CRISPR / dCas9 vector for improving yield of lactyl-N-tetrasaccharide of bacillus subtilis as well as construction method and application of CRISPR / dCas9 vector

By constructing the CRISPR/dCas9 vector in Bacillus subtilis, inhibiting the expression of zwf gene, the problem of competing pathways in the synthetic pathway limiting the production of lacticyl-N-tetrasaccharides was solved, and a significant increase in the production of lacticyl-N-tetrasaccharides was achieved.

CN120099057APending Publication Date: 2025-06-06TIANJIN UNIV OF SCI & TECH
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510124852.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-26
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

In the prior art, when Bacillus subtilis produces lacticyl-N-tetrasaccharide, the production of lacticyl-N-tetrasaccharide is limited due to competitive pathways in the synthetic pathway. How to properly regulate metabolic flow to increase yield is an urgent problem.

Method used

The CRISPR/dCas9 vector construction method was used to design specific sgRNAs to inhibit the zwf gene expression in the pentose phosphate pathway, and the xylose-induced CRISPRi system was used to weaken the metabolic flow of the competitive pathway, thereby increasing the production of lactoyl-N-tetrasaccharide.

Benefits of technology

Through this method, a significant increase in the yield of lacticyl-N-tetrasaccharides was obtained, and the lacticyl-N-tetrasaccharide fermentation yield of the BDZP1 strain was 31% higher than that of the control strain BDP1, reaching 7.25 g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099057A_ABST
    Figure CN120099057A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology and genetic engineering, and discloses a CRISPR / dCas9 vector for improving the yield of lactyl-N-tetrasaccharide of bacillus subtilis as well as a construction method and application of the CRISPR / dCas9 vector, and a CRISPR / dCas9 system is applied to production of lactyl-N-tetrasaccharide from bacillus subtilis 168 for the first time. According to the invention, pW-dcas9, pW-sgRNA and pW-sgRNA-zwf recombinant vectors are constructed, the transcriptional level of the zwf gene in a phosphopentose pathway is significantly reduced by 11.32 times by using a CRISPR / dCas9 system induced by xylose, and the metabolic flux of a competitive pathway is weakened. The yield of the lactyl-N-tetrasaccharide of the engineering strain obtained by the invention is greatly improved by 31% and reaches 7.25 g / l. Meanwhile, an effective method is provided for lowering metabolic flows of a cell wall competitive pathway and a glycolysis competitive pathway in a later period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of biochemistry, molecular biology and genetic engineering, and in particular to a CRISPR / dCas9 vector for improving the yield of lactoyl-N-tetraose in Bacillus subtilis, and a construction method and application thereof. Background Art

[0002] Breast milk is generally considered to be the most important source of nutrition for infants. In addition to providing the nutrients required for normal growth of infants, it also contains thousands of biologically active substances. Human milk oligosaccharides (HMOs) are the third largest solid component in breast milk after lactose and fat. The content in mature milk is 12-13 g / L, and in colostrum it can reach 22-23 g / L, which is unmatched by cow's milk (cow's milk oligosaccharides <1 g / L). HMOs can withstand hydrolysis by enzymes in the infant's digestive tract, thereby resisting infection by gastrointestinal pathogens and maintaining the balance of gastrointestinal microecology. Lactoyl-N-tetraose plays a vital role in the health and development of infants, including prebiotic effects, anti-adhesion antibiotics, antiviral protection and immunomodulators. In view of the important biological functions and physiological activities of lactoyl-N-tetraose, it has been approved by the European Food Safety Authority (EFSA), the European Union (EU) and the US Food and Drug Administration (FDA) to be added to infant formula as a nutritional fortifier. However, the amount obtained by isolating and extracting from natural products is very small, far from the needs of research, so obtaining this type of compound through artificial synthesis becomes the best choice. At present, the commercial production of LNT mainly includes two methods: chemical synthesis and biosynthesis. Among them, the biosynthesis method only requires cheap carbon sources and renewable donors in cells as raw materials, and obtains high economic output at a lower environmental cost, so it has a broader application prospect.

