Kluffa yeast and application of Kluffa yeast in preparation of red camellia fermentation liquor with anti-aging and repairing functions

Abstract

The invention discloses Kluffa yeast and application of the Kluffa yeast in preparation of red camellia fermentation liquor with anti-aging and repairing functions, the Kluffa yeast is used for repairing PR-LQX002, the Latin name of the Kluffa yeast is Lachancea kluyveri, and the preservation number of the Kluffa yeast is CCTCC NO: M 20241723. The invention also provides a red camellia fermentation broth, a composition containing the fermentation broth and application of the red camellia fermentation broth in preparation of products with anti-oxidation, anti-saccharification, anti-wrinkle or repair effects. The fermentation broth is prepared from the following raw materials: red camellia flowers, red camellia leaves and Kluffa yeast PR-LQX002. The Kluffa yeast can greatly promote fermentation of flowers and leaves of the red camellia, and the obtained red camellia fermentation liquor not only contains active substances such as flavone, polyphenol and free amino acid, but also contains lipid substances such as ceramide, and has multiple effects such as saccharification resistance, repair, wrinkle resistance and oxidation resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of plant fermentation, and in particular relates to a Kluyveromyces saccharomyces and an application thereof in preparing a red camellia fermentation liquid with anti-aging and repairing effects. Background Art

[0002] Camellia L. is the largest genus in the Theaceae family, containing 20 groups and a total of 280 species, of which 238 are found in my country. One of the groups is the Red Camellia Group (Sect. Camellia), which has 57 species worldwide, 55 of which are found in my country, and the remaining two are in Japan. The plants of the Red Camellia Group not only have important economic, medicinal and ornamental values, but also have certain application value in the cosmetics industry. Red Camellia flower and leaf extracts have excellent antioxidant capacity. Studies have shown that Red Camellia flower extracts can protect the skin aging mechanism activated by urban air pollutants. In addition, the antioxidants in Red Camellia leaves also have anti-photoaging effects.

[0003] Saccharomyces kluyveri, also known as Lachancea kluyveri, is a species distantly related to Saccharomyces cerevisiae based on its ecological, physiological and genetic characteristics, and is the only species in the genus Saccharomyces that possesses ceramide.

[0004] Patent application CN116785361A discloses a camellia fermentation product and its preparation method and application. Camellia, water and yeast of a specific strain are used to form an initial system. After fermentation, sterilization and solid-liquid separation, the obtained cell-free supernatant is the camellia fermentation product, which has anti-sebum and wrinkle-reducing effects and can be used as an effective ingredient to prepare various skin external compositions. After fermentation, the inactivated bacteria are directly centrifuged without any bacterial cell wall breaking treatment, resulting in the loss of a large amount of active ingredients in the bacteria. Moreover, it only focuses on flavonoid compounds such as rutin and catechins and crude polysaccharides in the fermentation broth, and does not focus on other effective ingredients and consider the anti-glycation and repair effects of the fermentation broth.

[0005] Patent CN115569096B relates to a camellia fermentation filtrate and a fermentation process. The raw materials for preparing the camellia fermentation filtrate include: camellia, lactic acid bacteria, oligofructose and water. The prepared camellia fermentation filtrate contains abundant tea polyphenols, flavonoids and other biological small molecule natural nutrients, has strong antioxidant and anti-wrinkle properties, simple preparation raw materials, safe and environmentally friendly process, controllable process and strong applicability. However, it only focuses on small molecules such as tea polyphenols and flavonoids, and does not pay attention to other effective ingredients and consider the anti-glycation and repair effects of the fermentation broth.

[0006] Patent application CN116350556A provides a camellia fermentation filtrate and its preparation method and application. Bifidobacterium adolescentis, yeast and Lactobacillus helveticus are used as fermentation agents, and staged fermentation is adopted to release the active ingredients in the camellia cells, increase the content of effective ingredients in the fermentation filtrate, and enhance the moisturizing, anti-oxidation, anti-wrinkle and skin-lightening effects of the fermentation filtrate. However, its fermentation process is divided into two fermentations, and the process is relatively complicated; and after the bacteria are inactivated, the cell wall is not broken, which will cause the loss of active ingredients in the bacteria, and the anti-glycation and repair effects of the fermentation liquid are not considered. Summary of the invention

[0007] The purpose of the present invention is to provide a Kluyveromyces and its application in preparing red camellia flower and leaf fermentation liquid with anti-aging and repairing effects. By searching for Kluyveromyces that can produce ceramide from red camellia plants and fermenting red camellia flower and leaf powder, the red camellia flower and leaf fermentation liquid contains not only active substances such as flavonoids, polyphenols, free amino acids, but also lipid substances such as ceramide, making it more effective in many aspects, such as anti-glycation, repair, anti-wrinkle and anti-oxidation.

[0008] The objective of the present invention is achieved through the following technical solutions:

[0009] In a first aspect, the present invention provides a Kluyveri yeast antibiotic PRO-LQX002 derived from Camellia japonica, whose Latin name is Lachancea kluyveri and whose deposit number is CCTCC NO:M 20241723.

