Anti-tumor vaccine as well as preparation method and application thereof
The anti-tumor vaccine BCG-CW@LNT prepared by combining the BCG-CW cell wall component (BCG-CW) with liquid nitrogen-treated tumor cells (LNT), solved the problem of weak immunogenicity of the existing vaccine, significantly enhanced anti-cancer immunity, and showed good anti-tumor treatment effects and long-term memory effects.
Patent Information
- Application Number
- CN202510313206.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-17
AI Technical Summary
The existing tumor vaccines have weak immunogenicity and are difficult to induce long-term effective immune responses, resulting in frequent new and recurrent infections.
By extracting cell wall components (BCG-CW) from BCG vaccine and combining with liquid nitrogen-treated tumor cells (LNT), the anti-tumor vaccine BCG-CW@LNT was prepared, and "therapeutic dead cells" were used to trigger a wide range of antigenic reactions and enhance anti-cancer immunity.
The BCG-CW@LNT vaccine significantly activates bone marrow-derived dendritic cells, enhances their antigen presentation ability, enhances T-cell-mediated specific immune response, shows good anti-tumor treatment effects, and has long-term memory effects.
Smart Images

Figure CN120093906A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of tumor vaccines, and in particular to an anti-tumor vaccine and a preparation method and application thereof. Background Art
[0002] Among the treatment methods for malignant tumors, the use of therapeutic tumor vaccines is an important breakthrough in the treatment of malignant tumors. By activating the patient's own immune system, tumor cells, tumor-specific or related antigens are used to induce cellular and humoral immune responses in the body, thereby achieving the purpose of clearing or controlling the tumor. However, traditional vaccines currently have weak immunogenicity and are difficult to induce the body to produce long-term effective immune responses, resulting in many new and recurrent infections. This requires more research and innovation to overcome these challenges in order to achieve a wider clinical application of tumor vaccines.
[0003] At present, except for the Bacillus Calmette-Guérin (BCG) infusion used for more than 40 years to treat high-risk non-muscle invasive bladder cancer (NMIBC), there are still few studies on specific tumor vaccines for cancer. Therefore, it may be worth exploring the development of therapeutic tumor vaccines based on BCG, which is expected to provide a new option for safer and more effective immunotherapy for cancer. Summary of the invention
[0004] The technical problem to be solved by the present invention is to provide an anti-tumor vaccine BCG-CW@LNT in view of the deficiencies in the prior art.
[0005] Another technical problem to be solved by the present invention is to provide a method for preparing the above anti-tumor vaccine.
[0006] The final technical problem to be solved by the present invention is to provide the use of the above anti-tumor vaccine in the preparation of anti-tumor vaccine preparations for cancer treatment.
[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:
[0008] A method for preparing an anti-tumor vaccine, first extracting the main immune-activating component from BCG: the cell wall component (BCG-CW). Subsequently, the tumor cells are treated by rapid freezing and thawing with liquid nitrogen to obtain LNT cells. Using this "therapeutic dead cell", the whole cell is used to induce a wide range of antigenic responses, simulating the natural presentation of antigens in the tumor microenvironment, thereby enhancing anti-cancer immunity. Then, BCG-CW is combined with LNT to prepare the anti-tumor vaccine BCG-CW@LNT.
[0009] The specific steps include:
[0010] (1) The BCG bacteria are centrifuged to collect the precipitate, washed, resuspended, and heat-inactivated, and then subjected to ultrasonic treatment to obtain a homogenate, and the homogenate is heat-treated and then centrifuged to collect the precipitate, and the obtained precipitate is defatted and deproteinized to prepare BCG cell wall BCG-CW;
[0011] (2) collecting tumor cells by centrifugation and resuspending them in a cryopreservation solution, and freezing the cryopreservation solution containing tumor cells with liquid nitrogen to obtain LNT cells;
[0012] (3) The BCG cell wall BCG-CW obtained in step (1) and the LNT cells obtained in step (2) are oscillated and mixed to prepare the anti-tumor vaccine BCG-CW@LNT.
[0013] Wherein, in step (1), the BCG bacteria are BCG bacteria in the logarithmic growth phase obtained through pre-culture.
[0014] Specifically, BCG bacteria (BCG) were inoculated into Middlebrook 7H9 medium (purchased from Coolable, catalog number MKC-301) for pre-culture, and cultured at 37° C. and 120 rpm with shaking until the logarithmic growth phase.
[0015] Wherein, in step (1), the heat inactivation is carried out under the conditions of: heating at 100-125°C for 10-20 min; the preferred conditions are: heating at 100°C in a pressure cooker for 20 min.
[0016] Wherein, the washing in step (1) is done with PBS buffer; the resuspending is done in 1-10% Triton X-100, and the preferred condition is to resuspend in 2% Triton X-100.
[0017] Wherein, in step (1), the centrifugal collection of the precipitate is carried out under the following centrifugal conditions: centrifugation at 10000g to 16000g for 10 to 30 min at 4 to 25°C; the preferred conditions are: 25°C, 15000g, 20 min.
[0018] Wherein, in step (1), the ultrasonic treatment is carried out under the following treatment conditions: 50-100 kHz, pulse period ultrasonic treatment for 10-20 min; the preferred treatment conditions are: 80 kHz, 5s on / 5s off pulse period ultrasonic treatment for 20 min.
[0019] Wherein, in step (1), the heat treatment is carried out under the conditions of: heating in a metal bath at 60-100°C for 100-200 min; the preferred conditions are: heating in a metal bath at 80°C for 180 min.
[0020] Wherein, in step (2), the tumor cells are solid tumor cells, including subcutaneous tumors, in situ tumors, and metastatic tumors.
[0021] Wherein, in step (2), the tumor cells include but are not limited to mouse-derived bladder cancer cell lines or mouse-derived non-small cell lung cancer cell lines. In the prior art, any tumor cells extracted from solid tumors are within the scope of protection of the present invention, and LNT cells can be obtained by liquid nitrogen cryopreservation.
[0022] In some embodiments of the present invention, the mouse-derived bladder cancer cell line includes any one of the MB49 cell line, the MB49-LUC-GFP cell line, and the MB49-OVA cell line; and the mouse-derived lung cancer cell line is the LLC cell line.
[0023] Wherein, in step (2), the freezing solution is a serum-free cell freezing solution purchased from Synsai, catalog number: C40100.
[0024] Wherein, in step (2), in the freezing solution containing tumor cells, the density of tumor cells is 5 to 10 M / mL.
[0025] Wherein, in step (2), the liquid nitrogen freezing treatment is performed 1 to 3 times, preferably 2 times. Specifically, the cryopreservation solution containing tumor cells is immersed in liquid nitrogen for 10 to 16 hours, taken out and placed on ice to dissolve for 60 to 180 minutes; preferably, the cryopreservation solution containing tumor cells is immersed in liquid nitrogen for 12 hours, taken out and placed on ice to dissolve for 90 to 120 minutes.
[0026] Wherein, in step (3), the mixing ratio of the number of LNT cells and the mass of BCG-CW cell wall is 1:5-30 ng, and the preferred mixing ratio is 1:15 ng.
