effectiveness of glucocorticoid treatment for MCD patients, providing a new way for the prognosis prediction of MCD patients using glucocorticoid treatment, and thus providing a scientific basis for individualized treatment.

[0012] Second, the present invention can evaluate the remission of nephrotic syndrome in patients with minimal change disease after glucocorticoid treatment by detecting the expression levels of specific miRNAs and specific mRNAs in the serum of a subject with a detection reagent, so as to guide the clinical application of glucocorticoid.

[0013] III. Applying the reagents for detecting the expression levels of specific miRNAs and specific mRNAs to a kit can quickly predict the effectiveness of glucocorticoid treatment based on the remission of nephrotic syndrome, and continuously monitor and evaluate the immune system response, and promote the disease outcome by adjusting the treatment plan. Description of the Drawings

[0014] Figure 1 Figure for estimating the proportion of mRNA-seq cells in the sequencing analysis results of Example 1;

[0015] Figure 2 Figure for GSEA gene set enrichment analysis of mRNA after 2 months of glucocorticoid treatment;

[0016] Figure 3 Figure for GSEA gene set enrichment analysis of mRNA after 4 months of glucocorticoid treatment;

[0017] Figure 4 Figure for GSEA gene set enrichment analysis of mRNA after 8 months of glucocorticoid treatment;

[0018] Figure 5 Venn diagram of differentially expressed genes of mRNA after 2, 4, and 8 months of GC treatment respectively;

[0019] Figure 6 Cluster heat map of differentially expressed genes of mRNA after 2, 4, and 8 months of GC treatment respectively;

[0020] Figure 7 Figure for GSEA analysis of mRNA after conventional GC treatment;

[0021] Figure 8 Heat map of upregulated changes in mRNA caused by conventional GC treatment for 2, 4, and 8 months;

[0022] Figure 9 Volcano plot of mRNA regulatory changes caused by conventional GC treatment for 2 months;

[0023] Figure 10 Volcano plot of mRNA regulatory changes caused by conventional GC treatment for 4 months;

[0024] Figure 11 Volcano plot of mRNA regulatory changes caused by conventional GC treatment for 8 months;

[0025] Figure 12 Heat map of changes in log2FC values of the expression levels of specific mRNAs caused by conventional GC treatment for 2, 4, and 8 months;

[0026] Figure 13 Figure for enrichment of significantly different mRNA pathways;

[0027] Figure 14 The sensitivity and specificity ROC curves for the selected specific mRNA;

[0028] Figure 15 The significantly enriched map of mRNA pathways regulated by significantly different miRNAs;

[0029] Figure 16 The correlation diagram of partial mRNA and miRNA;

[0030] Figure 17 The heat map of miRNA up-regulation changes caused after 2, 4, and 8 months of conventional GC treatment;

[0031] Figure 18 The volcano plot of miRNA regulation changes caused after 2 months of conventional GC treatment;

[0032] Figure 19 The volcano plot of miRNA regulation changes caused after 4 months of conventional GC treatment;

[0033] Figure 20 The volcano plot of miRNA regulation changes caused after 8 months of conventional GC treatment;

[0034] Figure 21 The plot of log2FC value changes in the expression levels of specific miRNAs caused after 2, 4, and 8 months of conventional GC treatment;

[0035] Figure 22 The sensitivity and specificity ROC curves for the selected specific miRNA;

[0036] Figure 23 The KEGG network analysis diagram of miRNA potential regulatory genes;

[0037] Figure 24 The KEGG network analysis diagram of the mRNA encoding surface receptors among miRNA-regulated genes. Detailed implementation manners

[0038] The present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0039] For the experimental methods without specific conditions noted in the embodiments, they are generally in accordance with conventional conditions or the conditions recommended by the manufacturer. For the materials, reagents, etc. used in the following embodiments, unless otherwise specified, they can all be obtained from commercial channels.

[0040] Related technologies

[0041] Podocyte injury is one of the core pathological mechanisms of MCD. During the progression of minimal change disease, the expression of mRNA and miRNA related to the process of podocyte injury repair is abnormal, and these molecular mechanisms may be closely related to its pathogenesis and disease progression. For example, changes in the mRNA expression levels of specific podocyte markers (such as NPHS1 and WT1) and genes related to the maintenance of podocyte function (such as nephrin encoded by NPHS1 and podocin encoded by NPHS2) may reflect podocyte damage and disruption of the filtration barrier. The miR-30 family is involved in maintaining the podocyte structure, and its expression is related to foot process fusion, while overexpression of miR-193a is thought to induce podocyte apoptosis by targeting the WT1 gene. In addition, abnormal expression of mRNA and miRAN can also affect the onset and progression of MCD through regulation of cellular inflammatory injury and immune responses.