[0010] The Kluyveromyces yeast PRO-LQX002 was deposited in the China Center for Type Culture Collection on August 2, 2024, with the deposit address being Wuhan University, Wuhan, China. This strain is the only strain in the genus Saccharomyces that currently possesses ceramide.

[0011] In a second aspect, the present invention provides a red camellia fermented liquid, the preparation raw materials of which include: red camellia flowers, red camellia leaves, and Kluyveri yeast modified antibiotic PRO-LQX002, the Latin name of the Kluyveri yeast modified antibiotic PRO-LQX002 is Lachancea kluyveri, and the preservation number is CCTCC NO:M 20241723.

[0012] As some specific embodiments of the present invention, the Camellia japonica fermentation liquid is the supernatant obtained by co-fermenting Camellia japonica, Camellia sinensis leaves and seed liquid of Kluyveromyces resistant to PRO-LQX002, and then centrifuging, breaking the cell wall and filtering.

[0013] As some specific embodiments of the present invention, the Camellia japonica fermented liquid also includes a preservative, and the preservative is added to the obtained supernatant, and the supernatant is filtered again, and the filtrate is the Camellia japonica fermented liquid.

[0014] As some specific embodiments of the present invention, the preservative is glycerol and / or 1,2-pentanediol.

[0015] As some specific embodiments of the present invention, the usage ratio of the red camellia and red camellia leaves to the Kluyveromyces Kluyveri PRO-LQX002 seed solution is 20-30 g: 50-100 mL.

[0016] As some specific embodiments of the present invention, the mass ratio of the red camellia to the red tea leaves is 10:1-1:10.

[0017] As some specific embodiments of the present invention, the fermentation culture is a constant temperature shaking culture.

[0018] As some specific embodiments of the present invention, the fermentation culture temperature is 25-28°C;

[0019] And / or, the rotation speed of the fermentation culture is 150-200r / min;

[0020] And / or, the fermentation culture time is 48-96h;

[0021] Preferably, the fermentation culture temperature is 28°C;

[0022] And / or, the fermentation culture has a rotation speed of 200 r / min.

[0023] As some specific embodiments of the present invention, the centrifugal speed is 4000-8000rpm;

[0024] And / or, the centrifugation time is 5-10 min.

[0025] As some specific embodiments of the present invention, the cell wall breaking specifically comprises: using the supernatant obtained by centrifugation to prepare a bacterial suspension from the precipitated bacterial mud, and performing a homogenization cell wall breaking treatment to obtain a homogenous liquid.

[0026] As some specific embodiments of the present invention, the pressure of the homogenization wall breaking treatment is 800-1200 bar;

[0027] And / or, the homogenization wall-breaking process is repeated 2-4 times.

[0028] As some specific embodiments of the present invention, the filtration specifically comprises: combining the supernatant obtained by centrifugation with the homogenous liquid obtained by cell wall breaking, and filtering with a 0.1-0.2 μm ceramic membrane.

[0029] As some specific embodiments of the present invention, the Camellia japonica fermentation broth includes small molecule active substances and lipid substances; the small molecule active substances include at least one of flavonoids, polyphenols, and free amino acids; and the lipid substances include ceramide.

[0030] As some specific embodiments of the present invention, the preparation raw materials also include: at least one of anhydrous powdered glucose, anhydrous calcium chloride, magnesium sulfate heptahydrate, potassium dihydrogen phosphate, ammonium sulfate, sodium chloride and a defoaming agent.

[0031] As some specific embodiments of the present invention, the contents of the various components in the preparation raw materials are: anhydrous powdered glucose 10-20 g / L, anhydrous calcium chloride 0.1-0.4 g / L, magnesium sulfate heptahydrate 1-3 g / L, potassium dihydrogen phosphate 1-3 g / L, ammonium sulfate 4-6 g / L, sodium chloride 1-2 g / L, and defoaming agent 0.4-0.6 g / L.

[0032] As some specific embodiments of the present invention, the seed solution of Kluyveromyces saccharomyces cerevisiae resistant to PRO-LQX002 is cultured by the following steps:

[0033] S1. Activation of primary bacterial solution: In a sterile environment, the mother strain of Kluyveromyces PRO-LQX002 is inoculated into YM liquid culture medium, and cultured at 25-30°C and 120-180r / min for 1-2 days to obtain primary bacterial solution; the strain is activated to make the strain have better vitality, which is convenient for the subsequent fermentation of red camellia flowers and leaves;

[0034] S2. Secondary bacterial liquid culture: Inoculate the primary bacterial liquid into YM liquid culture medium at an inoculation rate of 5-10% (v / v), culture at 25-30°C and 120-180 r / min for 1-2 days to obtain the seed liquid of Kluyveromyces saccharomyces PRO-LQX002.