[0027] The anti-tumor vaccine prepared by the anti-tumor vaccine preparation method is also within the scope of protection of the present invention.
[0028] The anti-tumor vaccine comprises BCG-CW and tumor cells LNT frozen in liquid nitrogen; the BCG-CW uses LNT cells as carriers and adheres to the surface of LNT cells.
[0029] The use of the anti-tumor vaccine in the preparation of a preparation for preventing and / or treating tumor diseases is also within the scope of protection of the present invention.
[0030] Wherein, the tumor diseases include but are not limited to bladder cancer and lung cancer.
[0031] Specifically, in some embodiments of the present invention, after verifying the immune activation effect of BCG-CW@LNT in vivo and in vitro, the efficacy was verified in bladder cancer models and lung cancer models. The BCG-CW@LNT vaccine prepared by the present invention showed good anti-tumor therapeutic effects in both bladder cancer and lung cancer models, and due to the presence of memory T cells, it has a long-term memory effect, which means that it can provide long-term anti-tumor treatment and prevention effects.
[0032] Tumor vaccines have important research value and application prospects in the field of tumor immunology. Traditionally, tumor vaccines are mainly regarded as a treatment method aimed at clearing established tumors by activating the body's immune system. However, studies in recent years have shown that tumor vaccines also show great potential in preventing tumor formation and recurrence. The core goal of preventive tumor vaccines is to activate the immune system in advance and induce specific immune responses against tumor antigens, thereby effectively intervening in the early stages of tumor occurrence or recurrence.
[0033] In some embodiments of the present invention, BCG-CW@LNT, as a new type of anti-tumor vaccine, combines the immune activation properties of BCG cell wall (BCG-CW) with the immune regulation function of LNT, showing a significant immune enhancement effect. Its research on preventing tumor formation not only provides new ideas for tumor immune prevention, but also lays an important foundation for exploring more efficient tumor vaccine design strategies.
[0034] Specifically, in some embodiments of the present invention, the acute toxicity and long-term toxicity of BCG-CW@LNT were comprehensively evaluated by detecting blood routine, blood biochemical indices, spleen pathological changes and pathological analysis of major tissues and organs of mice, proving that the BCG-CW@LNT prepared by the present invention has good safety.
[0035] Beneficial effects:
[0036] (1) The present invention prepares an anti-tumor vaccine BCG-CW@LNT by using cell walls extracted from BCG as an immune adjuvant and then mixing them with LNT cells obtained by rapid freezing and thawing of tumor cells in liquid nitrogen. The vaccine can utilize this "therapeutic dead cell" to induce a wide range of antigenic responses through whole cells, simulating the natural presentation of antigens in the tumor microenvironment, thereby enhancing anti-cancer immunity.
[0037] (2) In in vitro experiments, the BCG-CW@LNT prepared by the present invention can significantly activate bone marrow-derived dendritic cells (BMDC), and effectively enhance the immune function of bone marrow-derived dendritic cells (BMDC) by promoting their maturation and enhancing their antigen presentation ability. In particular, in terms of antigen processing, the antigens carried on the surface of BCG-CW@LNT-OVA (taking chicken ovalbumin OVA as an example) can be efficiently taken up and processed by dendritic cells, and then presented to T cells derived from the spleen of OT1 mice, activating the proliferation of specific T cells and significantly increasing the release of anti-tumor cytokines (such as TNF-α, IFN-γ, etc.). This mechanism not only enhances the anti-tumor ability of dendritic cells, but also effectively mobilizes T cell-mediated specific immune responses.
[0038] (3) In the in vivo experiment, BCG-CW@LNT after systemic administration can effectively accumulate in tumors and lymph nodes, give full play to its adjuvant function of BCG-CW, efficiently deliver LNT antigen to antigen-presenting cells in tumors and lymph nodes, and significantly enhance tumor-specific CD8 + In addition, the homing ability of LNT cells enables BCG-CW@LNT to accumulate in tumor tissues, thereby promoting the infiltration of M1 macrophages in the tumor microenvironment and further enhancing the immune killing effect of tumors.
[0039] (4) In bladder cancer and lung cancer models, the BCG-CW@LNT prepared by the present invention not only showed good anti-tumor therapeutic effects (significantly inhibited the growth of subcutaneous tumors and in situ tumors, and significantly prolonged the survival of mice), but also avoided the common side effects such as weight loss and cystitis during bladder instillation. In addition, after BCG-CW@LNT pre-immunotherapy, tumor growth was significantly inhibited, indicating that the vaccine can effectively induce anti-tumor memory immune response in vivo and provide long-term tumor immune protection. That is, due to the presence of memory T cells, it has a long-term memory effect, which can provide long-term anti-tumor and preventive effects, providing a new option for tumor treatment.
[0040] (5) The BCG-CW@LNT prepared by the present invention showed good safety and tolerability. The safety assessment results further confirmed that BCG-CW@LNT treatment not only did not cause acute inflammatory response, but also did not have adverse effects on the physiological and biochemical functions of mice after long-term (3 weeks) administration, nor did it cause significant damage to major tissues and organs.
[0041] (6) The BCG-CW@LNT prepared by the present invention is a new type of anti-tumor vaccine, which combines the immune activation properties of BCG cell wall (BCG-CW) with the immune regulation function of LNT, and exhibits a significant immune enhancement effect. Its research on the prevention of tumor formation not only provides new ideas for tumor immune prevention, but also lays an important foundation for exploring more efficient tumor vaccine design strategies.
[0042] (7) The innovativeness of the BCG-CW@LNT anti-tumor vaccine prepared by the present invention is also reflected in its potential for personalized treatment in the future. According to the tumor tissue characteristics of patients with different types of tumors, the corresponding LNT cells can be customized to combine with patient-specific antigens to further optimize the effect of the BCG-CW@LNT vaccine. This personalized strategy can provide precise treatment according to the patient's specific condition, which not only improves the targetedness and efficacy of the treatment, but also effectively reduces adverse reactions and side effects. With the continuous development of tumor immunotherapy, the BCG-CW@LNT anti-tumor vaccine provides broad application prospects for future clinical applications with its efficient immune activation, enhanced anti-tumor immune response, excellent safety and significant therapeutic effects. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.
[0044] Figure 1 SEM images of living MB49 cells and corresponding LNT cells (scale bar = 10 μm).
[0045] Figure 2 The figure shows the changes in LNT cell size and surface structure analyzed by flow cytometry.
[0046] Figure 3 The fluorescence staining images of living MB49 cells and corresponding LNT cells under a fluorescence microscope.
[0047] Figure 4 The graph shows the results of CCK8 cell proliferation assay of live MB49 cells and corresponding LNT cells.
[0048] Figure 5 The cell membrane structures of living MB49 cells and corresponding LNT cells under a fluorescence microscope.
[0049] Figure 6 These are images of tumor formation in mice after implantation of living MB49 cells and corresponding LNT cells.
[0050] Figure 7 The survival curves of mice after tumor implantation with live MB49 cells and corresponding LNT cells.