[0042] Studies have found that abnormal expression of mRNA related to cytoskeleton remodeling, inflammatory factors and apoptosis (such as ACTN4) occurs in the glomeruli of MCD patients. For example, miR-146a can participate in the regulation of inflammatory responses by regulating the nuclear factor κB (NF-κB) signaling pathway, and miR-155 may play a role in MCD by regulating T cell immune function. Abnormal methylation at specific loci of genes related to immune responses (such as IL-4, FOXP3) may alter the cytokine network and balance. Among the selected biomarkers above, TMEFF1 (Transmembrane Protein With EGF Like And Two Follistatin Like Domains 1) is a transmembrane protein expressed in podocytes or the glomerular basement membrane, which may affect the morphology and function of podocytes by regulating cytoskeleton-related pathways (such as Rho family small GTPases), and TMEFF1 may be a downstream target regulated by glucocorticoids, affecting its therapeutic effect. ACHE (Acetylcholinesterase) is acetylcholinesterase, which may participate in abnormal activation of T cells and immune-mediated podocyte injury by regulating the cholinergic anti-inflammatory pathway. CA1 (Carbonic Anhydrase 1) is a common carbonic anhydrase, and its abnormal expression may disrupt intracellular ion homeostasis and signal transduction, accelerate foot process fusion, and thus exacerbate the damage of the filtration barrier. GYPA (Glycophorin A) is a major glycoprotein on the erythrocyte membrane, and its damage may lead to the release of free radicals by erythrocytes, exacerbating the oxidative stress state of the glomeruli. Glucocorticoids may also indirectly affect GYPA-related metabolism and function by improving systemic inflammation and oxidative stress.

[0043] Regarding the miRNAs (miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p) that exhibit significant changes during the remission of nephrotic syndrome in patients with glucocorticoid-induced minimal change disease, although there is no clear research directly revealing their roles in MCD, they may all affect the occurrence, development, and prognosis of MCD through mechanisms such as podocyte injury and cytoskeleton regulation, inflammatory response and immune regulation, oxidative stress and apoptosis, participation in epigenetic regulation (such as DNA methylation or histone modification), and regulation of specific target gene expression. In summary, the relationship between mRNA and miRNA is complex and their interaction is tight, forming a multi-level gene expression regulation network, which plays a crucial role in the occurrence and development of various kidney diseases including minimal change disease.

[0044] Meanwhile, the interaction between mRNA / miRNA also constitutes the core mechanism of glucocorticoid signaling pathway regulation, and their synergistic effect promotes the remission of nephrotic syndrome. The glucocorticoid (GC) signaling pathway is the molecular mechanism by which cells respond to GC. Most GCs bind to corticosteroid-binding globulin (CBG) in plasma and enter the cell interior through passive diffusion, then bind to the glucocorticoid receptor (GR) inside the cell. GR is a nuclear receptor. After binding to GC, its conformation changes, exposing the nuclear localization signal. The GR-GC complex then translocates to the nucleus and binds to the glucocorticoid response element (GRE) on the promoter of the target gene in the form of a homodimer or heterodimer, recruiting a series of cofactors that regulate chromatin remodeling and activating or inhibiting the transcription of specific genes. Existing studies have shown that glucocorticoids are involved in epigenetic mechanisms, which are usually mediated by histone modification, DNA methylation, and microRNAs. Glucocorticoids not only regulate the expression of miRNAs through the glucocorticoid receptor in various physiological and pathological processes, but also through the combined effects of changing the expression of DNA methyltransferase (DNMT), inducing DNA demethylation, affecting histone modification, and changing the expression of glucocorticoid receptors, enabling glucocorticoids to induce or inhibit the expression of specific genes in different cell types and tissues.

[0045] Upon retrieval, it was found that mRNA and miRNA have long been used as biomarkers in the diagnosis and prognosis monitoring of various kidney diseases such as nephrotic syndrome, diabetic nephropathy, IgA nephropathy, membranous nephropathy, etc. However, there are few mRNA and miRNA biomarkers significantly related to the remission of nephrotic syndrome in patients with minimal change disease disclosed in the existing domestic and foreign technologies, and no research on biomarkers for predicting the remission of glucocorticoid-induced nephrotic syndrome has been found. Based on the important role of genomic and epigenetic changes in the progression of minimal change disease, and the fact that glucocorticoids may reverse these changes after being applied to the treatment of minimal change disease, in this invention, the changes in the expression levels of mRNA and miRNA at the 2nd, 4th, and 8th months after the remission of nephrotic syndrome induced by glucocorticoid treatment in 8 patients with minimal change disease were traced, and thus a detection kit for predicting the treatment effect of minimal change disease was developed. This invention is of great significance for predicting the disease outcome of patients with minimal change disease after glucocorticoid treatment.

[0046] The present invention provides the application of biomarkers in the preparation of products for predicting the remission of nephrotic syndrome in MCD patients after glucocorticoid treatment, wherein the biomarkers are selected from at least one of specific miRNA and specific mRNA, the specific miRNA includes miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p, and the specific mRNA includes ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB.

[0047] In the present invention, the number of specific miRNA is 4, and the number of specific mRNA is 8.

[0048] Among them: the ID and sequence of specific miRNA in the miRBase database are shown in Table 1, and the coordinate information of specific mRNA biomarkers is shown in Table 2.

[0049] Table 1 ID and sequence of specific miRNA in the miRBase database

[0050] miRNA Name miRBase Database ID Sequence Number Sequence miR-590-3p MIMAT0004801 SEQ ID NO.1 UAAUUUUAUGUAUAAGCUAGU miR-4772-5p MIMAT0019926 SEQ ID NO.2 UGAUCAGGCAAAAUUGCAGACU miR-582-5p MIMAT0003247 SEQ ID NO.3 UUACAGUUGUUCAACCAGUUACU miR-424-5p MIMAT0001341 SEQ ID NO.4 CAGCAGCAAUUCAUGUUUUGAA

[0051] Table 2 Coordinate information of specific mRNA

[0052]

[0053]

[0054] Preferably, the product includes a reagent or a kit.

[0055] When the product is a kit, in addition to the detection reagent, the kit may further include one or more conventional reagents required for methylation quantitative PCR, such as DNA extraction reagent, bisulfite, deionized water, Taq mixture buffer, etc.

[0056] In the present invention, the test sample of the subject is serum.

