Application of soybean ARGONAUTE family gene GmAGO5 in improvement of yield and quality

Abstract

The invention discloses an application of a gene GmAGO5 of a soybean ARGONAUTE family. The gene GmAGO5 of the soybean ARGONAUTE family is shown The nucleotide sequence of the soybean GmAGO5 protein coding gene GmAGO5 is as shown in SEQ ID NO. 1. The invention also discloses a preparation method of the soybean GmAGO5 protein coding gene The constructed plant gene editing knockout vector pSCM-GmAGO5 is transferred into an acceptor material Tianlong No.1 by using a cotyledonary node transformation method. The GmAGO5 gene is knocked out, so that the plant height of the gene edited soybean is reduced, the branch included angle is reduced, and the protein content of the soybean seeds is remarkably increased. Therefore, the soybean GmAGO5 protein coding gene GmAGO5 disclosed by the invention can be applied to reducing soybean plant height, reducing branch included angle and improving the protein content of soybean seeds through a genetic engineering means.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering and relates to the application of a soybean ARGONAUTE family gene GmAGO5. Specifically, it relates to the application of the ARGONAUTE family gene GmAGO5 derived from cultivated soybeans, which is highly expressed in roots and pods and is related to regulating soybean plant type and seed development, in regulating plant height, branch angle, protein content and other plant type and quality traits. Background Art

[0002] Human diet and livestock feed mainly come from cereals and legumes. Soybean (Glycine max L.) is native to my country. Its seeds are rich in protein (PC) and oil, so it is widely used in agriculture and industry. As a short-day crop, soybean is planted in a wide geographical area. Plant height and branch angle are important plant type traits of soybean, which have an important impact on its yield (Yang Shengxian et al., 2011). Especially in the mode of soybean-corn strip composite planting, plant height and branch angle determine the planting characteristics of soybean lodging resistance and dense planting tolerance, and then determine the yield of soybean under high-density planting. Yield traits are often negatively correlated with quality traits. Increasing yield as much as possible while ensuring that the fat and protein content in soybean seeds does not change significantly has always been an important breeding goal in soybean breeding. Therefore, exploring genes that can simultaneously regulate soybean plant height, branch angle and protein content has important application value for cultivating ideal plant types and high-yield, high-quality and adaptable soybean varieties. AGO proteins (Argonaute proteins) are a class of proteins that are widely present in animals, plants and microorganisms and are highly conserved. The main conserved domains include PAZ, PIWI, etc. AGO proteins exert their functions by binding to sRNA: first, they exert their functions by affecting the transcription pathway or inhibiting the translation process to control the downstream target genes; second, they regulate the methylation of the DNA sequence of downstream genes, thereby activating or inhibiting the expression of downstream genes; third, they regulate the histone modification of genes to regulate gene expression. There are also certain differences in the number of AGO family members in different species. For example, there are 27 AGO genes in the genome of microorganisms nematodes; in plants, such as the Arabidopsis genome and the rice genome contain 10 AGO genes and 19 AGO genes respectively, and the AGO protein families in corn and soybean are 17 and 22 respectively. The AGO families of these plants are consistent with the classification in Arabidopsis; in animals, the Drosophila genome contains 5 AGO genes (Cai Jianyu et al., 2017). Previous studies have shown that AGO proteins are involved in plant defense against viruses and in viral immunity based on RNA levels (Morel JB et al., 2002). However, there are few studies on AGO proteins regulating plant architecture and seed development, especially soybean plant height, branch angle and protein content. Summary of the invention

[0003] The purpose of the present invention is to disclose an application of a soybean ARGONAUTE family gene GmAGO5.

[0004] Another object of the present invention is to provide genetic engineering applications of the gene in regulating soybean plant height, branch angle and protein content.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The soybean ARGONAUTE family gene GmAGO5, the nucleotide sequence is: SEQ ID NO.1.

[0007] The amino acid sequence of the protein encoded by the cultivated soybean ARGONAUTE family gene GmAGO5 of the present invention is SEQ ID NO.2.

[0008] A gene editing vector containing the soybean ARGONAUTE family gene GmAGO5 of the present invention.

[0009] The application of the cultivated soybean GmAGO5 protein encoding gene GmAGO5 of the present invention in improving the plant type and quality of gene-edited plants.