[0051] Figure 8 Coomassie blue staining of electrophoresis showing the total protein distribution of living MB49 cells and corresponding LNT cells.
[0052] Fig. 9 The figure shows the result of using Western Blot (WB) to detect the GFP expression level on the surface of living MB49-LUC-GFP cells and corresponding LNT cells.
[0053] Fig.10 The results of proteomic analysis of living MB49 cells and corresponding LNT cells. A is a volcano map of protein spectrum analysis; B is a heat map of protein spectrum; C is a GO analysis map of up-regulated proteins; and D is a GO analysis map of down-regulated proteins.
[0054] Fig.11 Fluorescence images of BCG-CW adhering to the cell surface.
[0055] Fig.12 Scanning electron microscopy high-resolution images of BCG-CW@LNT prepared with different ratios of LNT cells and BCG-CW (scale bar = 200 μm).
[0056] Fig.13 To detect the ratio of CD80+ / CD86+ / MHCⅡ+ in dendritic cells (BMDCs) when BCG-CW stimulates BMDCs in vitro. A is the ratio of CD80 and CD86 expressed on the surface of BMDCs after BCG, BCG-CW, LNT and BCG-CW@LNT treatment; B is the ratio of MHC-II molecules expressed in BMDCs.
[0057] Fig.14 ELISA was used to detect the cytokine levels in the co-incubation system of BCG-CW, BCG-CW@LNT and BMDC.
[0058] Fig.15 qRT-PCR was used to detect the cytokine levels in the co-incubation system of BCG-CW, BCG-CW@LNT and BMDC.
[0059] Fig.16 Activation of cytotoxic T cells. A is the activation effect of MB49-OVA cells, LNT-OVA cells and BCG-CW@LNT-OVA on OT1 mouse spleen T cells detected by flow cytometry; B is the result of flow cytometry statistical analysis; C is the level of specific T cells detected by flow cytometry; D is the result of flow cytometry statistical analysis; E is the detection of activated CD137 + Specific T cells; F is for detecting activated CD69 +Specific T cells. Note: ns no significant difference; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0060] Fig.17 The distribution of BCG-CW@LNT in various tissues in mice.
[0061] Fig.18 Cytotoxic CD8 + T cell activation level.
[0062] Fig.19 is the activation level of DC cells in the tumor.
[0063] Fig. 20 It is the level of M1 and M2 macrophages in tumor.
[0064] Fig.21 Cytotoxic CD8 + T cell activation level.
[0065] Fig. 22 It is the activation level of DC cells in the lymph nodes adjacent to the tumor.
[0066] Fig.23 Figure 1 is the efficacy of BCG-CW@LNT in the mouse bladder cancer subcutaneous tumor model. Figure A is the growth curve of tumor volume in each group of mice, Figure B is the tumor tissue image of each group of mice after treatment, Figure C is the statistical analysis of tumor volume between groups, and Figure D is the weight change curve of each group of mice.
[0067] Fig.24 The efficacy of BCG-CW@LNT in the mouse bladder cancer orthotopic tumor model. A is the growth of mouse orthotopic tumors tracked by animal live imaging (n=5); B is the growth trend of mouse orthotopic bladder tumors according to the fluorescence intensity value; C is the survival curve of each group of mice; D is the statistical graph of fluorescence intensity of each group; E is HE staining of bladder cancer tissues in each group.
[0068] Fig.25 The efficacy of BCG-CW@LNT in the mouse bladder cancer lung metastasis model. A is the in vivo fluorescence imaging and HE staining of lung tissue after treatment; B is the quantitative statistics of fluorescence intensity; C is the mouse survival curve. Note: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0069] Fig.26The efficacy of BCG-CW@LNT in the mouse lung cancer subcutaneous tumor model. A is the tumor diameter of the mouse subcutaneous tumor measured from Day 4 after tumor implantation, and the tumor volume is calculated to track the growth of the tumor in each group of mice; B is the volume statistical analysis of the subcutaneous tumor in each group of mice; C is the tumor tissue image of each group of mice after treatment; D is the comparison of the weight changes of mice in each treatment group. Note: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0070] Fig. 27 This is an experiment on preventing tumor formation with BCG-CW@LNT. A is a schematic diagram of the experimental process of mouse pre-immunization and tumor inoculation; B is the statistical result of the change of tumor volume over time in each group of mice; C is an image of tumor growth in mice in different immune treatment groups.
[0071] Fig.28 Safety evaluation of BCG-CW@LNT vaccine. A is the blood routine results 24 hours after a single injection and 21 days after long-term injection of BCG-CW@LNT, and the key blood cell indicators of mice (including white blood cells, red blood cells, neutrophils, peripheral blood mononuclear cells and platelets); B is the results of blood biochemical analysis, liver and kidney function indicators of each group of mice (including alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, total bilirubin, blood urea nitrogen and creatinine levels); C is the size and weight image of the spleen of each treatment group; D is the HE staining results of the main tissues and organs of mice (heart, liver, spleen, lung and kidney). DETAILED DESCRIPTION
[0072] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.
[0073] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.
[0074] In the following examples, the MB49, MB49-LUC-GFP, MB49-OVA, and LLC cell lines were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. All cell lines were verified by STR and tested for mycoplasma contamination regularly.
[0075] Example 1: Preparation of BCG-CW
[0076] Bacillus Calmette-Guérin (BCG) bacteria were inoculated into Middlebrook 7H9 medium (purchased from Coolable, catalog number MKC-301) for pre-culture and cultured at 37°C and 120rpm under shaking conditions until the logarithmic phase. The pre-cultured BCG bacterial solution was centrifuged at 5,000×g for 10 min to collect the bacterial precipitate. After washing with PBS and resuspending in 2% Triton X-100, it was heated and inactivated at 100°C in a pressure cooker for 20 min. Subsequently, a VCX 750 ultrasonic processor (Thermo Fisher Scientific, USA) was used for ultrasonic treatment at 80kHz, 5s on / 5s off pulse cycle for 20 min. The homogenate after ultrasonic treatment was heated in an 80°C metal bath for 3h, and then centrifuged at 15,000×g for 20min at 25°C to collect the insoluble components. To remove lipids and proteins, the precipitate was washed twice with 5 volumes of 2% (v / v) Triton X-100 and three times with 5 volumes of 2% (w / v) sodium dodecyl sulfate (SDS), and each wash was followed by centrifugation at 15,000×g for 20 min. The resulting BCG-CW precipitate was further washed twice with 5 volumes of 10% (v / v) isopropanol and three times with 5 volumes of acetone to ensure complete removal of SDS. Subsequently, the sample was repeatedly washed with 10% isopropanol until the optical density (OD) of the supernatant at 280 nm was less than 0.05, indicating that residual contaminants had been removed. Finally, the purified BCG-CW was resuspended in 100% isopropanol and stored at -20°C until use. The dry weight of BCG-CW was calculated by collecting the precipitate by centrifugation of the suspension at 15,000×g for 20 min and weighing it after drying it overnight at 50°C.