[0057] It can be understood that the reagent for detecting the expression level of the biomarker can be used to detect the expression level of any one of the 4 specific miRNAs, or can be used to detect the expression levels of any multiple of the 4 specific miRNAs; it can be used to detect the expression level of any one of the 8 specific mRNAs, or can be used to detect the expression levels of any multiple of the 8 specific mRNAs; at the same time, it can also be a combination for detecting the expression levels of specific miRNAs and specific mRNAs, wherein the specific miRNA is one or more, and the specific mRNA is one or more.

[0058] It should be noted that in the above description, multiple includes two or more than two.

[0059] Preferably, the Real-time RT-PCR (qPCR) method is used to detect the expression level of specific miRNAs.

[0060] Preferably, the mRNA qRT-PCR (qPCR) method is used to detect the expression level of mRNAs.

[0061] More preferably, when the biomarker to be detected is a specific miRNA, the specific probe has a base sequence complementary to one or more of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p.

[0062] In the present invention, the design of the specific probe and the PCR primers in the PCR reaction solution are conventional technical means in the art and can also be designed as other sequences. Exemplarily: the PCR primer design for specific miRNAs is shown in Table 3, and the PCR primer design for specific mRNAs is shown in Table 4.

[0063] Table 3 PCR primer sequences for specific miRNAs

[0064]

[0065]

[0066] Table 4 PCR primer sequences for specific mRNAs

[0067]

[0068] Preferably, when the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p in the serum of a subject are highly expressed relative to the standard expression level, it is predicted that the probability of the subject using glucocorticoids to induce remission of nephrotic syndrome in patients with minimal change disease is high, where the standard expression level refers to the average expression level before glucocorticoid treatment in patients with minimal change disease.

[0069] Preferably, the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p are positively correlated with the remission rate of the subject using glucocorticoids to induce remission of nephrotic syndrome in patients with minimal change disease.

[0070] Preferably, when the expression levels of ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB in the serum of a subject are highly expressed relative to the reference expression level, it is predicted that the probability of the subject using glucocorticoids to induce remission of nephrotic syndrome in patients with minimal change disease is high, where the reference expression level refers to the average expression level before glucocorticoid treatment in patients with minimal change disease.

[0071] It should be noted that in the present invention, both the reference expression level and the standard expression level can be described as the baseline, which is the standard for judging high or low expression levels.

[0072] Example 1

[0073] Screening and Validation of mRNA Markers for Predicting Remission of Nephrotic Syndrome in Patients with Minimal Change Disease Induced by Glucocorticoid Treatment

[0074] 1.1. Prospective Time-Series Study

[0075] Eight patients diagnosed with minimal change disease (MCD) and presenting with initial nephrotic syndrome (NS) were selected for an 8-month follow-up. In this time-series study, all patients were fully informed and received a standard conventional glucocorticoid treatment regimen, which started with high-dose oral prednisone (1 mg / kg / day, maximum 80 mg / day) or an equivalent dose of methylprednisolone (0.8 mg / kg / day), treated for 6 to 8 weeks, and reduced by 5 mg every two weeks after complete remission. The patients included in the study did not receive any immunosuppressive therapy other than glucocorticoids. Patients who did not achieve complete remission of nephrotic proteinuria within 8 weeks or had early recurrence were excluded from this study and received other immunosuppressive therapies.

[0076] 1.2. Research Methods

[0077] The total RNA of the samples was extracted using the PAXgene Blood miRNA Kit (Cat#763134, Qiagen) according to the standard operating procedures provided by the manufacturer. After the extracted total RNA passed the electrophoresis quality inspection by the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), the total RNA was purified using the RNAClean XP Kit (Cat A63987, Beckman Coulter, Brea Corporation, Kramer Avenue, CA, USA) and the Enzymatic DNase Set (Cat#79254, Qiagen, GmbH, Germany). The quality inspection of the total RNA was performed using the NanoDrop ND-2000 spectrophotometer and the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The qualified RNA could be used for subsequent sequencing experiments. The steps of mRNA isolation, fragmentation, first-strand cDNA synthesis, second-strand cDNA synthesis, end repair, 3'-end adenylation, adapter ligation, and enrichment were performed on the purified total RNA according to the experimental operation instructions to complete the construction of the sequencing sample library. According to the corresponding procedures shown in the cBot User Guide, cluster generation and first-strand sequencing primer hybridization were completed on the cBot equipped with the Illumina sequencer. The sequencing reagents were prepared according to the Illumina User Guide, and the flow cell carrying the clusters was loaded onto the machine. The paired-end program was selected for paired-end sequencing. The sequencing process was controlled by the data collection software provided by Illumina, and real-time data analysis was performed.

[0078] Wherein:

[0079] The steps for rRNA removal and RNA fragmentation include: 1. Make up the purified RNA sample of 1 - 3 μg to 10 μl with nuclease - free water; 2. Add 5 μl of rRNA binding buffer; 3. Add 5 μl of rRNA removal mixture; 4. Gently pipette 10 times to mix evenly; 5. Place the sample on a PCR instrument at 65 °C for 5 minutes; 6. After incubation, let the sample stand at room temperature for 1 minute; 7. Place the rRNA removal beads on a vortex to evenly suspend the magnetic beads; 8. Add 35 μl of rRNA removal beads s to the sample and pipette 20 times to ensure uniform mixing of the sample and the magnetic beads; 9. Let the mixed magnetic beads and sample stand at room temperature for 1 minute; 10. After standing at room temperature for 1 minute, place it on a magnetic stand at room temperature for 1 minute; 11. After the solution becomes clear, transfer the supernatant to a new centrifuge tube; 12. Place the centrifuge tube containing the supernatant from step 11 on a magnetic stand for 1 minute; 13. After the solution becomes clear, transfer the supernatant to a new centrifuge tube again; 14. Place the RNA Clean XP beads on a vortex to evenly suspend the magnetic beads; 15. Take 90 μl of RNA Clean XP beads and add them to the sample, and pipette thoroughly to ensure uniform mixing of the sample and the magnetic beads; 16. Let the well - mixed sample and magnetic beads stand at room temperature for 15 minutes; 17. After standing at room temperature, place it on a magnetic stand at room temperature for 5 minutes; 18. After the sample becomes clear, remove the supernatant; 19. Place the sample on a magnetic stand, add 200 μl of freshly prepared 70% ethanol, let it stand for 30 s, and then remove the supernatant; 20. Repeat step 19; 21. Let the sample dry at room temperature for 15 minutes, and then remove the sample from the magnetic stand; 22. Slightly shake the elution buffer at room temperature; 23. Add 11 μl of elution buffer to the sample and evenly suspend the magnetic beads in the elution buffer; 24. Let the sample with elution buffer stand at room temperature for 2 minutes; 25. After standing at room temperature, place the sample on a magnetic stand for 5 minutes; 26. After the sample becomes clear, transfer 8.5 μl of the supernatant to a 0.3 ml centrifuge tube; 27. Add 8.5 μl of elution stock solution fragment high mixture to the sample and mix thoroughly; 28. Place the sample on a PCR instrument at 94 °C for 8 minutes, and then keep it at 4 °C.

[0080] Note: Immediately perform the synthesis of the first - strand cDNA after fragmentation.

[0081] The steps for mRNA purification and fragmentation include: 1. Add 1 - 3 g of purified total RNA to a 1.5 ml enzyme - free water centrifuge tube and adjust the volume to 50 μL with enzyme - free water; 2. Vigorously shake and mix the RNA purification magnetic beads evenly.

[0082] 3. Add 50 μL of the well-mixed RNA purification magnetic beads into a 1.5-ml EP tube containing RNA. Gently pipette several times until well mixed; 4. Incubate the sample in a metal bath at 65 °C for 5 minutes; 5. Remove the sample from the metal bath and let it stand at room temperature for 5 minutes; 6. Place the 1.5-ml EP tube containing the magnetic beads and RNA on a magnetic stand and wait for 5 minutes to allow the magnetic beads to fully adsorb to the magnetic stand; 7. After the supernatant is clear, discard the supernatant. Pick up the 1.5-ml EP tube containing the mRNA-magnetic beads from the magnetic stand, add 200 μL of magnetic bead washing buffer, mix well, then place it on the magnetic stand again for adsorption and wait for 5 minutes; 8. Discard the supernatant, and then add 50 μL of elution buffer and mix well; 9. After mixing, incubate the sample in a metal bath at 80 °C for 2 minutes to elute the mRNA from the magnetic beads; 10. Wait for the sample to cool to room temperature, then add 50 μL of magnetic bead binding buffer to the 1.5-mL EP tube containing the mRNA-magnetic beads, mix well and let it stand at room temperature for 5 minutes; 11. Place the re-bound EP tube on the magnetic stand for adsorption for 5 minutes to allow the magnetic beads containing mRNA to fully adsorb to one side of the magnetic stand and separate from the supernatant; 12. After the supernatant is clear, discard the supernatant. Remove the EP tube containing the mRNA-magnetic beads from the magnetic stand, add 200 μL of magnetic bead washing buffer, mix well, then place it on the magnetic stand again for adsorption and wait for 5 minutes; 13. Discard the supernatant, remove the EP tube containing the mRNA-magnetic beads from the magnetic stand, add 19.5 μL of elution stock fragment high mixture and mix well; 14. Incubate the sample in a metal bath at 94 °C for 6 minutes, then let it cool at room temperature; 15. Place the EP tube containing the mRNA-magnetic beads on the magnetic stand for adsorption for 5 minutes; 16. After the supernatant is clear, transfer at least 17 μL of the supernatant to a 200-μL PCR tube.

[0083] The steps for first-strand cDNA synthesis include: 1. Prepare the mixture: 1 μl of SuperScript II plus 9 μl of the first-strand synthesis mixture; 2. Add 8 μl of the mixture to the fragmented sample in the first chapter and mix well; 3. Place the sample on a PCR instrument and run the following program: · 25 °C for 10 minutes, · 42 °C for 15 minutes, · 70 °C for 15 minutes, · Hold at 4 °C.

[0084] The steps of second-strand cDNA synthesis include: 1. After the first-strand synthesis is completed, add 5 μl of resuspension buffer to the sample; 2. Then add 20 μl of the second-strand labeling reaction mixture and mix well; 3. Place the sample on a PCR instrument and run the following program: · 16°C for 1 hour, · keep at 4°C. After the program ends, purify the sample. First, place the AMPure XP magnetic beads on a vortex mixer and shake well to make the magnetic beads evenly suspended in the buffer; 4. Add 90 μl of AMPure XP magnetic beads to the sample and mix well; 5. Incubate the sample and the magnetic beads at room temperature for 15 minutes; 6. After incubation, place the mixture of the sample and the magnetic beads on a magnetic stand at room temperature for 5 minutes; 7. After standing, wait for the solution to clarify and discard 135 μl of the supernatant; 8. Place the sample on a magnetic stand, add 200 μl of fresh 80% EtOH to the sample, and after 30 s, remove the ethanol supernatant; 9. Repeat step 8; 10. Place the sample at room temperature for 15 minutes to dry the sample; 11. Add 17.5 μl of resuspension buffer to wash the magnetic beads off the tube wall and make them fully suspended; 12. Incubate the sample at room temperature for 2 minutes; 13. After incubation, place the sample on a magnetic stand at room temperature for 5 minutes; 14. After the solution clarifies, pipette 15 μl of the supernatant into a new tube.