[0010] As a preferred embodiment of the present invention, the transgenic soybean in which GmAGO5 is knocked out using CRISPR / Cas9 technology has reduced plant height, reduced branch angle, and significantly increased protein content.

[0011] When using GmAGO5 to construct a plant expression vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, GFP gene, etc.) that can be expressed in plants or a resistance gene for an antibiotic marker (gentamicin marker, kanamycin marker, hygromycin marker, etc.). Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by phenotypic traits.

[0012] The plant expression vector carrying the GmAGO5 of the present invention can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants. The transformed plant host can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis, soybean, rapeseed, cucumber, tomato, poplar, lawn grass, and alfalfa.

[0013] Beneficial effects:

[0014] In the present invention, GmAGO5 belongs to the ARGONAUTE family and contains PAZ and PiWi domains. Through tissue expression analysis, it was found that GmAGO5 was expressed in various tissues, among which the expression level in the stem was the lowest, the expression level in the root was the highest, and the pod was second. Subcellular localization showed that the GmAGO5 protein was mainly located in the nucleus and cell membrane. Using the plant gene editing vector pSCM-GmAGO5, the GmAGO5 gene of the present invention was knocked out in the soybean variety Tianlong No. 1, which can regulate the plant height, branch angle and protein content of soybeans. Compared with the control, the plant height of GmAGO5 gene-edited soybeans was significantly reduced, the branch angle was significantly reduced, and the protein content was significantly increased. The present invention discloses the role of the gene in regulating soybean plant height, branch angle and protein content. The plant height, branch angle and protein content of soybeans of crops can be directionally modified, thereby improving the plant type and grain quality of the plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0016] Figure 1 Cloning of GmAGO5 gene

[0017] Primers were designed based on the GmAGO5 sequence information predicted by the phytozome website, and PCR amplification was performed using the cDNA of the leaves of Nannong 1138-2 at the flowering stage as a template to obtain a 2877bp DNA fragment. After sequencing analysis, the sequence information of the fragment was consistent with the sequence predicted by the phytozome website, that is, the 2877bp fragment was the GmAGO5 gene. The marker was 5k, and from bottom to top, they were 300, 500, 800, 1000, 1500, 2000, 3000 and 5000bp.

[0018] Figure 2 Tissue expression analysis of GmAGO5 gene.

[0019] Real-time fluorescence quantitative PCR technology was used to study the expression of GmAGO5 in different tissues of soybean Tianlong No. 1, including roots, stems, leaves, flowers, 35-day pods, and seeds.

[0020] Figure 3 Subcellular localization of GmAGO5 (A) d35s::GFP; (B) d35s::GmAGO5-GFP;

[0021] Figure 4 pSCM-GmAGO5 vector map

[0022] Figure 5 Bar test strip identification of GmAGO5 gene-edited soybeans.

[0023] T 0 Bar strip detection of GmAGO5 gene-edited soybean plants. WT represents the receptor Tianlong No. 1, and 1-3 represent three T 0 -generation positive single plants.

[0024] Figure 6 PCR identification of GmAGO5 gene-edited soybean.

[0025] 1 is the pSCM-GmAGO5 recombinant plasmid (positive control); 2-4 are single plants of three different T 1 -generation transgenic lines, KO-31, KO-55, KO-W35; WT is the receptor Tianlong No. 1 (negative control). Among them, Marker is 2k, and from bottom to top are 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp in turn.

[0026] Figure 7 Relative expression level of GmAGO5 in gene-edited soybean

[0027] KO-31, KO-55, KO-W35 are different transgenic lines, and TL is the receptor Tianlong No. 1, the same below. Figure 8 Plant height comparison between GmAGO5 gene-edited soybean and control

[0028] Compared with the control TL, the plant heights of the three GmAGO5 gene-edited soybeans increased, and the lines KO-31, KO-55, and KO-W35 reached extremely significant differences. * indicates significant difference at the 0.01 < p < 0.05 level; ** indicates extremely significant difference at the 0.001 < p < 0.01 level; *** indicates significant difference at the p < 0.001 level.

[0029] Fig. 9 Branch angle comparison between GmAGO5 gene-edited soybean and control

[0030] Compared with the control TL, the branch angles of the three GmAGO5 gene-edited soybeans decreased, and the lines KO-31, KO-55, and KO-W35 reached extremely significant differences. * indicates significant difference at the 0.01 < p < 0.05 level; ** indicates extremely significant difference at the 0.001 < p < 0.01 level; *** indicates significant difference at the p < 0.001 level.