[0077] Example 2: Liquid nitrogen treatment of MB49 tumor cells to obtain corresponding LNT cells
[0078] MB49 cells (mouse bladder cancer cells) were collected, centrifuged at 850rpm for 3min, and resuspended in serum-free cell cryopreservation solution (purchased from Xinsaimei, serum-free cryopreservation solution, item number: C40100), with a cell density of 5-10M / mL. After the cryopreservation solution was soaked in liquid nitrogen for 12h, it was taken out and thawed on ice for 90-120min, and the liquid nitrogen-treated LNT cells were obtained after repeated freeze-thaw treatment 2-3 times. Before use, the cells were quickly thawed in a 37°C water bath, centrifuged at 850rpm for 3min, then washed with PBS solution, resuspended in PBS, and stored at 4°C for use.
[0079] 1. Characterization of LNT cell morphology
[0080] Scanning electron microscopy (SEM) was used to observe the living MB49 cells and LNT cells after liquid nitrogen freeze-thaw treatment ( Figure 1 The results showed that LNT cells were similar in size to living cells, but their cell surface was rougher. Further analysis using flow cytometry also confirmed the changes in LNT cell size and surface structure by forward scattered light area (FSC-A) and side scattered light area (SSC-A). Figure 2 ).
[0081] 2. Identification of LNT cell death status and membrane integrity
[0082] The Calcein AM / PI live-dead cell double staining kit (purchased from Bio-Tech, catalog number: C2015M) was used to identify the death status of live cells and LNT cells. Under a fluorescence microscope, all LNT cells were dead cells ( Figure 3 ). Further, the CCK8 cell proliferation experiment was used for verification. Specifically, the LNT cells were centrifuged (e.g., 1,000rpm, 5 minutes), the supernatant was discarded, and the cells were resuspended in complete culture medium. The cells were seeded in a 96-well plate at a density of 2×10^3 cells per well, with a volume of 100μL per well. According to the CCK-8 reagent manual, the CCK-8 stock solution was mixed with the complete culture medium in a ratio of 1:9 (e.g., 10μL CCK-8 stock solution + 90μL culture medium) to prepare the CCK-8 working solution. Add 100μL CCK-8 working solution to each well and shake gently to mix. Return the 96-well plate to 37°C, 5% CO 2 Incubate in a cell culture incubator away from light for 2 hours (the specific time depends on the cell type and growth status). After the incubation, remove the 96-well plate and gently shake the liquid in the wells to mix. Use an ELISA reader to measure the absorbance value (OD) of each well at a wavelength of 450nm. 450 The results confirmed that LNT cells were dead cells and had no proliferation ability ( Figure 4 In addition, the DAPI staining kit (purchased from Bio-Tech, catalog number C1002) was used to localize the cell nucleus, and the Dil membrane dye was used to stain the living cells and LNT cells. The results showed that LNT cells, like living cells, maintained the integrity of the cell membrane structure ( Figure 5 ).
[0083] 3. Subcutaneous tumor implantation experiment
[0084] Live MB49 cells and LNT cells were implanted into the subcutaneous area on the right back of C57 mice at a concentration of 1×10^6 / 100μL and 100μL / mouse for subcutaneous tumor implantation experiments to observe their tumor-forming abilities and their effects on the survival of mice.
[0085] The results showed that over time, living MB49 cells formed distinct subcutaneous tumors in mice, while LNT cells did not show any tumorigenicity. Figure 6 In addition, the survival curve showed that all mice implanted with live MB49 cells died soon after implantation, while all mice treated with LNT cells survived ( Figure 7 ). These results showed that LNT cells treated with liquid nitrogen freeze-thaw not only lost their proliferation ability, but also completely lost their pathogenicity, further confirming its safety.
[0086] 4. Explore whether tumor cells will lose key proteins after being frozen and thawed by liquid nitrogen
[0087] A complete antigen spectrum can more comprehensively activate the immune system and induce a polyclonal immune response against tumors. Therefore, the integrity of the antigen components is crucial to the immunogenicity of tumor vaccines. In order to verify whether the tumor cells undergo liquid nitrogen freeze-thaw treatment will lead to the loss of key proteins, thereby ensuring the integrity of the antigen components when used as tumor vaccines, the following experiments were conducted.
[0088] (1) Study on the total protein distribution of living MB49 cells and LNT cells
[0089] According to the protein Coomassie brilliant blue staining method, 10% polyacrylamide gel was used for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to separate proteins. Take 100mL of 10× electrophoresis buffer, add 900mL of ultrapure water, dilute to 1× electrophoresis buffer, mix well for use. Take out the gel plate, pull out the comb vertically, use a 1mL syringe to absorb the electrophoresis buffer, rinse the comb hole, and remove the residual unpolymerized gel. Install the gel plate into the electrophoresis tank, add 1× electrophoresis buffer, set the initial voltage to 80V, and electrophoresed for about 30 minutes. The protein samples loaded were all 20μg. After the sample entered the separation gel, the voltage was adjusted to 120V and the electrophoresis was continued for 60 minutes until the bromophenol blue indicator was close to the bottom of the gel plate. After electrophoresis, the gel was stained with the Coomassie brilliant blue staining kit (Biyuntian, P0017A). The gel was immersed in the staining solution and stained for 4 hours with gentle shaking at room temperature. Subsequently, the gel was transferred to the destaining solution and incubated for about 6 hours, with the destaining solution changed every 2 hours to ensure clear background removal. Comparative analysis of total protein distribution in living MB49 cells and LNT cells.
[0090] The results showed that the overall protein distribution of LNT cells and living MB49 cells was basically the same, with only a few proteins showing slight changes in content, indicating that liquid nitrogen freeze-thaw treatment did not significantly damage the protein composition of the cells ( Figure 8 ). This result confirmed that LNT cells maintained a high degree of integrity at the protein level, providing an important experimental basis for their use as a tumor vaccine.
[0091] (2) WB verification of the expression level of recombinant green fluorescent protein (GFP)
[0092] Taking MB49 cells (MB49-LUC-GFP cells) expressing green fluorescent protein (GFP) as an example, the expression level of GFP on the surface of LNT cells and living cells was detected by Western Blot (WB). In short, the following steps were included: protein denaturation (heating samples and loading buffer), preparation and casting of separation gel and stacking gel (mixing gel, adding APS, and standing to solidify), loading (adding denatured samples and markers), electrophoresis (80V start, 120V continued until bromophenol blue approached the bottom), transfer (assembling transfer clips, constant current 300mA transfer for 60-70 minutes), blocking (5% skim milk powder blocking for 2 hours), incubation with primary antibody (4°C overnight), TBST washing, incubation with secondary antibody (room temperature for 1 hour), TBST washing, and finally development (using ECL reagent chemiluminescence imaging).
[0093] The results showed that after liquid nitrogen freeze-thaw treatment, the GFP level on the cell membrane did not decrease significantly, and even increased slightly ( Fig. 9 ). This finding further supports that liquid nitrogen treatment can effectively retain key antigen components on the cell membrane, thereby ensuring the immunogenicity and functionality of tumor vaccines.