[0003] Bacillus subtilis 168 is certified as a safe microorganism (Generally Recognized as Safe, GRAS) by the U.S. Food and Drug Administration (FDA) and can be used as a food safety-grade strain. Its own metabolic pathways include the synthesis pathways of uridine diphosphate galactose and uridine diphosphate acetylglucosamine, and these two substances can be used as substrates to participate in the synthesis of lactoyl-N-tetraose. Therefore, the use of metabolic engineering methods to construct Bacillus subtilis engineered bacteria is an effective strategy for producing lactoyl-N-tetraose. However, due to the presence of various competitive pathways in the synthesis pathway, such as the cell wall competition pathway, the glycolysis pathway (EMP) and the pentose phosphate pathway (HMP), the synthesis of the final yield is limited. How to appropriately downregulate the metabolic flow of the cell wall competition pathway and reduce the ratio of glucose-6-phosphate required in the cell growth pathway to achieve a balance between the metabolic flow of product synthesis and cell growth is an urgent problem to be solved. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose in Bacillus subtilis and a construction method and application thereof.

[0005] The technical solution adopted by the present invention to solve the technical problem is:

[0006] A method for constructing a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose in Bacillus subtilis comprises the following steps:

[0007] a. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-F and kan-R to obtain fragment 1;

[0008] The nucleotide sequence of the primer ori-F is shown in SEQ ID NO.1, and the nucleotide sequence of the primer kan-R is shown in SEQ ID NO.2;

[0009] b. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-UP-F and aprE-UP-F to obtain fragment 2;

[0010] The nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.3, and the nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.4;

[0011] c. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-DN-F and aprE-DN-F to obtain fragment 3;

[0012] The nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.5, and the nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.6;

[0013] d. Using pJMP1 as a vector, double digestion with restriction endonuclease SmaI was performed to obtain fragment 4;

[0014] e. The fragment 1 obtained in step a, the fragment 2 obtained in step b, the fragment 3 obtained in step c and the fragment 4 obtained in step d were used to construct the vector pW-dcas9 by Seamless Cloning Kit.

[0015] A Bacillus subtilis containing the above-mentioned vector, wherein the construction method of the Bacillus subtilis comprises the following steps:

[0016] The vectors were linearized by ApaI digestion, and the linearized vectors were chemically transformed into B. subtilis 168. Positive clones were screened using LB plates containing erythromycin resistance. An appropriate amount of transformants were picked for colony PCR to verify that dcas9 was integrated into the B. subtilis 168 genome, and BD1 bacteria were obtained, which was Bacillus subtilis containing the vector.

[0017] Furthermore, the method for constructing the Bacillus subtilis also includes the following steps:

[0018] The linearized pW-sgRNA-zwf recombinant plasmid was chemically transformed into BD1 bacteria, and positive clones were screened using LB plates containing tetracycline resistance. Transformants were picked for colony PCR to verify that sgRNA-zwf was integrated into the BD1 bacterial genome, and BDZ1 bacteria were obtained, which was Bacillus subtilis containing the vector;

[0019] Among them, the construction method of the linearized pW-sgRNA-zwf recombinant plasmid comprises the following steps:

[0020] Taking the pW-sgRNA recombinant plasmid as the starting vector, first, pW-sgRNA was digested with restriction endonuclease BsaI, and then the vector was recovered; then the zwf-N20 fragment and the pW-sgRNA vector digested with BsaI were connected at 25°C for 1 hour under the condition of adding T4 DNA ligase, and the zwf-N20 fragment was inserted into the digested pW-sgRNA vector; the ligation product was transformed into DH5α competent cells and screened with a plate; the LB plate containing kanamycin was used for screening; the correctness of the plasmid was verified by colony PCR, XhoI / XbaI double digestion, and sequencing using primers zwf-N20-2F and pW-sgRNA-R, and the pW-sgRNA-zwf recombinant plasmid was obtained, which contained sgRNA specifically targeting the zwf gene;

[0021] The construction method of the pW-sgRNA recombinant plasmid comprises the following steps:

[0022] f. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-2F and kan-2R to obtain fragment 5;

[0023] The nucleotide sequence of the primer ori-2F is shown in SEQ ID NO.7, and the nucleotide sequence of the primer kan-2R is shown in SEQ ID NO.8;

[0024] g. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-UP-F and srfAC-UP-F to obtain fragment 6;