[0031] Fig.10 Protein content comparison between GmAGO5 gene-edited soybean and control

[0032] Compared with the control TL, the protein content of the three GmAGO5 gene-edited soybeans increased, and the KO-31 and KO-55 lines showed extremely significant differences, while the protein content of the KO-W35 line increased. * indicates significant difference at the 0.01 < p < 0.05 level; ** indicates extremely significant difference at the 0.001 < p < 0.01 level; *** indicates significant difference at the p < 0.001 level. Detailed implementation mode

[0033] The present invention will be further described in detail below with reference to the accompanying drawings, examples, and data. These examples are only for illustrative purposes and do not limit the scope of the present invention in any way. In the following examples, various processes and methods not described in detail are conventional methods well known in the art. The primers used are indicated when they first appear, and the same primers used later have the same content as the first indication.

[0034] Example 1 Cloning and identification of soybean GmAGO5 and its encoding gene

[0035] Primers were designed according to the GmAGO5 sequence information predicted by the phytozome website, and PCR amplification was performed using the leaf cDNA of Nannong 1138-2 at the full flowering stage as a template.

[0036] Forward primer GmAGO5-F: ACCACACTTCCTTCCCTCCTA;

[0037] Reverse primer GmAGO5-R: CACAACGCTCTGTTTACCGC.

[0038] The GmAGO5 gene was amplified from the total RNA of soybean leaves by RT-PCR. Soybean leaf tissue was taken and ground with a mortar. The mixture was added to a 1.5 mL EP tube containing lysis solution and then transferred to a glass homogenizer after sufficient shaking. After homogenization, the mixture was transferred to a 1.5 mL EP tube and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectrophotometer. The total RNA obtained was used as a template and reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara Company to synthesize the first chain of cDNA. PCR amplification reaction was performed. The PCR reaction system was: 2 μl cDNA (0.05 μg), 2 μl of upstream and downstream primers (10 μM), 25 μl 2×PhantaMax Buffer, 1 μl dNTP (10 mM) and 1U Phanta Max Super-Fidelity DNA polymerase (Vazyme), and 50 μl was supplemented with ultrapure water. The PCR program was as follows: it was carried out on a Bio-RAD PTC200 PCR instrument, and the program was 94°C pre-denaturation for 3 min; 94°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 45 s, for a total of 30 cycles; then 72°C extension for 5 min to terminate the reaction, and stored at 4°C. The PCR product was recovered and cloned into the pGEM-Teasy vector, and the cDNA sequence of the soybean gene GmAGO5 with a complete coding region was obtained after sequencing. SEQ ID NO.1, a full length of 2877 bp, encoding 959 amino acids shown in SEQ ID NO.2.

[0039] Example 2 Expression characteristics of GmAGO5 in different organs of soybean

[0040] RNA was extracted from roots, stems, leaves, flowers, 35-day-old pods, and seeds of Tianlong No. 1 and converted into cDNA for RT-PCR analysis.

[0041] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as the internal reference gene, and the amplification primers were Tubulin upstream primer sequence: GGAGTTCACAGAGGCAGAG, Tubulin downstream primer sequence: CACTTACGCATCACATAGCA. cDNA from different soybean tissues or organs was used as a template for real-time fluorescence quantitative PCR analysis. The amplification primers for GmAGO5 were: GmAGO5-qPCR-F: CAACCAGATTCACGCCATCC, GmAGO5-qPCR-R: GAGACGCGGCA CGAACAG. Results ( Figure 2 ) analysis showed that the expression of GmAGO5 was relatively high in roots and pods, indicating that GmAGO5a may be associated with soybean pod development.

[0042] Example 3 Subcellular localization of GmAGO5

[0043] Subcellular localization was performed using the transient expression method of Nicotiana benthamiana. The vector used was P2, and the primers were GmA GO5-P2-F:ACAAATCTATCTCTCTCGAGATGTCTCGTCGCGGTGGCTC, GmA GO5-P2-R:GCTCACCATGGATCCACAGAAGAACATCACATCTT. PCR amplification, after the target band was correct, the rubber was cut and recovered, and the rubber recovery product was connected to the vector by homologous recombination to construct the subcellular localization vector p2-GmAGO5 (the gene is at the N-terminus of GFP). After transient expression in tobacco, it was cultured in the dark for 48 hours. After laser irradiation with a laser confocal microscope (Zeiss, LSM780), a green fluorescent signal was generated to locate the protein and observe and take pictures. The results are shown in Figure 3 As shown, the empty vector was distributed throughout the cell, and the GmAGO5:GFP fusion protein was also distributed in the nucleus and cell membrane, indicating that GmRNF1a may function in the cell membrane and nucleus.