[0094] (3) Proteomic analysis of living MB49 cells and LNT cells
[0095] In order to fully elucidate the protein expression differences between liquid nitrogen treated cells (LNT) and untreated cells, proteomic analysis was performed on live MB49 cells and LNT cells, and three independent samples were prepared for each cell line to ensure the reliability and reproducibility of the experimental results. The above proteomic analysis was completed by Shanghai Biopharm Biotech Co., Ltd.
[0096] The results showed that among the 7,157 proteins detected, only 175 proteins were upregulated and 94 proteins were downregulated. In addition, the upregulated proteins were mainly membrane proteins and mitochondrial membrane proteins, while the downregulated proteins were mainly ribosomes and ribonucleoprotein components ( Fig.10 ). This result indicates that liquid nitrogen freezing treatment can retain and even increase the number of cell surface proteins to the greatest extent, especially membrane proteins associated with tumor-specific antigens.
[0097] In summary, LNT cells can maintain the integrity of the cell membrane structure after liquid nitrogen freeze-thaw treatment, without causing the loss of key proteins and surface antigens, and completely lose pathogenicity and proliferation ability. These characteristics make LNT cells a safe and highly immunogenic tumor vaccine candidate material.
[0098] Example 3: Preparation of BCG-CW@LNT vaccine against bladder cancer
[0099] 1. Prepare BCG-CW@LNT vaccine and verify the adhesion effect of BCG-CW to LNT cells
[0100] The live MB49 cells and corresponding LNT cells of Example 2 were marked with DAPI staining, and the BCG-CW prepared in Example 1 was marked with CY3 dye. 1×10^5 LNT cells were mixed with 1.5×10^6ng BCG cell wall BCG-CW (the ratio of LNT cell number to BCG-CW mass was 1:15, unit: cells / ng), and incubated at room temperature and 100rpm for 30min to prepare the anti-bladder cancer BCG-CW@LNT vaccine. Under a fluorescence microscope, it can be clearly seen that BCG-CW successfully adhered to the surface of LNT cells and live MB49 cells ( Fig.11 ).
[0101] 2. High-resolution imaging analysis of BCG-CW on the surface of LNT cells
[0102] To further visualize the uniform distribution of BCG-CW on the surface of LNT cells, scanning electron microscopy (SEM) was used to perform high-resolution imaging analysis of BCG-CW@LNT vaccines prepared by mixing LNT cells with BCG-CW in different proportions. Specifically, the BCG-CW component was first ultrasonically treated at 80kHz for 20 minutes to ensure that it was fully dispersed. The two were then mixed according to different ratios of LNT cell number to BCG-CW mass (1:5, 1:10, 1:15, 1:30), and mixed on a shaker at room temperature for 30 minutes to ensure that BCG-CW was evenly distributed and firmly adhered to the surface of LNT cells.
[0103] SEM observation results showed that BCG-CW formed a uniform covering layer on the surface of LNT cells, and the adhesion effect increased with the increase of the proportion ( Fig.12 ).
[0104] Example 4: Verification of whether the BCG-CW@LNT vaccine against bladder cancer can have immune activation ability
[0105] 1. In vitro validation
[0106] (1) Activation of BMDC by BCG-CW@LNT
[0107] Bone marrow-derived dendritic cells (BMDCs) were isolated from 4-6 week old C57BL / 6 mice and differentiated in vitro using 20 ng / mL GM-CSF and 5 ng / mL IL-4. Immature BMDCs were co-cultured with BCG, BCG-CW, LNT, or BCG-CW@LNT for 24 h at 37°C and 5% CO2. After co-culture, cells were harvested, stained with fluorescent dye-labeled antibodies against CD80, CD86, and MHC-II, and analyzed by flow cytometry (BD Biosciences, USA).
[0108] Fig.13 The in vitro detection of BCG-CW stimulating effect on dendritic cells (BMDC) was demonstrated. Flow cytometry analysis showed that BCG-CW and BCG-CW@LNT, like complete BCG, can effectively improve the antigen presentation ability of dendritic cells, as manifested by the upregulation of the expression of CD80 and CD86 co-stimulatory molecules ( Fig.13 In addition, the expression of MHC-II molecules on the surface of professional dendritic cells was upregulated. The upregulation of MHC-II molecules indicated that BCG-CW could enhance the ability of BMDC to capture and present exogenous antigens, thereby more effectively activating T cell-mediated immune responses ( Fig.13 These results indicate that BCG-CW can effectively promote the maturation of BMDCs, thereby enhancing their antigen presentation ability.
[0109] The levels of IL6, IL-12 and TNF-α in the co-incubation system of BCG-CW and BCG-CW@LNT and BMDCs were detected by ELISA kit, and it was found that the levels of IL6, IL-12 and TNF-α were significantly increased ( Fig.14 ). qRT-PCR was used to detect the expression of IL6, IL-12 and TNF-α in the co-incubation system of BCG-CW and BCG-CW-encapsulated BCG-CW@LNT and BMDCs, and it was found that the expression of IL6, IL-12 and TNF-α was upregulated, indicating a significant pro-inflammatory immune environment ( Fig.15 ).
[0110] The primer sequences used for qRT-PCR detection are shown in Table 1 below.
[0111] Table 1 Primer sequences used for qRT-PCR detection
[0112] Gene name Forward Primer Reverse primer IL6 CCTATGCCTCCCTGTGCT TGGTCGCCCTCGTAGTAGA IL12 CCAAAGGGATGACATAGTGAA GGTGAGGAAATGGCAGAGTT TNF-α TCTGAGTGGGACTGGCTGTTGG AGAGACCTCCCTTGTTGAGAAG IFN-γ TGCAGGTCATTCAGATGT AGC TGGCTCTTTCCTGTTTTA GCTG Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
[0113] (2) Activation of cytotoxic T cells by BCG-CW@LNT-OVA
[0114] Dendritic cells (DCs) serve as key antigen presenting cells (APCs) and present processed antigen peptides to the cell surface through MHC-I / antigen peptide complexes. This process is the activation of CD8 + In order to explore whether BCG-CW can further enhance the specific T cell killing effect against tumor antigens, the MB49-OVA cell model expressing the antigen ovalbumin (OVA) was used to study the effect of BCG-CW@LNT on DC maturation, antigen presentation ability and T cell activation in vitro. The specific process is as follows:
[0115] First, BMDC cells were co-incubated with MB49-OVA cells, LNT-OVA cells (MB49-OVA cells frozen by liquid nitrogen), and BCG-CW@LNT-OVA (MB49-OVA cells encapsulated by BCG-CW) for 24 h, and then the stimulated BMDC cells were co-incubated with OT1 mouse spleen T cells at a cell number ratio of 1:10 for 12 h. Subsequently, cytotoxic T cells (CD8 + T cells) activation and antigen-specific responses. The analysis included total CD8 + T cells (CD3 + CD8 + ), antigen-specific CD8 + T cells (Tetramer + CD8 + ) and the activation status of T cells was assessed based on the expression of CD137 and CD69, which represent the early and sustained activation of T cells, respectively.