[0035] As some specific embodiments of the present invention, the YM liquid culture medium includes 5 g / L soy peptone, 10 g / L glucose, 3 g / L yeast extract powder FM888, and 3 g / L malt extract powder.

[0036] In a third aspect, the present invention provides a composition comprising any one of the Camellia japonica fermented liquids described above.

[0037] In a fourth aspect, the present invention provides a use of the Camellia japonica fermented liquid or the above-mentioned composition as described above in the preparation of a product with antioxidant, anti-glycation, anti-wrinkle or repair effects.

[0038] The red camellia fermented liquid has excellent anti-oxidation, anti-glycation, anti-wrinkle and repairing effects.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] (1) A strain of Kluyveromyces that can produce ceramide was screened from the Camellia japonica plant, and the flowers and leaves of Camellia japonica were fermented, so that the fermented liquid of Camellia japonica not only contained active substances such as flavonoids, polyphenols, and free amino acids, but also contained lipid substances such as ceramide, which could greatly promote the fermentation of Camellia japonica flowers and leaves and greatly increase the content of active ingredients in the fermented liquid;

[0041] (2) The Camellia sinensis fermented liquid of the present invention has multiple effects, including anti-glycation, repair, anti-wrinkle and anti-oxidation. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0043] Figure 1 The microscopic morphology of the screened strains grown on YM medium. DETAILED DESCRIPTION

[0044] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0045] The culture medium formula used in the following examples is as follows:

[0046] (1) YM solid medium: 5 g / L soy peptone, 10 g / L glucose, 3 g / L yeast extract, 3 g / L malt extract, 15 g / L agar powder;

[0047] (2) YM liquid medium: soy peptone 5 g / L, glucose 10 g / L, yeast extract powder FM888 3 g / L, malt extract powder 3 g / L;

[0048] (3) Liquid fermentation medium: anhydrous powdered glucose 10-20 g / L, anhydrous calcium chloride 0.1-0.4 g / L, magnesium sulfate heptahydrate 1-3 g / L, potassium dihydrogen phosphate 1-3 g / L, ammonium sulfate 4-6 g / L, sodium chloride 1-2 g / L, defoamer 0.4-0.6 g / L.

[0049] The specific formula of the liquid fermentation medium used in the following examples is: 10 g / L of anhydrous powdered glucose, 0.2 g / L of anhydrous calcium chloride, 1 g / L of magnesium sulfate heptahydrate, 3 g / L of potassium dihydrogen phosphate, 5 g / L of ammonium sulfate, 1 g / L of sodium chloride, and 0.5 g / L of defoaming agent.

[0050] Example 1: Bacteria screening

[0051] 1. Materials: red camellia, peptone, glucose, yeast powder, malt extract, agar powder, sodium hydroxide, etc.

[0052] 2. Instruments: constant temperature static incubator, constant temperature shaking incubator, high pressure steam sterilizer, test tube, triangular shake flask, etc.

[0053] 3. Methods:

[0054] 1) Screening method: Using the plate dilution coating method, 0.5 g of crushed red camellia was added to 5 mL of sterile water, and the suspension was prepared by shaking at 28°C and 150 r / min for 30 min. The suspension was then diluted to 10 -3 , 10 -4 , 10 -5 , 10 -6 There are 4 gradients in total. Take 100 μL of each concentration of bacterial solution and spread it on YM solid medium. Place it in a 28℃ constant temperature static incubator and invert it for 2-3 days. After a single colony grows on the plate, select 15-20 single colonies and place them in 15-20 bottles containing 5 mL The test tubes were filled with YM liquid culture medium, covered with test tube stoppers, placed in a 28°C constant temperature shaking incubator at a speed of 200 r / min for shaking culture for 1-2 days; after the culture was completed, the bacterial liquid in the test tube was inoculated into 2 bottles of YM liquid culture medium (50 mL / 250 mL) according to a 5% inoculation amount, the bottle mouths were sealed with sterile breathable caps, and placed in a 28°C constant temperature shaking incubator at a speed of 150 r / min for shaking culture for 1-2 days; after the culture was completed, a shake bottle with good growth was selected for each single colony, the culture medium bottle cap was opened in a clean bench, 50 mL of sterile 50% glycerol was added to each bottle, and after shaking, it was divided into several glycerol cryopreservation tubes, marked, and stored in a -80°C ultra-low temperature refrigerator.

[0055] 2) Identification method: Take each single colony glycerol tube, transfer it to the respective YM medium in the clean bench, seal the bottle mouth with a sterile breathable cap, and place it in a 28°C constant temperature shaking incubator at a speed of 150r / min for activation culture for 1 day; in the clean bench, transfer the activated bacterial liquid to a shake flask containing fermentation medium (liquid fermentation medium containing 25g / L red camellia leaf powder), seal the bottle mouth with a sterile breathable cap, and place it in a 28°C constant temperature shaking incubator at a speed of 150r / min. Ferment with high-speed shaking for 2-4 days; after the fermentation is completed, take out the shaking flask, keep it at 90°C in a sterilizer for 20 minutes for sterilization, take it out after sterilization, filter it with a 0.2μm polypropylene membrane, filter out the red camellia and leaf residues, collect the filtrate, and filter the filtrate with a 0.2μm nylon membrane to obtain a relatively clear fermentation liquid, detect the content of lipids such as ceramide in the fermentation liquid, select the strain with a higher ceramide content as the strain for subsequent fermentation, and send it to the Microbial Preservation Center for strain identification.