[0085] Note: After this step is completed, the sample can be refrigerated in a -20°C refrigerator.

[0086] The steps of 3'-end adenylation include: 1. Add 2.5 μl of resuspension buffer to each sample; 2. Add 12.5 μl of the A-Tailing mixture to each sample and mix well; 3. Place the sample on a PCR instrument and select the program: 37°C for 30 minutes, 70°C for 5 minutes, keep at 4°C; 4. After the program ends, place the sample on ice and immediately ligate the sequencing adapter.

[0087] The steps for connecting the adapter include: 1. Add 2.5 μl of resuspension buffer to the sample and mix well; 2. Add 2.5 μl of RNA adapter index to the sample and mix well; 3. Add 2.5 μl of adapter mixture to the sample and mix well; 4. Place the sample on a PCR instrument, select the program of 30°C for 10 minutes and hold at 4°C; 5. After the PCR program ends, add 5 μl of stop adapter buffer to the sample and mix well; 6. Subsequently, purify the sample. First, place the AMPure XP magnetic beads on a vortex mixer and shake well to evenly suspend the magnetic beads in the buffer; 7. Add 42 μl of AMPure XP magnetic beads to the sample and mix evenly; 8. Incubate the sample and the magnetic beads at room temperature for 15 minutes; 9. After incubation, place the mixture of the sample and the magnetic beads on a magnetic stand at room temperature for 5 minutes; 10. After the solution becomes clear, discard 79.5 μl of the supernatant; 11. Place the sample on a magnetic stand, add 200 μl of fresh 80% EtOH to the sample, and after 30 s, remove the ethanol supernatant; 12. Repeat step 11; 13. Place the sample at room temperature for 15 minutes to dry the surface of the sample; 14. Add 52.5 μl of resuspension buffer to wash the magnetic beads off the tube wall and make them fully suspended; 15. Incubate the sample at room temperature for 2 minutes; 16. After incubation, place the sample on a magnetic stand at room temperature for 5 minutes; 17. After the solution becomes clear, aspirate 50 μl of the supernatant into a new tube; 18. Add another 50 μl of AMPure XP magnetic beads to the just aspirated sample and mix evenly; 19. Incubate the sample and the magnetic beads at room temperature for 15 minutes; 20. After incubation, place the mixture of the sample and the magnetic beads on a magnetic stand at room temperature for 5 minutes; 21. After the solution becomes clear, discard 95 μl of the supernatant; 22. Place the sample on a magnetic stand, add 200 μl of fresh 80% EtOH to the sample, and after 30 s, remove the ethanol supernatant; 23. Repeat step 22; 24. Place the sample at room temperature for 15 minutes to dry the surface of the sample; 25. Add 22.5 μl of resuspension buffer to wash the magnetic beads off the tube wall and make them fully suspended; 26. Incubate the sample at room temperature for 2 minutes; 27. After incubation, place the sample on a magnetic stand at room temperature for 5 minutes; 28. After the solution becomes clear, aspirate 20 μl of the supernatant into a new tube.

[0088] The PCR amplification method includes the following steps: 1. Add 5 μl of the PCR primer mixture to each sample; 2. Add 25 μl of the main PCR mixture to each sample and mix well; 3. Place the samples on a PCR instrument and run the program; 4. After the PCR program ends, purify the samples. First, place the AMPure XP magnetic beads on a vortexer and shake well to evenly suspend the magnetic beads in the buffer; 5. Add 50 μl of AMPure XP magnetic beads to the samples and mix well; 6. Incubate the samples and the magnetic beads at room temperature for 15 minutes; 7. After incubation, place the mixture of the samples and the magnetic beads on a magnetic rack at room temperature for 5 minutes; 8. After incubating for 5 minutes and waiting for the solution to clarify, discard 95 μl of the supernatant; 9. Place the samples on a magnetic rack, add 200 μl of fresh 80% EtOH to the samples, and after 30 s, remove the ethanol supernatant; 10. Repeat step 7; 11. Place the samples at room temperature for 15 minutes to dry the surface of the samples; 12. Add 32.5 μl of resuspension buffer to wash the magnetic beads off the tube wall and make them fully suspended; 13. Incubate at room temperature for 2 minutes; 14. After completion, place the samples on a magnetic rack at room temperature for 3 minutes; 15. After the solution clarifies, aspirate 30 μl of the supernatant into a new tube.

[0089] The steps for library quality inspection include: 1. Take 1 μL of the library DNA and quantify it using a Qubit 2.0 fluorometer; 2. Detect the size distribution using an Agilent 2100, and the band distribution is around 350 bp; 3. Store the library samples at -20 °C.

[0090] 1.3. mRNA Sequencing and Analysis

[0091] After obtaining the mRNA expression matrix, the ABIS program was used to infer the distribution of immune cells in the peripheral blood of patients. Next, assuming a negative binomial distribution model, gene normalization and standardization were performed, and the DESeq2 package was used to identify differentially expressed genes. Data visualization was performed using the ggplot2, VennDiagram, tibble, and dplyr packages, while gene enrichment analysis was performed using the clusterProfiler package.