[0025] The nucleotide sequence of the primer srfAC-UP-F is shown in SEQ ID NO.9, and the nucleotide sequence of the primer srfAC-UP-R is shown in SEQ ID NO.10;

[0026] h. Using the pJOE8999 vector as a template, PCR amplification was performed using primers sgRNA-F and sgRNA-R to obtain fragment 7;

[0027] The nucleotide sequence of the primer sgRNA-F is shown in SEQ ID NO.11, and the nucleotide sequence of the primer sgRNA-R is shown in SEQ ID NO.12;

[0028] i. Using pWH1520 vector as template, PCR amplification was performed using primers TCR-F and TCR-R to obtain fragment 8;

[0029] The nucleotide sequence of the primer TCR-F is shown in SEQ ID NO.13, and the nucleotide sequence of the primer TCR-R is shown in SEQ ID NO.14;

[0030] j. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-DN-F and srfAC-DN-F to obtain fragment 9;

[0031] The nucleotide sequence of the primer srfAC-DN-F is shown in SEQ ID NO.15, and the nucleotide sequence of the primer srfAC-DN-R is shown in SEQ ID NO.16;

[0032] The fragment 5 obtained in step f, the fragment 6 obtained in step g, the fragment 7 obtained in step h, the fragment 8 obtained in step i and the fragment 9 obtained in step j were used to construct the vector pW-sgRNA.

[0033] A recombinant Bacillus subtilis synthesizing lactoyl-N-tetraose obtained by using the Bacillus subtilis as described above, wherein the recombinant Bacillus subtilis is BDP1 or BDZP1; the BDP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BD1 bacterium; the BDZP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BDZ1 bacterium.

[0034] Furthermore, the construction method of the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid comprises the following steps:

[0035] According to the β-1,3-galactosyltransferase gene (WP_008952439.1) in Pseudogulbenkiania ferrooxidans published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.19 was synthesized; using the synthesized β-1,3-galactosyltransferase gene as a template, PCR amplification was performed using primers pf-F and pf-R to obtain fragment 10; according to the β-1,3-N-acetylglucosaminyltransferase gene (WP_029769400.1) in Neisseria polysaccharea published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.20 was synthesized; using the synthesized β-1,3-N-acetylglucosaminyltransferase gene as a template, PCR amplification was performed using primers nplgtA-F and nplgtA-R to obtain fragment 11; according to the Escherichia coli published on NCBI, coliK12) was encoded by Bacillus subtilis and the codons were optimized to synthesize the gene sequence shown in SEQ ID NO.21; the synthesized lactose permease gene was used as a template and primers lacY-F and lacY-R were used to perform PCR amplification to obtain fragment 12; the plasmid pHT01 was digested with restriction endonuclease BamHI, and the vector was recovered using a purification recovery kit;

[0036] Fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment were assembled. The specific process was as follows: in a 20 μl reaction system, four fragments 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragments with overlapping sequences were mixed, and the molar ratio of fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment was 1:1:1:3. Then 10 μl of 2XSeamless Cloning Mix was added and made up to 20 μl with water. After the reaction was completed at 50°C for 45 min, the reaction product was placed on ice for 5 min, and 5 μl was taken to transform into 100 μl DH5α competent bacteria; LB plates containing ampicillin were used for screening; primers pH-F / pH-R were used to verify the correctness of the plasmid through colony PCR, KpnI / XbaI double enzyme digestion, and sequencing to obtain the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid.

[0037] The method for producing lactoyl-N-tetraose by fermentation using the recombinant Bacillus subtilis as described above comprises the following steps:

[0038] For the fermentation culture of recombinant Bacillus subtilis, 15 g / L xylose inducer was added after 4.5 h to 7.5 h of culture to induce dCas9 expression, and cultured at 37°C and 220 rpm for 42 h to 48 h to obtain lactoyl-N-tetraose.

[0039] Furthermore, the fermentation medium used for the fermentation culture is: glucose 40-70 g / L, lactose 5-15 g / L, yeast extract 8-16 g / L, tryptone 5-10 g / L, (NH 4 ) 2 SO 4 5-10g / L, K 2 HPO 4 8.5g / L, KH 2 PO 4 2.5g / L, MgSO 4 7H 2 O3g / L, CaCl 2 0.15g / L, the trace element solution is prepared according to the mg / L ratio: MnSO 4 3.4mg, FeSO 4 .7H 2 O 28mg, ZnCl 2 7.0mg, solution is water.