[0056] 4. Identify the selected strains

[0057] Its morphological characteristics are: growing on SDA plate culture medium, colony size 1-3mm, colony color white to light yellow, smooth and shiny surface, neat edges, microscope shows that the single bacteria are round to oval, with budding reproduction, microscopic morphology like Figure 1 shown.

[0058] The DNA was sent to a third-party institution (Micro-Base Biotechnology (Shanghai) Co., Ltd.) for sequencing of the 26S rDNA gene D1 / D2 region. The sequencing results are as follows (SEQ ID NO.1):

[0059] GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTTTTGATTGGAGCAGCCGGGGGAGTGCCAGCCAGCCTGCGCTTAATTGCGCGGCCGACGGTGCTTTCTGTTAACGGTT GTCTCTTTCTACACACACACTGTGGAGTTTTTTCTACTTTGCTACTTTTTCTTTGGGCGCAAGCCCAGAGGATACAAAACACAAACAATTTTTTATGTTTATTTTAGTCAAGAAATTTTCATTTTAAGAAAATAAAA TATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCTTTGGGTTTGGTCGTGAGTGATACTCTTT CCAGGGTTAACTTGAAAATGCTGGCCATCTGGCTGCTGCTGGCTGAGGCTCTAGTCCAGTCTGCTGATACTCGACGTATTAGGTTTTACCAACTCGTTGTGGCATCGGTCGGGCGTTATTACGACTCTAGCACGAAAGTACAGACAGCCTGGCGAACAGTATTCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAA.

[0060] The strain was compared with the NCBI nt database by blastn, and was most similar to Lachancea kluyveri culture CBS: 4568. The strain was named Xiukang PRO-LQX002, and it belongs to the order Saccharomycetes, family Lachancea, and genus Lachancea kluyveri.

[0061] The strain preservation instructions are as follows:

[0062] Strain name: PRO-LQX002 strain

[0063] Classification name: Kluyveromyces

[0064] Latin name: Lachancea kluyveri

[0065] Deposit number: CCTCC NO:M 20241723

[0066] Depository: China Center for Type Culture Collection (CCTCC)

[0067] Deposit address: Wuhan University, Wuhan, China

[0068] Date of preservation: August 9, 2024.

[0069] Example 2 - Preparation of Camellia sinensis fermentation broth

[0070] 1. Seed liquid culture method:

[0071] 1) Activation of primary bacterial liquid: A glycerol tube containing the screened Kluyveromyces PRO-LQX002 strain in Example 1 was taken out from a -80°C refrigerator, melted in 40°C warm water, transferred into YM liquid culture medium under a sterile environment, covered with a sterile breathable cap, and placed in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min for 1 day.

[0072] 2) Secondary bacterial liquid culture: transfer the primary bacterial liquid into the secondary shake flask (YM liquid culture medium) at a 5% (v / v) inoculation volume, cover with a sterile breathable cover, and place in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min.

[0073] 2. Preparation and sterilization of fermentation medium:

[0074] Liquid fermentation medium containing red camellia flower and leaf powder was prepared according to the following formula: red camellia flower and leaf powder (m 红山茶花 :m 红山茶叶 =2:1) ​​powder 25g / L, anhydrous powdered glucose 10g / L, anhydrous calcium chloride 0.2g / L, magnesium sulfate heptahydrate 1g / L, potassium dihydrogen phosphate 3g / L, ammonium sulfate 5g / L, sodium chloride 1g / L, defoamer 0.5g / L, placed in a conical flask and sterilized at 121℃ for 20min.

[0075] 3. Shake flask fermentation: In a clean bench, add the secondary seed solution to a triangular flask at a 5% (v / v) inoculation rate, and place the shake flask in a constant temperature shaking incubator at 28°C and shake at 150 r / min for 48 h.

[0076] 4. Post-treatment: centrifuge with a centrifuge, collect the supernatant and the bacterial mud, use the supernatant to make the bacterial mud into a 10% wet weight bacterial suspension, the bacterial suspension is broken by a high-pressure homogenizer, the homogenization pressure is 1000 bar, the homogenization times are three times, the supernatant and the homogenate are combined and filtered with a ceramic membrane with a pore size of 0.2 μm to obtain a clarified liquid, add preservatives glycerol and 1,2-pentanediol, and then filter and sterilize through a 0.22 μm nylon membrane to obtain the red camellia fermentation liquid.