[0092] Details of the sequencing and analysis are shown in Figures 1 to 8 . Among them:

[0093] Figure 1 This is the estimation of mRNA-seq cell proportions. In mRNA sequencing, the proportions of various cell types in each patient can be estimated by analyzing transcriptome data, and this method is usually referred to as "cell type deconvolution" or "cell type proportion estimation". It can be seen that the proportions of neutrophils and CD4+ T memory cells are the highest among these patients, and they may participate in the immune regulation during the remission process of minimal change nephrotic syndrome.

[0094] Figure 2 mRNA gene enrichment and GSEA analysis after 2 months of glucocorticoid treatment Figure 3 mRNA gene enrichment and GSEA analysis after 4 months of glucocorticoid treatment Figure 4 mRNA gene enrichment and GSEA analysis after 8 months of glucocorticoid treatment. From Figures 2 to 4 It can be seen that after the 2nd month of GC treatment, the mRNA expression levels related to enzyme inhibitory activity and peptidase regulatory activity are the highest; after the 4th month of GC treatment, the mRNA expression levels related to carbohydrate binding, sulfur compound binding, immune receptor activity, and cytokine binding are the highest; after the 8th month of GC treatment, the mRNA expression levels related to ribosomal structural components, immune receptor activity, and heparin binding are the highest. And the P values are all statistically significant, that is, the differences are significant.

[0095] Figure 5 Venn diagram of differentially expressed genes after 2, 4, and 8 months of GC treatment respectively Figure 6 Cluster heatmap of differentially expressed genes after 2, 4, and 8 months of GC treatment respectively. The Venn diagram shows that a total of 140 mRNAs with significant expression differences were detected at these three detection time points. The cluster heatmap is used to display the similarity and difference in the expression of these mRNAs among multiple samples. The color bar in the upper right corner represents the range of data, that is, the log2FC value, and the color depth represents the magnitude of this value. The above 8 mRNA markers were taken from the most significantly upregulated among these 140, indicating that these mRNA markers are stably regulated and easy to detect during the remission process of glucocorticoid-induced minimal change nephrotic syndrome.

[0096] Figure 7 GSEA analysis chart after conventional GC treatment. GSEA analysis is an analytical method used to identify a set of genes related to specific biological functions, pathways, or processes. It detects its significant enrichment by evaluating the distribution position of a predefined gene set in a set of sorted samples. The running enrichment score is shown above. The higher the RES, the more significant the selected gene set within this ranking range. The ranking list metrics below provide a global perspective on the importance of genes in the entire dataset. It can be seen that the fatty acid metabolism pathway is the most active, that is, the most correlated, in the region of higher gene rankings.

[0097] 1.4. Experimental results

[0098] For the experimental method, please refer to the research method in 1.2. For the experimental results, please refer to Figures 8 to 14 .

[0099] Among them: Figure 8This is a heatmap showing the mRNA regulatory changes induced after 2, 4, and 8 months of conventional GC treatment. It can be seen that the expression levels of ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB were significantly upregulated at all three detection points.

[0100] Figure 9 This is a volcano plot showing the mRNA regulatory changes induced after 2 months of conventional GC treatment. Figure 10 This is a volcano plot showing the mRNA regulatory changes induced after 4 months of conventional GC treatment. Figure 11 This is a volcano plot showing the mRNA regulatory changes induced after 8 months of conventional GC treatment. Volcano plots are commonly used to display the results of differential analysis in gene expression or other omics data. X-axis (log2FC): Represents the fold change in gene expression, with base 2 logarithm. Positive values indicate upregulation, and negative values indicate... Y-axis (-log10 P Value): Represents statistical significance. The smaller the P value, the higher the position of the point on the Y-axis. The P value is logarithmically transformed for easier display in the graph. Red dots represent the significantly upregulated genes identified: ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB. From Figures 9 to 11 It can be seen that ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB were significantly upregulated at all three monitoring points.

[0101] Figure 12 This is a graph showing the changes in log2FC values of mRNA expression levels induced after 2, 4, and 8 months of conventional GC treatment. It can be seen from this the overall changes in log2FC values of ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE, and GYPB.

[0102] Figure 13 This shows the enrichment of significantly different mRNA pathways, indicating a large number and significance of immune receptor activities.

[0103] Figure 14ROC curve for the selected specific mRNA. The count values of the corresponding mRNA in the original sequencing data at 22 detection time points of 8 patients were selected and divided into two groups: disease state and remission state. Among them, the disease state corresponded to the count values before treatment in 8 groups, and the remission state corresponded to the count values after 2, 4, and 8 months of glucocorticoid treatment in 14 groups. The areas under the curves of 8 specific mRNAs were ACHE - 0.839, CA1 - 0.946, GYPA - 0.888, TMEFF1 - 0.848, DEFA4 - 0.902, EMID1 - 0.875, ELANE - 0.875, and GYPB - 0.893, indicating high detection sensitivity and specificity.

[0104] The specific log2FC values and p - values of the regulatory changes of specific mRNAs after 2, 4, and 8 months of GC treatment are shown in Table 5.