[0040] The use of the recombinant Bacillus subtilis as described above in the fermentation production of lactoyl-N-tetraose.

[0041] Use of the CRISPR / dCas9 vector as described above in the fermentation production of lactoyl-N-tetraose.

[0042] The use of Bacillus subtilis as described above in the fermentation production of lactoyl-N-tetraose.

[0043] The advantages and positive effects achieved by the present invention are:

[0044] 1. The present invention provides a method for increasing the yield of lactoyl-N-tetraose (LNT) by inhibiting gene expression using CRISPR / dCas9; in particular, it provides a method for inhibiting the expression of the zwf gene in the pentose phosphate pathway to a suitable level by using a xylose-induced CRISPRi (CRISPR interference) system, thereby weakening the metabolic flow of the competing pathway and increasing the yield of lactoyl-N-tetraose.

[0045] The present invention applies the CRISPR / dCas9 system to the production of lactoyl-N-tetraose by Bacillus subtilis 168 for the first time, and constructs pW-dcas9 recombinant vectors, pW-sgRNA recombinant vectors and pW-sgRNA-zwf recombinant vectors. It relates to a xylose-induced CRISPRi (CRISPR interference) system that inhibits the expression of the zwf gene in the pentose phosphate pathway to a suitable level, weakens the metabolic flow of the competitive pathway, and the lactoyl-N-tetraose production of the engineered strain obtained by the present invention is greatly improved. The lactoyl-N-tetraose fermentation yield of the engineered strain BDZP1 obtained by the present invention is 31% higher than that of the BDP1 bacteria, reaching 7.25g / L.

[0046] 2. The precursor synthesis pathway of lactoyl-N-tetraose competes with the cell wall competition pathway, glycolysis pathway (EMP) and pentose phosphate pathway (HMP). Although the metabolic flow of the competitive pathway can be weakened by directly knocking out genes such as pfkA, zwf, and murAA, this strategy will inhibit cell growth and lead to a decrease in the yield of the target product. Therefore, CRISPRi technology can fine-tune the metabolic flow by downregulating the expression level of genes by constructing a CRISPRi system in cells, thereby increasing the yield of lactoyl-N-tetraose.

[0047] The present invention applies the CRISPR / dCas9 system to the production of lactoyl-N-tetraose by Bacillus subtilis 168 for the first time, and involves a CRISPRi system induced by xylose to inhibit the expression of the zwf gene in the pentose phosphate pathway to an appropriate level, weakening the metabolic flux of the competitive pathway. The lactoyl-N-tetraose yield of the engineered strain obtained by the present invention is greatly increased. At the same time, it provides an effective method for later down-regulating the metabolic flux of the cell wall competitive pathway and reducing the glucose-6-phosphate ratio required in the cell growth pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The diagrams are of the pW-dcas9 recombinant plasmid and the pW-sgRNA recombinant plasmid constructed in the present invention;

[0049] Figure 2 The maps of the pW-sgRNA-zwf recombinant plasmid and pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid constructed in the present invention;

[0050] Figure 3 This is a comparison chart of zwf gene expression levels in BDP1 and BOZP1 of the present invention;

[0051] Figure 4 This is a comparison chart of the lactoyl-N-tetraose yields of BDP1 and BOZP1 in the present invention. DETAILED DESCRIPTION

[0052] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0053] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0054] A method for constructing a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose in Bacillus subtilis comprises the following steps:

[0055] k. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-F and kan-R to obtain fragment 1;

[0056] The nucleotide sequence of the primer ori-F is shown in SEQ ID NO.1, and the nucleotide sequence of the primer kan-R is shown in SEQ ID NO.2;

[0057] l. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-UP-F and aprE-UP-F to obtain fragment 2;

[0058] The nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.3, and the nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.4;

[0059] m. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-DN-F and aprE-DN-F to obtain fragment 3;

[0060] The nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.5, and the nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.6;

[0061] n. pJMP1 was used as a vector and double digested with restriction endonuclease SmaI to obtain fragment 4;

[0062] o. Fragment 1 obtained in step a, fragment 2 obtained in step b, fragment 3 obtained in step c and fragment 4 obtained in step d were used to construct vector pW-dcas9 using a Seamless Cloning Kit.