[0044] Example 4 Genetic Engineering Application of GmAGO5

[0045] The CDS region sequence of the GmAGO5 gene was placed into CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ), sgRNA was obtained, and sgRNA with high targeting efficiency and low off-target rate was selected. In order to improve the targeting efficiency, four sgRNAs were selected: GmAGO5-sgF1: GGCCAGGGTTCGGTCTTGTAGTTTTAGAGCTAGAAATAGCA AG,

[0046] GmAGO5-sgR1:TACAAGACCGAACCCTGGCCCAATCCATATGTTTTCCTGG AC;

[0047] GmAGO5-sgF2:AGACCGGCACGAACAGGTGGTTTTAGAGCTAGAAATAGC AAG,

[0048] GmAGO5-sgR2:CACCTGTTCGTGCCGCGTCTTGACCAGACATGTCACGCTTA GT;

[0049] GmAGO5-sgF3:GACGGAGACGCGGCACGAACGTTTTAGAGCTAGAAATAGC AAG,

[0050] GmAGO5-sgR3:GTTCGTGCCGCGTCTCCGTCCAATCCATATGTTTTCCTGGGA C;

[0051] GmAGO5-sgF4:ATTCAGTGAACGGCCAGGGTTGTTTTAGAGCTAGAAATAGC AAG,

[0052] GmAGO5-sgR4:AACCCTGGCCGTTCACTGAATTGACCAGACATGTCACGCTT AGT.

[0053] The specific operation is as follows: construct the sgRNA targeting sequence, use the pGmU6 plasmid as the template, use the template upstream primer U6-F (GGAATTGTGAGCGGATAAC) and the sgRNA1 downstream primer GmAGO5-sgR1 as a pair of primers, use the sgRNA1 upstream primer GmAGO5-sgF1 and the template downstream primer U6-R (CCATGAATAGGTCTATGACC) as another pair of primers, and perform PCR reactions to obtain two fragments, U6-F—GmAGO5-sgR1 and GmAGO5-sgF1—U6-R; use the pGmU3 plasmid as the template, use the template upstream primer U3-F (TAGAGG AGCTGTTCTGCTTC) and sgRNA2 downstream primer GmAGO5-sgR2 were used as a pair of primers, and sgRNA2 upstream primer GmAGO5-sgF2 and template downstream primer U3-R (CCATGAATAGGTCTATGACC) were used as another pair of primers. PCR reactions were performed to obtain U3-F—GmAGO5-sgR2 and GmAGO5-sgF2—U3-R. By the same PCR method, U6-F—GmAGO5-sgR3 and GmAGO5-sgF3—U6-R as well as U3-F—GmAGO5-sgR4 and GmAGO5-sgF4—U3-R were obtained.

[0054] Subsequently, a bridging PCR reaction was carried out using U6-F—GmAGO5-sgR1 and GmAGO5-sgF1—U6-R as templates to obtain the U6-F—GmAGO5-sgRNA1—U6-R fragment; through the same bridging PCR reaction, U3-F—GmAGO5-sgRNA2—U3-R, U6-F—GmAGO5-sgRNA3—U6-R, and U3-F—GmAGO5-sgRNA4—U3-R were obtained again, a total of 4 bridging PCR reaction products, which achieved the goal of connecting sgRNA1 and sgRNA3 to the U6 promoter, and sgRNA2 and sgRNA4 to the U3 promoter, and then connecting the 4 bridging PCR reaction products to the T vector for storage.