[0105] Table 5 Specific log2FC values and p - values of the regulatory changes of specific mRNAs after 2, 4, and 8 months of GC treatment

[0106] Gene Name February log2FC April log2FC August log2FC February p-value April p-value August p-value ACHE 4.0596 4.5109 4.3484 0.0086 0.0026 0.0086 CA1 3.2876 3.6718 3.4480 0.0000 0.0000 0.0000 GYPA 4.0195 4.7057 4.2191 0.0025 0.0009 0.0033 TMEFF1 4.5517 3.7635 4.6476 0.0212 0.0465 0.0046 DEFA4 4.7056 4.6010 2.9610 0.0000 0.0010 0.0001 EMID1 3.8708 2.9037 2.8134 0.0000 0.0006 0.0018 ELANE 4.6159 4.4895 2.9091 0.0000 0.0000 0.0009 GYPB 2.8160 3.5106 3.3651 0.0003 0.0001 0.0000

[0107] As can be seen from Table 5, the P - values are all < 0.05, showing statistical significance.

[0108] Example 2

[0109] Screening and validation of miRNA markers for predicting remission of minimal change nephrotic syndrome in patients treated with glucocorticoids

[0110] 2.1. Prospective time - series study

[0111] Eight patients diagnosed with minimal change disease (MCD) and presenting with a first episode of nephrotic syndrome (NS) were selected for an 8 - month follow - up. In this time - series study, all patients were fully informed and received a standard conventional glucocorticoid treatment regimen, which started with high - dose oral prednisone (1 mg / kg / day, maximum 80 mg / day) or an equivalent dose of methylprednisolone (0.8 mg / kg / day), treated for 6 - 8 weeks, and then reduced by 5 mg every two weeks after complete remission. The patients included in the study did not receive any immunosuppressive agents other than glucocorticoids. Patients who did not achieve complete remission of nephrotic proteinuria within 8 weeks or had early recurrence were excluded from this study and received other immunosuppressive treatments.

[0112] It should be noted that the samples selected in this example are exactly the same as those in Example 1.

[0113] 2.2 Research methods

[0114] Using mirVanaTM The miRNA isolation kit (Cat#.AM1561, Austin, Texas, USA) was used to extract total RNA from the samples according to the standard operating procedures provided by the manufacturer. The extracted total RNA was reserved for use after passing the electrophoresis quality inspection by the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). The purified total RNA was subjected to steps such as 3'-end adapter ligation, 5'-end adapter ligation, reverse transcription, amplification, cDNA library size selection, and purification according to the experimental operation instructions to complete the construction of the sequencing sample library. The constructed library was quantified using a 2.0 fluorometer, and the size of the library was detected by the Agilent 2100. According to the corresponding procedures shown in the cBot user guide, cluster generation and hybridization of the first-strand sequencing primer were completed on the cBot equipped with the Illumina HiSeq sequencer. The sequencing reagents were prepared according to the Illumina user guide, and the flow cell carrying the clusters was loaded onto the machine. The single-read program was selected for single-end sequencing. The sequencing process was controlled by the data collection software provided by Illumina, and real-time data analysis was performed.

[0115] Total RNA was isolated from the samples using the miRNeasy Serum / Plasma Kit (Qiagen, Germany). Paired-end libraries were synthesized using the QIAseq miRNA Library Kit (Qiagen, Germany) according to the manufacturer's instructions. The purified library was quantified using a 2.0 fluorometer (Life Technologies, USA) and verified using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA) to determine the insert size and calculate the molar concentration. The library was diluted to 10 pM, clusters were generated by cBot, and then sequenced on the Illumina NovaSeq 6000 (Illumina, USA). Library construction and sequencing were completed by Shanghai Biotechnology Company.

[0116] The raw sequences were preprocessed using fastx (version: 0.0.13) to filter out low-quality reads, as well as sequences with 3' primers, 5' primers, polyA tails, or insertion tags. Further annotation analysis was performed using the commercial software Bowtie. Briefly, the obtained clean reads were aligned with various databases, including ncRNA, piRNA, and Rfam, allowing a maximum of 2 nt mismatches to remove non-coding RNAs such as rRNA, tRNA, snRNA, and snoRNA. The remaining reads were analyzed by BLAST searching and aligning with the mature miRNA sequences and precursor structures annotated in miRBase (version 22.0) to identify conserved miRNAs. Only those small RNAs that exactly match known miRNAs or miRBase precursors were considered conserved mature miRNAs. For sequences that did not match the sequences in the above databases, the miRCat program in the sRNA tool suite sofpage2 was used to analyze the genome. The genomic hit distribution pattern and the secondary structure of the genomic regions corresponding to the sRNA hits were observed to predict mature miRNAs and their precursor structures. When the minimum free energy and Randfold p-value of the precursor with a stem-loop hairpin were respectively lower than kcal / mol and 0.1, the precursor with a stem-loop hairpin could be predicted. After completing all annotation steps, size distribution and saturation analysis were performed using the sequences.

[0117] 2.3 miRNA sequencing analysis

[0118] After obtaining the miRNA expression matrix, differential expression analysis of miRNAs was performed using DESeq2; at the same time, enrichment analysis was performed using the clusterProfiler, GSEABase, and miRBaseConverter packages, mapping mRNA enrichment to miRNAs. The specific results are shown in Figures 15 to 16 .

[0119] Figure 15 is the enrichment map of significantly differentially regulated mRNA pathways by significantly differentially expressed miRNAs, Figure 16 is the correlation diagram of some mRNAs and miRNAs. From Figure 15 it can be seen that the GO enrichment pathways of miRNA_mRNA are concentrated in pathways related to immune receptor activity and neutral amino acid transmembrane transporter activity; Figure 16 shows the corresponding relationship between some mRNAs regulated by miRNAs as target genes, demonstrating a multi-level gene expression regulation network between mRNAs and miRNAs.