[0116] Flow cytometry analysis results showed that ( Fig.16 In Figure A), MB49-OVA cells and liquid nitrogen-frozen MB49-OVA cells (LNT-OVA) significantly activated spleen-derived T cells and promoted CD8 + T cell proliferation. Fig.16 The results of flow cytometry analysis in Figure B show that the BCG-CW@LNT-OVA treatment group has a significant effect on CD8 + The activation efficiency of T cells was the highest, which indicated that BCG-CW modification significantly promoted the maturation and antigen presentation ability of BMDCs and enhanced the activation and proliferation of T cells.
[0117] The results of flow cytometry detection of specific T cells showed that the antigen-specific T cells (CD3 + CD8 + The proportion of SIINFEKL tetramer-positive cells in T cells was significantly higher than that in other groups ( Fig.16 C and D in the figure indicate that BCG-CW@LNT-OVA effectively promotes the induction and expansion of antigen-specific T cells by enhancing the presentation efficiency of DC cells to LNT cell surface antigens. Fig.16 E) and CD69 ( Fig.16 F) The expression levels of these two T cell activation markers increased significantly, further confirming the activation state of specific T cells. In addition, the expression levels of TNF-α and IFN-γ in the BCG-CW@LNT-OVA treatment group were also significantly upregulated, suggesting that it may exert anti-tumor immune effects by enhancing the function of cytotoxic T cells, providing an important theoretical basis for subsequent anti-tumor treatment.
[0118] 2. In vivo validation
[0119] (1) Dynamic distribution of BCG-CW@LNT in vivo
[0120] To investigate the dynamic distribution of BCG-CW@LNT in vivo, BCG-CW@LNT was labeled with Cyanine 3 (Cy3) and injected into tumor-bearing C57BL / 6 mice (5×10^5 MB49 cells subcutaneously) at 100 μL per mouse via the tail vein. At predetermined time points (1, 3, 5, and 7 days after injection), the mice were euthanized, and the main organs, tumors, and tumor-draining lymph nodes were harvested. The biodistribution of BCG-CW@LNT in major organs (heart, liver, spleen, lungs, and kidneys) and tumor-related tissues (tumors and tumor-draining lymph nodes) was monitored using a small animal in vivo imaging system (Bruker, Germany). At the same time, the fluorescence intensity of each tissue was measured in vitro using the same imaging system, and the data were quantitatively analyzed to evaluate the distribution and retention of BCG-CW@LNT in different tissues.
[0121] The results are as follows Fig.17 As shown in the figure, BCG-CW@LNT first accumulated in the lungs, liver, and spleen, then gradually transferred to the liver and was metabolized and cleared, while BCG-CW@LNT in the spleen was cleared more slowly. On the 5th day after injection, accumulation of BCG-CW@LNT was observed in the tumor and tumor-draining lymph nodes.
[0122] (2) Evaluation of BCG-CW@LNT immunogenicity in vivo
[0123] To evaluate the in vivo immunogenicity of BCG-CW@LNT, C57BL / 6 mice were subcutaneously inoculated with 5×10^5 MB49 cells. 3 Afterwards, PBS, BCG-CW, LNT, or BCG-CW@LNT were injected via the tail vein. On day 7 after injection, tumors and para-tumoral lymph nodes were harvested and single-cell suspensions were prepared for flow cytometry analysis.
[0124] The results showed that CD8 + The number of T cells increased significantly, and cytotoxic T cells with proliferation and killing abilities (characterized by ki67 and granzyme B levels) were upregulated the most in the BCG-CW@LNT group ( Fig.18 ). In addition, the BCG-CW alone-treated group also showed significant T cell activation, again demonstrating its ability to activate immune responses in vivo.
[0125] In order to explore the mechanism of T cell activation, the distribution of DCs and macrophages in tumors was detected. The results of flow cytometry staining for DC maturation markers (CD80, CD86) showed that mature DCs were significantly enriched in the tumors of mice in the BCG-CW alone treatment group and the BCG-CW@LNT treatment group, among which the increase in the proportion of mature DCs in the BCG-CW@LNT group was higher ( Fig.19 ). At the same time, the number of macrophages in the tumor also increased significantly, especially M1 macrophages, while the proportion of M2 macrophages decreased significantly ( Fig. 20 ). This indicates that after injection of BCG-CW@LNT, the tumor microenvironment was reshaped, which not only mediated T cell activation through the maturation of DCs, but also indirectly activated the pro-inflammatory immune response of macrophages in the tumor, further enhancing the anti-tumor effect.
[0126] Furthermore, by isolating the adjacent tumor-draining lymph nodes of mice, it was found that the cytotoxic CD8 + The number of T cells increased, especially in the BCG-CW alone treatment group and the BCG-CW@LNT treatment group. The T cells in the lymph nodes were obviously activated, as shown by the significant upregulation of the expression of CD69 and CD25 markers ( Fig.21 ). Mature DCs were significantly enriched in the tumors of mice in the BCG-CW alone treatment group and the BCG-CW@LNT treatment group in the adjacent lymph nodes of the tumor, and the increase in the proportion of mature DCs in the BCG-CW@LNT group was higher ( Fig. 22 ).
[0127] Example 5: Efficacy of BCG-CW@LNT vaccine as a therapeutic anti-tumor vaccine in bladder cancer
[0128] 1. Efficacy of BCG-CW@LNT vaccine in subcutaneous mouse bladder cancer model
[0129] The MB49 cell line was used to construct a subcutaneous mouse bladder cancer model. 5×10^5 MB49 cells were resuspended in 100μL PBS and injected into the subcutaneous area on the right back of the mouse. After the tumor was evenly formed, the mice were randomly divided into groups. PBS was used as the negative control group, BCG-CW was used as the treatment group, LNT was used as the treatment group, and BCG-CW@LNT was used as the treatment group. Cisplatin, a commonly used chemotherapy drug in clinical practice, was used as the positive control group. From the beginning of tumor formation, the drug was administered twice a week, with each dose of 100μL / mouse, for 2 weeks. PBS, BCG-CW, LNT, BCG-CW@LNT, and cisplatin were injected through the tail vein for treatment. At the same time, the tumor diameter and weight changes of the mice were recorded every 2 days, and the tumor volume was calculated based on the tumor diameter (calculation formula: V = length × width 2 ×0.52). The mice were killed 3 days after the last administration, and the overall tumor treatment effect was evaluated.
[0130] The tumor volume growth curve calculated based on the mouse tumor diameter shows ( Fig.23 A in the figure shows that there was no significant difference in tumor size between the mice in the LNT treatment group alone and the control group (PBS), indicating that LNT, which only provides tumor antigens, cannot exert a significant anti-tumor effect. The BCG-CW treatment group showed a moderate inhibitory effect on tumor growth, which may be due to the systemic immune activation caused by BCG-CW. In contrast, both the BCG-CW@LNT treatment group and the positive control drug cisplatin group significantly inhibited tumor growth, among which the tumor growth in the BCG-CW@LNT group was the slowest ( Fig.23 It is worth noting that due to the toxic side effects of cisplatin, the body weight of mice in this treatment group decreased significantly ( Fig.23 D).