[0077] Comparative Example 1

[0078] According to the fermentation culture method of Example 2, the Kluyveromyces saccharomyces PRO-LQX002 strain was fermented and cultured in a liquid fermentation medium without Camellia japonica flowers and leaves, as follows.

[0079] 1. Seed liquid culture method:

[0080] 1) Activation of primary bacterial liquid: A glycerol tube containing the screened Kluyveromyces PRO-LQX002 strain in Example 1 was taken out from a -80°C refrigerator, melted in 40°C warm water, transferred into YM liquid culture medium under a sterile environment, covered with a sterile breathable cap, and placed in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min for 1 day.

[0081] 2) Secondary bacterial liquid culture: transfer the primary bacterial liquid into the secondary shake flask (YM liquid culture medium) at a 5% (v / v) inoculation volume, cover with a sterile breathable cover, and place in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min.

[0082] 2. Preparation and sterilization of fermentation medium: Prepare liquid fermentation medium according to the formula without red camellia flowers and leaves, put it into a conical flask, and sterilize it at 121°C for 20 minutes.

[0083] The formula of liquid fermentation medium without red camellia flower and leaf powder: anhydrous powdered glucose 10g / L, anhydrous calcium chloride 0.2g / L, magnesium sulfate heptahydrate 1g / L, potassium dihydrogen phosphate 3g / L, ammonium sulfate 5g / L, sodium chloride 1g / L, defoaming agent 0.5g / L.

[0084] 3. Shake flask fermentation: In a clean bench, add the secondary seed solution to a triangular flask at a 5% (v / v) inoculation rate, and place the shake flask in a constant temperature shaking incubator at 28°C and shake at 150 r / min for 48 h.

[0085] 4. Post-treatment: centrifuge with a centrifuge, collect the supernatant and bacterial mud, use the supernatant to make the bacterial mud into a 10% wet weight bacterial suspension, the bacterial suspension is broken by a high-pressure homogenizer, the homogenization pressure is 1000 bar, the homogenization times are three times, the supernatant and the homogenate are combined and filtered with a ceramic membrane with a pore size of 0.2 μm to obtain a clarified liquid, add preservatives glycerol and 1,2-pentanediol, and then filter and sterilize through a 0.22 μm nylon membrane to obtain a fermentation liquid.

[0086] Comparative Example 2

[0087] According to the fermentation culture method of Example 2, the red Camellia japonica flower and leaf were extracted without using the Kluyveromyces Kluyveri PRO-LQX002 strain, as follows.

[0088] 1. Do not use primary and secondary bacterial solutions, directly prepare the extraction medium and sterilize it:

[0089] Prepare a liquid fermentation medium containing red camellia flowers and leaves in a triangular flask. The formula is as follows: Red camellia flowers and leaves powder (m 红山茶花 :m 红山茶叶 =2:1) ​​25g / L, anhydrous powdered glucose 10g / L, anhydrous calcium chloride 0.2g / L, magnesium sulfate heptahydrate 1g / L, potassium dihydrogen phosphate 3g / L, ammonium sulfate 5g / L, sodium chloride 1g / L, defoamer 0.5g / L. Sterilize at 121℃ for 20min.

[0090] 2. Shake flask extraction: In a clean bench, add sterile water to the shake flask at a 5% (v / v) inoculation rate, place in a 28°C constant temperature shaking incubator and shake at 150 r / min for 48 h.

[0091] 3. Post-treatment: centrifuge and collect the supernatant, filter with a ceramic membrane with a pore size of 0.2 μm to obtain a clarified liquid, add preservatives glycerol and 1,2-pentanediol, and then filter and sterilize with a 0.22 μm nylon membrane to obtain the red camellia extract.

[0092] Comparative Example 3

[0093] According to the fermentation culture method of Example 2, Bacillus subtilis was fermented and cultured in a liquid fermentation medium containing Camellia japonica flowers and leaves, as follows.

[0094] 1. Seed liquid culture method:

[0095] 1) Activation of primary bacterial liquid: Take out a glycerol tube of Bacillus subtilis strain (Bacillus subtilis strain CICC 20751 purchased from China Industrial Microbiological Culture Collection Center) from a -80°C refrigerator, melt it in 40°C warm water, transfer it into YM liquid culture medium under a sterile environment, cover it with a sterile breathable cap, and place it in a constant temperature shaking incubator at 28°C and 150 r / min for 1 day.

[0096] 2) Secondary bacterial liquid culture: transfer the primary bacterial liquid into the secondary shake flask (YM liquid culture medium) at a 5% (v / v) inoculation volume, cover with a sterile breathable cover, and place in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min.

[0097] 2. Preparation and sterilization of fermentation medium:

[0098] Liquid fermentation medium containing red camellia flower and leaf powder was prepared according to the following formula: red camellia flower and leaf powder (m 红山茶花 :m 红山茶叶 =2:1) ​​powder 25g / L, anhydrous powdered glucose 10g / L, anhydrous calcium chloride 0.2g / L, magnesium sulfate heptahydrate 1g / L, potassium dihydrogen phosphate 3g / L, ammonium sulfate 5g / L, sodium chloride 1g / L, defoamer 0.5g / L, placed in a conical flask and sterilized at 121℃ for 20min.