[0120] 2.4 Statistical analysis

[0121] Detect and compare the changes in the content of miRNAs in the serum samples of patients with minimal change disease before and after remission of nephrotic syndrome using glucocorticoids and before hormone treatment. Using the statistical analysis tool in EXCEL, calculate the mean and standard deviation of each group. Use the t-test between the two groups. P<0.05 is considered statistically significant, and P<0.01 is considered to have a significant difference.

[0122] 2.5 Experimental results

[0123] The experimental results are shown in Figures 17 to 24 .

[0124] Among them: Figure 17 is the heat map of the regulatory changes of some miRNAs caused by conventional GC treatment at 2, 4, and 8 months. It can be seen from Figure 17 that after remission of nephrotic syndrome in patients with minimal change disease using glucocorticoids, the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p in the serum increased significantly.

[0125] The above results show that there are significant differences in the expression levels of serum miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p before and after glucocorticoid treatment, suggesting that the upregulation of any one of these miRNAs is of significance in indicating the remission degree of nephrotic syndrome in patients with minimal change disease.

[0126] Figure 18 is the volcano plot of miRNA regulatory changes caused by conventional GC treatment at 2 months, Figure 19 is the volcano plot of miRNA regulatory changes caused by conventional GC treatment at 4 months, Figure 20 is the volcano plot of miRNA regulatory changes caused by conventional GC treatment at 8 months. It can be seen from Figures 18 to 20 that miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p were significantly upregulated at all three monitoring points.

[0127] Figure 21 is the heat map of the change in log2FC value of miRNA expression levels caused by conventional GC treatment at 2, 4, and 8 months. It can be seen from Figure 21 the overall change in the log2FC values of the four miRNAs miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p.

[0128] Figure 22ROC curves of sensitivity and specificity for the selected specific miRNAs. The count values of the corresponding miRNAs in the original sequencing data of 8 patients at 22 detection time points were selected and divided into two groups: disease state and remission state. Among them, the disease state corresponded to the count values before treatment in 8 groups, and the remission state corresponded to the count values after 2, 4, and 8 months of glucocorticoid treatment in 14 groups. The areas under the curves of 8 specific miRNAs were miR-590-3p: 0.786, miR-4772-5p: 0.862, miR-582-5p: 0.862, and miR-424-5p: 0.862, indicating high sensitivity and specificity at these monitoring points.

[0129] Figure 23 KEGG network analysis diagram of potential regulatory genes of miRNAs; Figure 24 KEGG network analysis diagram of mRNAs encoding surface receptors among miRNA-regulated genes; From Figure 23 and Figure 24 it can be seen the multiple biological signaling pathways and their interrelationships involved by miRNAs and mRNAs, including pathways such as the JAK-STAT signaling pathway, cytokine-cytokine receptor interaction, antigen presentation, and neutral amino acid transmembrane transport activities. These pathways form intricate connections and jointly participate in the remission process of nephrotic syndrome.

[0130] The specific log2FC values and p values of the regulatory changes of specific miRNAs after 2, 4, and 8 months of GC treatment are shown in Table 6.

[0131] Table 6 Specific log2FC values and p values of the regulatory changes of specific miRNAs after 2, 4, and 8 months of GC treatment

[0132] miRNA February log2FC April log2FC August log2FC February P-value April P-value August P-value hsa-miR-590-3p 3.4981 2.7286 2.8068 0.0000 0.0028 0.0020 hsa-miR-4772-5p 2.9389 2.6131 2.0868 0.0007 0.0038 0.0472 hsa-miR-582-5p 2.8015 2.4735 2.4742 0.0007 0.0038 0.0472 hsa-miR-424-5p 2.6782 2.1863 3.0357 0.0000 0.0003 0.0000

[0133] As can be seen from Table 6, the P values are all <0.05, which is statistically significant.

[0134] The above content is a further detailed description of the present invention in combination with specific preferred embodiments. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention belongs, without departing from the concept of the present invention, several simple deductions and substitutions can still be made, which should all be regarded as belonging to the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the expression of a biomarker in the preparation of a product for predicting the remission of nephrotic syndrome in MCD patients after glucocorticoid treatment, characterized in that: The biomarker is selected from at least one of specific miRNA and specific mRNA, the specific miRNA includes miR-590-3p, miR-4772-5p, miR-582-5p and miR-424-5p, and the specific mRNA includes ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE and GYPB.

2. The use according to claim 1, characterized in that: The product includes a kit or a reagent.

3. The use according to claim 1, characterized in that: The test sample of the subject is serum.

4. The use according to any one of claims 1 to 3, characterized in that: When the expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p in the serum of the subject are highly expressed relative to the standard expression levels, it is predicted that the subject has a high probability of using glucocorticoids to induce remission of nephrotic syndrome in patients with minimal change disease, wherein the standard expression level refers to the average expression level of the minimal change disease in patients before glucocorticoid treatment.

5. The use according to claim 4, characterized in that: The expression levels of miR-590-3p, miR-4772-5p, miR-582-5p, and miR-424-5p were positively correlated with the remission rate of nephrotic syndrome in patients with minimal change disease induced by glucocorticoids.

6. The use according to any one of claims 1 to 3, characterized in that: When the expression levels of ACHE, CA1, GYPA, TMEFF1, DEFA4, EMID1, ELANE and GYPB in the serum of the subject are highly expressed relative to the reference expression levels, it is predicted that the subject has a high probability of using glucocorticoids to induce remission of nephrotic syndrome in patients with minimal change disease, wherein the reference expression level refers to the average expression level of the disease in patients with minimal change disease before glucocorticoids are used for treatment.

Images