[0063] A Bacillus subtilis containing the above-mentioned vector, wherein the construction method of the Bacillus subtilis comprises the following steps:

[0064] The vectors were linearized by ApaI digestion, and the linearized vectors were chemically transformed into B. subtilis 168. Positive clones were screened using LB plates containing erythromycin resistance. An appropriate amount of transformants were picked for colony PCR to verify that dcas9 was integrated into the B. subtilis 168 genome, and BD1 bacteria were obtained, which was Bacillus subtilis containing the vector.

[0065] Preferably, the method for constructing Bacillus subtilis further comprises the following steps:

[0066] The linearized pW-sgRNA-zwf recombinant plasmid was chemically transformed into BD1 bacteria, and positive clones were screened using LB plates containing tetracycline resistance. Transformants were picked for colony PCR to verify that sgRNA-zwf was integrated into the BD1 bacterial genome, and BDZ1 bacteria were obtained, which was Bacillus subtilis containing the vector;

[0067] Among them, the construction method of the linearized pW-sgRNA-zwf recombinant plasmid comprises the following steps:

[0068] Taking the pW-sgRNA recombinant plasmid as the starting vector, first, pW-sgRNA was digested with restriction endonuclease BsaI, and then the vector was recovered; then the zwf-N20 fragment and the pW-sgRNA vector digested with BsaI were connected at 25°C for 1 hour under the condition of adding T4 DNA ligase, and the zwf-N20 fragment was inserted into the digested pW-sgRNA vector; the ligation product was transformed into DH5α competent cells and screened with a plate; the LB plate containing kanamycin was used for screening; the correctness of the plasmid was verified by colony PCR, XhoI / XbaI double digestion, and sequencing using primers zwf-N20-2F and pW-sgRNA-R, and the pW-sgRNA-zwf recombinant plasmid was obtained, which contained sgRNA specifically targeting the zwf gene;

[0069] The construction method of the pW-sgRNA recombinant plasmid comprises the following steps:

[0070] p. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-2F and kan-2R to obtain fragment 5;

[0071] The nucleotide sequence of the primer ori-2F is shown in SEQ ID NO.7, and the nucleotide sequence of the primer kan-2R is shown in SEQ ID NO.8;

[0072] q. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-UP-F and srfAC-UP-F to obtain fragment 6;

[0073] The nucleotide sequence of the primer srfAC-UP-F is shown in SEQ ID NO.9, and the nucleotide sequence of the primer srfAC-UP-R is shown in SEQ ID NO.10;

[0074] r. Using the pJOE8999 vector as a template, PCR amplification was performed using primers sgRNA-F and sgRNA-R to obtain fragment 7;

[0075] The nucleotide sequence of the primer sgRNA-F is shown in SEQ ID NO.11, and the nucleotide sequence of the primer sgRNA-R is shown in SEQ ID NO.12;

[0076] s. Using the pWH1520 vector as a template, PCR amplification was performed using primers TCR-F and TCR-R to obtain fragment 8;

[0077] The nucleotide sequence of the primer TCR-F is shown in SEQ ID NO.13, and the nucleotide sequence of the primer TCR-R is shown in SEQ ID NO.14;

[0078] t. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-DN-F and srfAC-DN-F to obtain fragment 9;

[0079] The nucleotide sequence of the primer srfAC-DN-F is shown in SEQ ID NO.15, and the nucleotide sequence of the primer srfAC-DN-R is shown in SEQ ID NO.16;

[0080] The fragment 5 obtained in step f, the fragment 6 obtained in step g, the fragment 7 obtained in step h, the fragment 8 obtained in step i and the fragment 9 obtained in step j were used to construct the vector pW-sgRNA.

[0081] A recombinant Bacillus subtilis synthesizing lactoyl-N-tetraose obtained by using the Bacillus subtilis as described above, wherein the recombinant Bacillus subtilis is BDP1 or BDZP1; the BDP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BD1 bacterium; the BDZP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BDZ1 bacterium.