[0099] 3. Shake flask fermentation: In a clean bench, add the secondary seed solution to a triangular flask at a 5% (v / v) inoculation rate, and place the shake flask in a constant temperature shaking incubator at 28°C and shake at 150 r / min for 48 h.

[0100] 4. Post-treatment: centrifuge with a centrifuge, collect the supernatant and the bacterial mud, use the supernatant to make the bacterial mud into a 10% wet weight bacterial suspension, the bacterial suspension is broken by a high-pressure homogenizer, the homogenization pressure is 1000 bar, the homogenization times are three times, the supernatant and the homogenate are combined and filtered with a ceramic membrane with a pore size of 0.2 μm to obtain a clarified liquid, add preservatives glycerol and 1,2-pentanediol, and then filter and sterilize through a 0.22 μm nylon membrane to obtain the red camellia fermentation liquid.

[0101] Comparative Example 4

[0102] According to the fermentation culture method of Example 2, the Bacillus subtilis strain was fermented and cultured in a liquid fermentation medium without Camellia japonica flowers and leaves, as follows.

[0103] 1. Seed liquid culture method:

[0104] 1) Activation of primary bacterial solution: Take out a glycerol tube of Bacillus subtilis strain (same as the Bacillus subtilis strain in Comparative Example 3) from a -80°C refrigerator, melt it in 40°C warm water, transfer it into YM liquid culture medium under a sterile environment, cover it with a sterile breathable cover, and place it in a constant temperature shaking incubator at 28°C and 150 r / min for 1 day.

[0105] 2) Secondary bacterial liquid culture: transfer the primary bacterial liquid into the secondary shake flask (YM liquid culture medium) at a 5% (v / v) inoculation volume, cover with a sterile breathable cover, and place in a constant temperature shaking incubator for shaking culture at 28°C and 150 r / min.

[0106] 2. Preparation and sterilization of fermentation medium:

[0107] A liquid fermentation medium without red camellia flower and leaf powder was prepared according to the following formula: 10 g / L anhydrous powdered glucose, 0.2 g / L anhydrous calcium chloride, 1 g / L magnesium sulfate heptahydrate, 3 g / L potassium dihydrogen phosphate, 5 g / L ammonium sulfate, 1 g / L sodium chloride, and 0.5 g / L defoaming agent. The medium was placed in a conical flask and sterilized at 121°C for 20 min.

[0108] 3. Shake flask fermentation: In a clean bench, add the secondary seed solution to a triangular flask at a 5% (v / v) inoculation rate, and place the shake flask in a constant temperature shaking incubator at 28°C and shake at 150 r / min for 48 h.

[0109] 4. Post-treatment: centrifuge with a centrifuge, collect the supernatant and the bacterial mud, use the supernatant to make the bacterial mud into a 10% wet weight bacterial suspension, the bacterial suspension is broken by a high-pressure homogenizer, the homogenization pressure is 1000 bar, the homogenization times are three times, the supernatant and the homogenate are combined and filtered with a ceramic membrane with a pore size of 0.2 μm to obtain a clarified liquid, add preservatives glycerol and 1,2-pentanediol, and then filter and sterilize through a 0.22 μm nylon membrane to obtain the red camellia fermentation liquid.

[0110] Test Example 1: Physical and Chemical Index Test - Test of Ceramide Type and Content

[0111] Liquid chromatography tandem mass spectrometry (LC-MS / MS) can accurately determine the quality and quantity, and lipidomics analysis was used to detect and screen lipids with important biological significance and statistically significant differences from different red camellia flower and leaf fermentation broth samples. Among them, 13 ceramides were screened out, as shown in Table 1.

[0112] Table 1 Types and contents of ceramides in different samples

[0113]

[0114]

[0115] It can be seen from the results in the above table that the PRO-LQX002 strain of Kluyveromyces screened by the present invention can produce a small amount of ceramide during the fermentation process, and contains different types of ceramides; while no ceramide substance was detected in Comparative Examples 2, 3 and 4 in which this strain was not used for fermentation.

[0116] Test Example 2: Physical and chemical index test - total flavonoids, total polyphenols and free amino acids test

[0117] The content of total polyphenols in the fermentation broth of the embodiment and the comparative example was determined by the Folin phenol method; the content of total flavonoids in the fermentation broth was determined by the sodium nitrite-aluminum nitrate-sodium hydroxide colorimetric method; and the content of free amino acids in the fermentation broth samples of different embodiments and comparative examples was tested by liquid chromatography-mass spectrometry. The results are shown in Table 2.