[0131] 2. Efficacy of BCG-CW@LNT vaccine in mouse orthotopic bladder tumor model
[0132] In order to better simulate the onset and progression of bladder cancer, a mouse orthotopic bladder tumor model was further constructed to systematically evaluate the anti-tumor efficacy of BCG-CW@LNT. The specific experimental design is as follows: 5×10^5 MB49-LUC-GFP bladder cancer cells with fluorescent labels were resuspended in 100μL PBS by in situ bladder perfusion and then injected into the mouse bladder to establish an orthotopic tumor. Tumor growth and progression were regularly and non-invasively monitored using a small animal in vivo fluorescence imaging system (IVIS Spectrum, PerkinElmer, USA). After the tumor was uniformly formed. After confirming the successful colonization of the orthotopic tumor on the 7th day, the mice were randomly divided into five groups and treated with PBS (negative control), BCG-CW, LNT and BCG-CW@LNT via tail vein injection, and the bladder perfusion BCG treatment group was set as a positive control. During the treatment, tumor growth was regularly monitored by in vivo imaging technology, and the weight changes and survival of the mice were recorded.
[0133] like Fig.24 As shown in Figure A, the intravesical BCG group showed significant anti-tumor effects, which is consistent with the clinical efficacy of BCG intravesical treatment of non-muscle invasive bladder cancer (NMIBC). It is worth noting that the BCG-CW@LNT treatment group also showed excellent anti-tumor effects in the orthotopic bladder cancer model, with a tumor growth inhibition rate comparable to that of the BCG intravesical group, and even superior to that of the BCG intravesical group in some indicators (such as weight change and survival). Fig.24 B in the figure shows the growth trend of mouse orthotopic bladder tumors plotted based on fluorescence intensity values. Fig.24 C in the figure is the survival curve of mice in each group. Fig.24 D in the figure is a statistical graph of fluorescence intensity in each group. After treatment, bladder tissues of mice in each group were taken for pathological analysis. HE staining results showed that ( Fig.24E), the bladder tissue of mice in the PBS control group showed typical tumor pathological characteristics, including massive infiltration of tumor cells, disordered tissue structure, significant nuclear atypia (increased nuclear-cytoplasmic ratio, nuclear hyperchromasia), and pathological mitotic figures. In addition, the hierarchical structure of the bladder wall was destroyed, the boundary between the mucosal layer and the muscular layer was unclear, and necrotic areas were visible locally. The tumor inhibition effect of the BCG-CW monotherapy group was weaker, and a moderate amount of tumor cell infiltration was still visible in the bladder tissue, the tissue structure was disordered in the local area, and the degree of inflammatory cell infiltration was between the BCG-CW@LNT group and the BCG infusion group. The tumor inhibition effect of the LNT monotherapy group was the weakest, with more tumor cell infiltration in the bladder tissue, and obvious nuclear atypia and pathological mitotic figures in the local area. In the BCG infusion group, although the tumor cell infiltration was significantly reduced compared with the PBS control group, more inflammatory cell infiltration (mainly neutrophils and macrophages) and local fibrosis appeared in the bladder tissue, suggesting that BCG infusion may induce a strong local inflammatory response and tissue damage. In addition, mucosal epithelial desquamation and edema were observed in some areas. In contrast, the bladder tissue pathology in the BCG-CW@LNT treatment group improved most significantly. Tumor cell infiltration was significantly reduced, the hierarchical structure of the bladder wall basically returned to normal, the mucosal epithelial cells were arranged neatly, and only a small number of inflammatory cells (mainly lymphocytes and monocytes) infiltrated. No obvious fibrosis or necrosis areas were observed, suggesting that BCG-CW@LNT caused less damage to normal tissues while inhibiting tumor growth. HE staining results further confirmed the significant anti-tumor effect of BCG-CW@LNT in the in situ bladder cancer model. Compared with BCG infusion, BCG-CW@LNT can not only effectively inhibit tumor growth, but also reduce tissue damage and inflammatory response, showing better treatment safety and tissue protection.
[0134] 3. Efficacy of BCG-CW@LNT vaccine in mouse bladder cancer lung metastasis model
[0135] Lung metastasis of bladder cancer is one of its most invasive features. Once lung metastasis occurs, the patient's prognosis deteriorates significantly and the survival rate decreases significantly. Lung metastasis is one of the important causes of death in bladder cancer patients. Therefore, studying effective treatment strategies to control the occurrence and progression of lung metastasis is crucial to improving the prognosis of bladder cancer patients.
[0136] In order to more comprehensively evaluate the anti-tumor therapeutic effect of BCG-CW@LNT, 1×10^5 MB49 cells were injected into the tail vein to establish a mouse bladder cancer lung metastasis model. The small animal in vivo fluorescence imaging system was used to detect the uniform tumor formation, and the mice were randomly divided into groups. LNT, BCG-CW, and BCG-CW@LNT were treated with the tail vein, and PBS was injected into the tail vein as a negative control, and the cisplatin treatment group was injected into the tail vein as a positive control. The treatment was twice a week for two weeks.
[0137] The therapeutic effect was evaluated by in vivo fluorescence imaging and pathological analysis of lung tissues. In vivo fluorescence imaging showed that BCG-CW@LNT treatment significantly reduced tumor-related fluorescence signals compared with other groups. Pathological analysis of lung tissues by HE staining further confirmed the reduction in tumor burden in the BCG-CW@LNT group, with fewer and smaller metastatic nodules observed compared with the PBS, LNT, and BCG-CW groups ( Fig.25 A in Figure 1). Quantitative analysis of fluorescence intensity (in p / sec / cm 2 The results showed that BCG-CW@LNT treatment resulted in a significant decrease in tumor-related fluorescence signals compared with the PBS (p<0.001), LNT (p<0.01), and BCG-CW (p<0.05) groups ( Fig.25 B in the figure). The fluorescence intensity of the BCG-CW@LNT group was lower than that of the cisplatin group, indicating that it has a good anti-tumor effect. Survival analysis showed that the median survival time of mice treated with BCG-CW@LNT was the longest, significantly longer than that of mice treated with PBS, LNT, and BCG-CW ( Fig.25 C). This indicates that BCG-CW@LNT can effectively prolong the survival of mice with bladder cancer lung metastasis.
[0138] Example 6: Efficacy of BCG-CW@LNT as a therapeutic anti-tumor vaccine in lung cancer
[0139] Lewis lung cancer cell line (LLC) was used to construct a mouse subcutaneous tumor model. 5×10^5 LLC cells were resuspended in 100μL PBS and injected into the subcutaneous area on the right back of the mouse. After uniform tumor formation, the mice were randomly divided into four groups: PBS group (negative control), cisplatin group (positive control), LNT alone treatment group, BCG-CW alone treatment group and BCG-CW@LNT group. The corresponding drug was injected through the tail vein twice a week, with an injection dose of 100μL / mouse, and the treatment lasted for 4 weeks. The tumor volume was measured every 2 days during the treatment (calculation formula: V=length×width2×0.52). Note: In this example, the LNT is LLC cells frozen by liquid nitrogen, and the BCG-CW@LNT is LLC cells wrapped in BCG-CW and frozen by liquid nitrogen. The treatment process refers to bladder cancer MB49 cells.