[0082] Preferably, the method for constructing the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid comprises the following steps:

[0083] According to the β-1,3-galactosyltransferase gene (WP_008952439.1) in Pseudogulbenkiania ferrooxidans published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.19 was synthesized; using the synthesized β-1,3-galactosyltransferase gene as a template, PCR amplification was performed using primers pf-F and pf-R to obtain fragment 10; according to the β-1,3-N-acetylglucosaminyltransferase gene (WP_029769400.1) in Neisseria polysaccharea published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.20 was synthesized; using the synthesized β-1,3-N-acetylglucosaminyltransferase gene as a template, PCR amplification was performed using primers nplgtA-F and nplgtA-R to obtain fragment 11; according to the Escherichia coli published on NCBI, coliK12) was encoded by Bacillus subtilis and the codons were optimized to synthesize the gene sequence shown in SEQ ID NO.21; the synthesized lactose permease gene was used as a template and primers lacY-F and lacY-R were used to perform PCR amplification to obtain fragment 12; the plasmid pHT01 was digested with restriction endonuclease BamHI, and the vector was recovered using a purification recovery kit;

[0084] Fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment were assembled. The specific process was as follows: in a 20 μl reaction system, four fragments 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragments with overlapping sequences were mixed, and the molar ratio of fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment was 1:1:1:3. Then 10 μl of 2XSeamless Cloning Mix was added and made up to 20 μl with water. After the reaction was completed at 50°C for 45 min, the reaction product was placed on ice for 5 min, and 5 μl was taken to transform into 100 μl DH5α competent bacteria; LB plates containing ampicillin were used for screening; primers pH-F / pH-R were used to verify the correctness of the plasmid through colony PCR, KpnI / XbaI double enzyme digestion, and sequencing to obtain the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid.

[0085] The method for producing lactoyl-N-tetraose by fermentation using the recombinant Bacillus subtilis as described above comprises the following steps:

[0086] For the fermentation culture of recombinant Bacillus subtilis, 15 g / L xylose inducer was added after 4.5 h to 7.5 h of culture to induce dCas9 expression, and cultured at 37°C and 220 rpm for 42 h to 48 h to obtain lactoyl-N-tetraose.

[0087] Preferably, the fermentation medium used for fermentation culture is: glucose 40-70g / L, lactose 5-15g / L, yeast extract 8-16g / L, tryptone 5-10g / L, (NH 4 ) 2 SO 4 5-10g / L, K 2 HPO 4 8.5g / L, KH 2 PO 4 2.5g / L, MgSO 4 7H 2 O3g / L, CaCl 2 0.15g / L, the trace element solution is prepared according to the mg / L ratio: MnSO 4 3.4mg, FeSO 4 .7H 2 O 28mg, ZnCl 2 7.0mg, solution is water.

[0088] The use of the recombinant Bacillus subtilis as described above in the fermentation production of lactoyl-N-tetraose.

[0089] Use of the CRISPR / dCas9 vector as described above in the fermentation production of lactoyl-N-tetraose.

[0090] The use of Bacillus subtilis as described above in the fermentation production of lactoyl-N-tetraose.

[0091] Specifically, the relevant preparation and detection are as follows:

[0092] Example 1

[0093] This example is to prepare a recombinant vector for inhibiting the expression of the zwf gene in the pentose phosphate pathway to a suitable level and producing lactoyl-N-tetraose. Specifically, the following steps are included:

[0094] Step 1: Construction of recombinant plasmid pW-dcas9, such as Figure 1 The specific operations are as follows:

[0095] Using pJOE8999 vector as a template, primers ori-F and kan-R were used for PCR amplification to obtain fragment 1; using the genome of Bacillus subtilis 168 as a template, primers aprE-UP-F and aprE-UP-R were used for PCR amplification to obtain fragment 2; using pJMP1 as a vector, restriction endonuclease SmaI was used for double digestion to obtain fragment 3; using the genome of Bacillus subtilis 168 as a template, primers aprE-DN-F and aprE-DN-R were used for PCR amplification to obtain fragment 4; fragment 1, fragment 2, fragment 3 and fragment 4 were assembled using a Seamless Cloning Kit. The specific process is as follows: In a 20 μl reaction system, four fragments 1, 2, 3 and 4 with appropriate overlapping sequences are mixed, and the molar ratio of fragment 1, fragment 2, fragment 3 and fragment 4 is 1:1:3:1. Then 10 μl of 2X Seamless Cloning Mix is ​​added, and water is added to 20 μl. After the reaction is completed at 50°C for 45 minutes, the reaction product is placed on ice for 5 minutes, and 5 μl is taken to transform into 100 μl DH5α competent bacteria. Screening is performed using LB plates containing kanamycin. The transformants were subjected to colony PCR, ApaI / KpnI double digestion (two bands of 4640 bp and 6490 bp appeared in the correct transformants), and sequencing to verify the correctness of the plasmid using primers aprE-UP-2F / dcas9-R (the correct transformant had a band of 1605 bp) and primers dcas9-F / aprE-DN-2R (the correct transformant had a band of 1933 bp), and the correctness of the plasmid was obtained. The pW-dcas9 recombinant plasmid was obtained.

[0096] The nucleotide sequence of the primer ori-F is shown in SEQ ID NO.1, and the nucleotide sequence of the primer kan-R is shown in SEQ ID NO.2;

[0097] The nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.3, and the nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.4;

[0098] The nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.5, and the nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.6.

[0099] Step 2: Construction of recombinant plasmid pW-sgRNA, such as Figure 1 The specific operations are as follows:

[0100] Using the pJOE8999 vector as a template, primers ori-2F and kan-2R were used for PCR amplification to obtain fragment 5; using the Bacillus subtilis 168 genome as a template, primers srfAC-UP-F and srfAC-UP-R were used for PCR amplification to obtain fragment 6; using the pJOE8999 vector as a template, primers sgRNA-F and sgRNA-R were used for PCR amplification to obtain fragment 7; using the pWH1520 vector as a template, primers TCR-F and TCR-R were used for PCR amplification to obtain fragment 8; using the Bacillus subtilis 168 genome as a template, primers srfAC-DN-F and srfAC-DN-R were used for PCR amplification to obtain fragment 9; fragments 5, 6, 7, 8 and 9 were assembled using a Seamless Cloning Kit. The specific process is as follows: In a 20 μl reaction system, five fragments 5, 6, 7, 8 and 9 with appropriate overlapping sequences were mixed, and the molar ratio of fragments 5, 6, 7, 8 and 9 was 2:2:1:2:1, then 10 μl of 2X Seamless Cloning Mix was added, and the mixture was made up to 20 μl with water, and the reaction was carried out at 50°C for 60 min. After the reaction was completed, the reaction product was placed on ice for 5 min, and 5 μl was taken to transform into 100 μl of DH5α competent bacteria. Screening was performed using an LB plate containing kanamycin. The transformants were subjected to colony PCR, XhoI / XbaI double restriction digestion (the correct transformants had two bands, 2333bp and 4624bp, respectively), and sequencing to verify the correctness of the plasmid using primers srfAC-UP-2F / 'gRNA-R (the correct transformants had a band of 1120bp) and primers TCR-2F / srfAC-DN-2R (the correct transformants had a band of 1747bp), and the correctness of the plasmid was obtained by obtaining the pW-sgRNA recombinant plasmid.

[0101] The nucleotide sequence of the primer ori-2F is shown in SEQ ID NO.7, and the nucleotide sequence of the primer kan-2R is shown in SEQ ID NO.8;

[0102] The nucleotide sequence of the primer srfAC-UP-F is shown in SEQ ID NO.9, and the nucleotide sequence of the primer srfAC-UP-R is shown in SEQ ID NO.10;

[0103] The nucleotide sequence of the primer sgRNA-F is shown in SEQ ID NO.11, and the nucleotide sequence of the primer sgRNA-R is shown in SEQ ID NO.12;

[0104] The nucleotide sequence of the primer TCR-F is shown in SEQ ID NO.13, and the nucleotide sequence of the primer TCR-R is shown in SEQ ID NO.14;

[0105] The nucleotide sequence of the primer srfAC-DN-F is shown in SEQ ID NO.15, and the nucleotide sequence of the primer srfAC-DN-R is shown in SEQ ID NO.16.