[0118] Table 2 Contents of total flavonoids, total polyphenols and free amino acids in fermentation broth of Examples and Comparative Examples

[0119]

[0120] It can be seen from Table 2 that the total amount of total flavonoids, total polyphenols and free amino acids in Example 2 are higher than those in each comparative example. The total flavonoids, total polyphenols and free amino acids produced by fermentation with the Xiukang PRO-LQX002 strain alone in Comparative Example 1 and water extraction with red camellia flowers and leaves alone in Comparative Example 2 are both low. After fermentation with the Xiukang PRO-LQX002 strain in a fermentation medium containing red camellia flowers and leaves in Example 2, the total flavonoids, total polyphenols and free amino acids produced are greatly increased, and are much greater than the sum of comparative examples 1 and 2, resulting in an effect of 1+1>2. Therefore, the strain Xiukang PRO-LQX002 of the present invention can promote the fermentation of red camellia flowers and leaves, and fermenting it together with red camellia flowers and leaves will produce more active ingredients.

[0121] In addition, compared with Comparative Example 2, it can be seen that Bacillus subtilis can also promote the fermentation of red camellia flowers and leaves to a certain extent. However, the content of active ingredients in the co-fermentation of Bacillus subtilis and red camellia flowers and leaves in Comparative Example 3 is much lower than the content of active ingredients in the co-fermentation of Saccharomyces kluyveri and red camellia flowers and leaves in Example 2. The fermentation effect of Saccharomyces kluyveri PRO-LQX002 on red camellia flowers and leaves is much higher than that of Bacillus subtilis.

[0122] Test Example 3: In vitro efficacy anti-wrinkle test - type I collagen promotion rate (fibroblasts)

[0123] The fermentation broth samples in different embodiments and comparative examples were tested for their ability to promote the synthesis of type I collagen in fibroblasts, and their anti-wrinkle effects were evaluated. The method refers to "T / SHRH 031-2020 Cosmetic Firming and Anti-Wrinkle Efficacy Test". HSF cells in the logarithmic growth phase were inoculated in a 3-cm diameter cell culture dish or a 6-well cell culture plate. After the cells were fused to 80%, the positive control sample (50 ng / ml TGF-β), Example 2, and the fermentation broth (1%) of Comparative Examples 1 and 2 were added to the sample group for culture. After replacing the fresh culture medium, the culture was continued for 24 hours, the cell supernatant was collected, and the content of type I collagen was detected by ELISA kit. The results are shown in Table 3.

[0124] Relative content of type Ⅰ collagen = T / C × 100%

[0125] in:

[0126] T—average value of type I collagen content of the test substance;

[0127] C—Average value of type I collagen content in blank / solvent control.

[0128] Table 3 Effects of different samples on the relative value of type I collagen

[0129] Sample name Test concentration Relative value of type Ⅰ collagen Blank control / 100.00％ Positive control (TGF-β) 50ng / ml 142.12±2.15％ Example 2 1％ 132.30±3.87％ Comparative Example 1 1％ 105.24±2.57％ Comparative Example 2 1％ 107.25±3.04％ Comparative Example 3 1％ 113.58±2.97％ Comparative Example 4 1％ 104.83±2.68％

[0130] From the results in Table 3, it can be seen that the fermentation broths of the examples and comparative examples can promote the synthesis of type I collagen to varying degrees, indicating that they have different anti-wrinkle effects. However, the anti-wrinkle effect of Example 2 is significantly better.

[0131] Test Example 4: In vitro efficacy repair test - cell scratch (keratinocytes)

[0132] Epidermal keratinocytes are important cells that make up the epidermis. When the skin surface is damaged, keratinocytes will be stimulated to migrate and repair the damaged parts. When the cells grow to a monolayer state in vitro, a blank area is artificially created on the monolayer cells. The cells at the edge of the scratch will gradually enter the blank area to heal the scratch, simulating the cell migration process in vivo to a certain extent. By measuring the cell migration rate after sample treatment, it is evaluated whether the test substance has a repair effect. The results are shown in Table 4.

[0133] Table 4 Effects of different samples on cell migration rate

[0134] Sample name Test concentration Cell migration rate Blank control / 19.80±1.04％ Example 2 1％ 29.24±0.97％ Comparative Example 1 1％ 23.18±1.01％ Comparative Example 2 1％ 20.35±0.89％ Comparative Example 3 1％ 22.12±0.91％ Comparative Example 4 1％ 19.99±0.98％

[0135] According to the results in Table 4, Example 2 can significantly improve the cell migration rate, and Comparative Examples 1 and 3 both have the effect of improving the cell migration rate, but are significantly less than Example 2, and Comparative Examples 2 and 4 have almost no effect.

[0136] Test Example 5: In vitro antioxidant efficacy test - DPPH free radical scavenging rate

[0137] 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH for short) is a stable long-lived free radical. Its ethanol solution is dark purple and has strong absorption near 520nm. When there is a free radical scavenger, the light absorption of the DPPH ethanol solution is weakened due to its single electron pairing. The degree of fading of the DPPH ethanol solution is linearly related to the number of electrons it accepts, which can be used to evaluate the ability of the test sample to scavenge free radicals, that is, the size of the antioxidant activity. This method was used to test the scavenging rate of the fermentation broth samples of different embodiments and comparative examples on DPPH, and the antioxidant effect of different samples was evaluated. The results are shown in Table 5.