[0140] Tumor volume growth curve shows ( Fig.26In Figure A), the tumors in the PBS group grew rapidly, while the LNT-only treatment group had limited inhibitory effect on tumor growth, indicating that LNT alone, which relies solely on tumor antigens, cannot significantly inhibit lung cancer progression. In contrast, the BCG-CW@LNT treatment group showed a significant tumor growth inhibition effect, which was comparable to the cisplatin group and even superior to the cisplatin group at certain time points ( Fig.26 In addition, the weight of mice in the BCG-CW@LNT treatment group changed steadily without obvious toxicity, while the weight of mice in the cisplatin group decreased significantly, suggesting that it may have certain systemic toxicity ( Fig.26 D).
[0141] In summary, in three bladder cancer models, BCG-CW@LNT showed significant therapeutic effects, significantly inhibited tumor growth and prolonged the survival of mice. Based on its excellent performance in bladder cancer models, we further explored whether BCG-CW@LNT has the potential for pan-cancer treatment. In the subcutaneous lung cancer tumor model, BCG-CW@LNT also showed significant anti-tumor effects, indicating that its immune activation mechanism may be broad-spectrum and applicable to a variety of tumor types, indicating that BCG-CW@LNT vaccine can be used as a new anti-tumor therapeutic vaccine.
[0142] Example 7: Tumor prevention effect and safety evaluation of BCG-CW@LNT
[0143] 1. Evaluation of tumor prevention effect
[0144] Mice were immunized by intravenous injection of PBS, LNT, BCG-CW, and BCG-CW@LNT once a week two weeks before tumor inoculation (days -14 and -7). On day 0, mice were subcutaneously injected with 5×10^5 tumor cells MB49 to establish the tumor model ( Fig. 27 A in Figure 1). Tumor growth was subsequently monitored and tumor volume was measured regularly. Control groups included mice treated with PBS alone, LNT alone, or BCG-CW alone.
[0145] The results showed that mice pre-immunized with BCG-CW@LNT were largely resistant to tumor formation, and no detectable tumor growth was observed during the entire experimental period ( Fig. 27 In contrast, the groups treated with PBS and LNT alone showed rapid tumor growth, indicating that pre-immunization with BCG-CW@LNT effectively prevented tumor establishment.
[0146] 2. Safety evaluation
[0147] Safety is an important indicator for evaluating whether a new anti-tumor vaccine can enter clinical transformation. Therefore, the acute and long-term toxicity of BCG-CW@LNT were comprehensively evaluated by testing the blood routine, blood biochemical indexes, spleen pathological changes and pathological analysis of major tissues and organs of mice.
[0148] In the acute toxicity experiment, mice were injected intravenously with BCG-CW@LNT once, and blood samples were collected 24 hours later for routine blood tests and blood biochemistry analysis. In the long-term toxicity experiment, mice were injected intravenously with BCG-CW@LNT twice a week for 4 consecutive injections, and blood samples were collected on Day 21 for testing.
[0149] The blood routine test results showed that no significant abnormalities were found in the key blood cell indicators of mice (including white blood cells, red blood cells, neutrophils, peripheral blood mononuclear cells and platelets) regardless of single injection or long-term injection of BCG-CW@LNT. Fig.28 The results of blood biochemical analysis showed that the liver and kidney function indicators (including alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, total bilirubin, BUN and CREA) of mice in the BCG-CW@LNT treatment group were not significantly different from those in the PBS group ( Fig.28 B in the figure indicates that the vaccine has no significant effect on liver and kidney function. The spleen is an important organ of the immune system, and changes in its size can reflect the degree of systemic inflammatory response. The experimental results showed that there was no significant difference in the spleen size of mice in the BCG-CW@LNT treatment group compared with the PBS group ( Fig.28 HE staining results showed that no obvious pathological changes were observed in the main tissues and organs (heart, liver, spleen, lung and kidney) of mice in the BCG-CW@LNT treatment group ( Fig.28 The above results show that the BCG-CW@LNT prepared by the present invention shows good safety.
[0150] The present invention provides an anti-tumor vaccine and its preparation method and application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.
Claims
1. A method for preparing an anti-tumor vaccine, characterized in that: The steps include: (1) The BCG bacteria are centrifuged to collect the precipitate, washed, resuspended, and heat-inactivated, and then subjected to ultrasonic treatment to obtain a homogenate, and the homogenate is heat-treated and then centrifuged to collect the precipitate, and the obtained precipitate is defatted and deproteinized to prepare BCG cell wall BCG-CW; (2) collecting tumor cells by centrifugation and resuspending them in a cryopreservation solution, and freezing the cryopreservation solution containing tumor cells with liquid nitrogen to obtain LNT cells; (3) The BCG cell wall BCG-CW obtained in step (1) and the LNT cells obtained in step (2) are oscillated and mixed to prepare the anti-tumor vaccine BCG-CW@LNT.
2. The preparation method according to claim 1, characterized in that: In step (1), the BCG bacteria are BCG bacteria in the logarithmic growth phase obtained through pre-culture; the heat inactivation is carried out under the conditions of: heating inactivation at 100-125° C. for 10-20 min.
3. The preparation method according to claim 1, characterized in that: In step (1), the ultrasonic treatment is carried out under the following conditions: 50-100 kHz for 10-20 min; the heat treatment is carried out under the following conditions: heating in a metal bath at 60-100° C. for 100-200 min.
4. The preparation method according to claim 1, characterized in that: In step (2), the tumor cells are solid tumor cells, including mouse-derived bladder cancer cell lines or mouse-derived non-small cell lung cancer cell lines; wherein the mouse-derived bladder cancer cell lines include any one of the MB49 cell lines, the MB49-LUC-GFP cell lines, and the MB49-OVA cell lines, and the mouse-derived lung cancer cell line is the LLC cell line.
5. The preparation method according to claim 1, characterized in that: In step (2), in the freezing solution containing tumor cells, the density of the tumor cells is 5 to 10 M / mL.
6. The preparation method according to claim 1, characterized in that: In step (2), the liquid nitrogen freezing treatment is performed 1 to 3 times, specifically, the freezing solution containing tumor cells is immersed in liquid nitrogen for 10 to 16 hours and then thawed on ice for 60 to 180 minutes.
7. The preparation method according to claim 1, characterized in that: In step (3), the mixing ratio of the number of LNT cells and the mass of BCG cell wall BCG-CW is 1:5-30ng.
8. The anti-tumor vaccine prepared by the preparation method according to any one of claims 1 to 7, characterized in that: The anti-tumor vaccine comprises BCG-CW cell wall and LNT cells treated with liquid nitrogen freezing; The BCG cell wall BCG-CW uses LNT cells as carriers and adheres to the surface of LNT cells.
9. Use of the anti-tumor vaccine according to claim 8 in the preparation of a preparation for preventing and / or treating tumor diseases, characterized in that: The tumor diseases include bladder cancer and lung cancer.
Citation Information
Patent Citations
Novel high-immunogenicity tumor whole-cell vaccine as well as preparation and application thereof
CN116672441A