[0055] Using primers pU6-F (GTCAGTCGACGGAATTGTGAGCGGATAAC) and pU6-R (CTAGTCTAGACCATGAATAGGTCTATGACC), the bridging products U6-F—GmAGO5-sgRNA1—U6-R and U6-F—GmAGO5-sgRNA3—U6-R were amplified by tailing PCR, so that the product fragments had NcoI and BamHI restriction sites on both sides; using primers pU3-F (CATGCCATGGTAGAGGAGCTGTTCTGCTT) and pU3-R (GTCAGTCGACATGAATAGGTCTATGACC), the bridging products U3-F—GmAGO5-sgRNA2—U3-R and U3-F—GmAGO5-sgRNA4—U3-R were amplified by tailing PCR, so that the product fragments had BamHI and XbaI restriction sites on both sides. The original pSCM vector plasmid was double-digested with NcoI and XbaI endonucleases, and the U6-F-GmAGO5-sgRNA1-U6-R and U3-F-GmAGO5-sgRNA2-U3-R with added restriction sites were ligated to the lac position of the cut pSCM vector, i.e., the gRNA scaffold position, using T4 ligase. Thus, a two-linked vector was constructed ( Figure 4 ), and similarly obtain another two-linked vector containing sgRNA3 and sgRNA4.

[0056] Using the pSCM vector plasmid connected with sgRNA3 and sgRNA4 as a template, pSC-MF (GATGTGTTAAATGCTGCGGCTCGTATGTTGTGTGGAATTG) and pSC-MR (ATCGGGGAAATTCGAGCTCTATACGCTAAGGGAATGCTTG) as primers for PCR amplification, the fragment product of U6-sgRNA3-U3-sgRNA4 was obtained, and the pSCM vector plasmid connected with sgRNA1 and sgRNA2 was digested with Eco91I endonuclease, and then connected with the amplified product of U6-sgRNA3-U3-sgRNA4 by recombinant ligase, thus constructing a four-linked pSCM vector pSCM-GmAGO5 edited with four sgRNAs, and pSCM-GmAGO5 was transferred into the Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. It was used for tissue culture experiments of soybean target gene knockout.

[0057] Transgenic soybean plants were created using the cotyledon node transformation method mediated by Agrobacterium strain EHA105. The specific creation process is as follows: soybean seeds with no surface defects, full grains, and uniform color of large and small seed coats were selected and sterilized in a fume hood. The chemical reaction HCl (concentrated) + NaClO → Cl 2↑+NaOH (the ratio of concentrated hydrochloric acid to sodium hypochlorite is about 1:10 in volume) produces chlorine for disinfection. In the experiment, 120ml of NaClO was taken into a conical flask. At this time, the beans placed in the culture dish were placed in the dryer, the conical flask was placed in the middle of the dryer, and the lid was closed. Then 15ml of concentrated HCl was slowly added from the top of the dryer through a separatory funnel, and the disinfection time was 6-7 hours. Seed germination: The sterilized seeds were fully blown away by chlorine in the clean bench, and vertically inserted into the pre-prepared solidified SG4 germination solid culture medium, so that the culture medium covered half of the hilum. Inoculation: Add about 120ml of YEB liquid culture medium with antibiotics Kan and Rif to the conical flask, add 1-2ml of a small amount of bacterial solution, and shake at 28°C and 200rpm to OD600=0.85-0.9. Agrobacterium infection: Centrifuge the shaken bacterial solution at 5000rpm for 10min at room temperature, discard the supernatant, then add co-culture medium CCM to two centrifuge tubes for oscillation and suspension, and adjust to OD600 = 0.5-0.6. Five days after the soybean seeds germinate, cut off part of the hypocotyl to retain 5-10mm, then cut the seeds along the cotyledons and hypocotyls, remove the true leaves, and then use a knife to gently cut several wounds along the direction of the hypocotyl at the cotyledon node. Pour the treated explants and the suspended bacterial solution into a sterilized jar, and co-culture at 28℃, 120rpm for 30-40min. Finally, take out the explants, place them on a solid co-culture medium CCM covered with a layer of filter paper with the cotyledon node side facing down, and place 14 explants in each culture dish, and culture them in the dark at 25℃ for 5 days. Induction of clustered buds: After 5 days of co-cultivation, the explants were sterilized with sterilized water and Wash-Liquid, and the overlong hypocotyls were cut off, leaving about 5-10 mm, and the growth point was inserted into the SIM solid medium without glufosinate at an angle of 45° upward, 8 per dish, and cultured at 26°C for 14-17 days. After 14-17 days, the large buds and part of the hypocotyls were removed, and the explants with clustered buds were replaced with SIM solid medium with 6 mg / L glufosinate for screening and cultured for 14-17 days. Elongation: The cotyledons, dead leaves and part of the hypocotyls of the explants that were not completely dead were removed, and replaced with SEM solid medium with 4 mg / L glufosinate for culture for 14-17 days. With a cycle of 14-17 days, the dead leaves and part of the hypocotyls were removed, and replaced with new SEM solid medium, and the concentration of glufosinate was gradually reduced. Rooting: When the bud of the explant grows to about 6cm, cut off the bottom, cut a cross-shaped wound at the bottom of the stem, and transfer to the rooting medium RM for cultivation. The induced roots can be seen after about 10 days. Hardening: Pour an appropriate amount of sterile water into the bottle and culture at 26℃ for about 5 days. Transplanting. When the number and length of roots are moderate, separate the tissue culture seedlings from the culture medium, transfer them to sterilized soil, and place them in an artificial incubator for growth (16h light / 8h dark, 25℃).