[0138] Table 5 Scavenging rate of DPPH free radicals by different samples

[0139]

[0140]

[0141] According to the results in the above table, the fermentation broth samples of different embodiments and comparative examples can remove DPPH free radicals to a certain extent at different concentrations, indicating that they have a certain antioxidant effect. However, it can be seen from the results that Example 2 has a better DPPH free radical removal rate and a better antioxidant effect.

[0142] Test Example 6: In vitro efficacy anti-glycation test - AGEs inhibition ability test

[0143] The fluorescence characteristics of advanced glycation end products (AGEs) of bovine serum albumin (BSA) in the non-enzymatic glycation reaction (Maillard reaction) of glucose (Glucose) were used to determine the protein glycosylation level using a fluorescence spectrophotometer to measure the fluorescence value at an excitation wavelength of 370nm / emission wavelength of 440nm. This method was used to test the inhibition rate of fermentation broth samples of different embodiments and comparative examples on AGEs, and to evaluate the anti-glycation effects of different samples. The results are shown in Table 6.

[0144] Table 6 Inhibition rate of different samples on AGEs

[0145] Sample name Test concentration Inhibition rate Blank control (aminoguanidine) 0.01％ 48.93％ Example 2 1％ 33.01％ Comparative Example 1 1％ 5.58％ Comparative Example 2 1％ 8.17％ Comparative Example 3 1％ 15.75％ Comparative Example 4 1％ 4.93％

[0146] According to the results in the table above, different fermentation broth samples with the same concentration all have a certain inhibition rate on the production of AGEs, indicating that they have a certain anti-glycation effect. Among them, Example 2 has the best inhibition rate on AGEs, which is more than twice the inhibition rate of Example 3, indicating that the fermentation broth fermented with red Camellia japonica flowers and leaves using the Kluyveromyces of the present invention has a better anti-glycation effect than the conventional Bacillus subtilis.

[0147] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A modified antibiotic PRO-LQX002 of Kluyveri yeast from Camellia japonica, whose Latin name is Lachanceakluyveri and whose deposit number is CCTCC NO:M 20241723.

2. A red camellia fermentation liquid, characterized in that: The preparation raw materials include: red camellia, red tea leaves, and the Kluyveromyces Kluyveri antibiotic PRO-LQX002 as claimed in claim 1.

3. The red camellia fermented liquid according to claim 2, characterized in that The red camellia fermented liquid is prepared by co-fermenting and culturing the seed liquid of red camellia, red camellia leaves and Kluyveromyces saccharomyces resistant to PRO-LQX002, and then centrifuging, breaking the cell wall and filtering to obtain the supernatant.

4. The red camellia fermented liquid according to claim 3, characterized in that The dosage ratio of the red camellia and red camellia leaves to the Kluyveromyces saccharomyces PRO-LQX002 seed solution is 20-30 g: 50-100 mL; The mass ratio of the red camellia to the red tea leaves is 10:1-1:

10.

5. The red camellia fermented liquid according to claim 3, characterized in that: The fermentation culture temperature is 25-28°C, the rotation speed is 150-200r / min, and the time is 48-96h.

6. The red camellia fermented liquid according to claim 3, characterized in that The seed solution of Kluyveromyces saccharomyces cerevisiae for PRO-LQX002 is cultured in the following steps: S1. Activation of primary bacterial solution: In a sterile environment, the mother strain of Kluyveromyces cerevisiae PRO-LQX002 was inoculated into YM liquid culture medium, and cultured at a constant temperature of 25-30°C and 120-180r / min to obtain primary bacterial solution; S2. Secondary bacterial liquid culture: Inoculate the primary bacterial liquid into YM liquid culture medium at an inoculation rate of 5-10%, and culture at 25-30° C. and 120-180 r / min with constant temperature shaking to obtain the seed liquid of Kluyveromyces PRO-LQX002.

7. The red camellia fermented liquid according to claim 2, characterized in that The raw materials for preparation also include at least one of anhydrous powdered glucose, anhydrous calcium chloride, magnesium sulfate heptahydrate, potassium dihydrogen phosphate, ammonium sulfate, sodium chloride and a defoaming agent.

8. The red camellia fermented liquid according to claim 2, characterized in that: The Camellia japonica fermented liquid comprises small molecule active substances and lipid substances; the small molecule active substances comprise at least one of flavonoids, polyphenols and free amino acids; and the lipid substances comprise ceramide.

9. A composition comprising the Camellia japonica fermented liquid according to any one of claims 2 to 8.

10. Use of the Camellia japonica fermented liquid according to any one of claims 2 to 8 or the composition according to claim 9 in preparing products having anti-glycation, repair, anti-wrinkle or anti-oxidation effects.

Images