[0058] The gene editing vector pSCM-GmAGO5 contains the selection marker gene bar in its vector sequence. After the transplantation of T0 seedlings, the bar rapid test strips were used to detect the positive T0 soybean plants ( Figure 5 ). After the T0 seedlings grow new leaves, take leaves from different nodes for mixed testing, add 500ul of buffer, crush the leaves and mix them, then insert the test strip vertically into the mixed liquid, and read the result after the mixed liquid rises to a certain height of the test strip. If there is only one band on the top, it is negative, and if two bands are displayed, it means the sample is positive. At this time, the bar protein can be detected, and the sample plant is considered to be a positive plant. T 1 Generation of extraction 0 The genomic DNA of the offspring of transgenic plants with bar resistance was screened and PCR identification was performed using gene-specific primers Bar-F: CGAGACAAGCACGGTCAACTT, and Bar-R: AAACCCACGTCATGCCAGTTC. The transgenic soybeans that could amplify a band of about 400 bp were positive ( Figure 6 ). Plants identified as positive by PCR were selected, and real-time fluorescence quantitative PCR was performed using qRT-GmAGO5-F CAACCAGATTCACGCCATCC and qRT-GmAGO5-RGAGACGCGGCACGAACAG as primers. The results showed that the expression level of GmAGO5 in gene-edited soybeans was significantly reduced ( Figure 7 ).

[0059] After tissue culture experiments, a total of 3 gene-edited strains were obtained. After reproduction and generation in the laboratory environment, T2 generation plants were planted in the Liuhe field and T3 generation seeds were harvested. The plant height, branch angle and grain protein of T2 generation transgenic plants were measured, and the plant height and branch angle of soybeans were investigated individually; the harvested seeds were placed in a 28°C oven and dried for 5 days, and the protein content of the seeds was measured using a near-infrared spectrometer. Compared with the recipient Tianlong No. 1, the plant height of the three gene-edited strains was reduced, and the difference in plant height between the three strains and the control reached an extremely significant level ( Figure 8 A, B); The branch angles of the three gene-edited strains decreased, and the differences in branch angles between the three strains and the control reached an extremely significant level ( Figure 8 B, Fig. 9 ). The seed protein content was higher than that of the recipient Tianlong No. 1, and the KO-31 and KO-55 strains reached extremely significant levels ( Fig.10 ). In summary, gene editing and knockout of GmAGO5 in soybean can reduce soybean plant height and branch angle while increasing the protein content of soybean seeds, creating genetic resources for ideal plant type design breeding and cultivating high-yield, high-quality and adaptable soybeans.

Claims

1. A cultivated soybean GmAGO5 protein encoding gene GmAGO5, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the gene GmAGO5 according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

3. The gene editing knockout vector of the cultivated soybean GmAGO5 protein encoding gene GmAGO5 according to claim 1.

4. Use of the cultivated soybean GmAGO5 protein encoding gene GmAGO5 according to claim 1 in improving the plant type and quality of gene-edited plants.

5. The use according to claim 4, characterized in that: Inhibiting the expression of the GmAGO5 protein-encoding gene GmAGO5 in cultivated soybeans can reduce soybean plant height, reduce branch angles, and increase soybean protein content, thereby improving the application of gene-edited plant type and quality.

6. Use of the gene editing knockout vector according to claim 3 in reducing soybean plant height, reducing branch angle, and increasing soybean protein content.

Images