[0106] Step 3: Construction of recombinant plasmid pW-sgRNA-zwf, such as Figure 2 The specific operations are as follows:

[0107] First, the 20nt sequence of sgRNA targeting inhibition of zwf (sequence as shown in SEQ ID NO.17) was designed online using the website http: / / chopchop.cbu.uib.no / , as shown in SEQ ID NO.18; the zwf-N20 fragment was obtained by renaturation at 95°C using primers zwf-N20-F and zwf-N20-R.

[0108] The pW-sgRNA recombinant plasmid provided above was used as the starting vector. First, pW-sgRNA was digested with restriction endonuclease BsaI, and then the vector was recovered with a purification recovery kit; then the zwf-N20 fragment was connected to the pW-sgRNA vector digested with BsaI under the condition of adding T4DNA ligase at 25°C for 1h, and the zwf-N20 fragment was inserted into the digested pW-sgRNA vector. The ligation product was transformed into DH5α competent cells and screened with a plate. LB plates containing kanamycin were used for screening. The transformants were verified by colony PCR, XhoI / XbaI double digestion (the correct transformant had two bands, 2333bp and 4277bp, respectively), sequencing, and the correctness of the plasmid was obtained using primers zwf-N20-2F and pW-sgRNA-R (the correct transformant had a band of 361bp). This vector contains sgRNA that specifically targets the zwf gene.

[0109] Step 4: Construction of recombinant plasmid pHT01-pf-β-1,3-galT-nplgtA-lacY, such as Figure 2 The specific operations are as follows:

[0110] According to the β-1,3-galactosyltransferase gene (WP_008952439.1) in Pseudogulbenkiania ferrooxidans published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO. 19 was synthesized. Using the synthesized β-1,3-galactosyltransferase gene as a template, primers pf-F and pf-R were used for PCR amplification to obtain fragment 10; according to the β-1,3-N-acetylglucosaminyltransferase gene (WP_029769400.1) in Neisseria polysaccharea published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO. 20 was synthesized. Using the synthesized β-1,3-N-acetylglucosaminyltransferase gene as a template, PCR amplification was performed using primers nplgtA-F and nplgtA-R to obtain fragment 11; according to the lactose permease gene (Gene ID: 949083) in Escherichia coli K12 published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO. 21 was synthesized. Using the synthesized lactose permease gene as a template, PCR amplification was performed using primers lacY-F and lacY-R to obtain fragment 12; the plasmid pHT01 was digested with restriction endonuclease BamHI, and the vector was recovered using a purification recovery kit; fragments 10, 11, 12 and the linearized pHT01 plasmid fragment were assembled using a Seamless Cloning Kit. The specific process is as follows: In a 20 μl reaction system, four fragments 10, 11, 12 with appropriate overlapping sequences and the linearized pHT01 plasmid fragment were mixed, and the molar ratio of fragment 10, fragment 11, fragment 12 and the linearized pHT01 plasmid fragment was 1:1:1:3, and then 10 μl of 2X Seamless Cloning Mix was added, and the mixture was made up to 20 μl with water. After the reaction was completed at 50°C for 45 minutes, the reaction product was placed on ice for 5 minutes, and 5 μl was taken to transform into 100 μl of DH5α competent bacteria. Screening was performed using an LB plate containing ampicillin. The transformant was verified for its correctness by colony PCR using primers pH-F / pH-R (the correct transformant band was 3596 bp), EcoRV / SaII double enzyme digestion (the correct transformant had two bands, 4845 bp and 6352 bp, respectively), and sequencing to obtain the recombinant plasmid pHT01-pf-β-1,3-galT-nplgtA-lacY.

[0111] The PCR system and conditions used in the preparation of gene fragments in Example 1 are:

[0112] PCR reaction system: DNA template 30ng, primer 20pmol, 50% DMSO 5μL, dNTP 10nmol, buffer 25μL, Taq DNA polymerase 1 unit, add pure water to make up to 50μL;

[0113] PCR conditions: 95℃5min; 95℃15s; 60℃15s; 72℃30s-2min; 30 cycles; 72℃10min.

[0114] The colony PCR system and conditions used in the PCR verification and screening of mutants in Example 1 are as follows:

[0115] PCR system: DNA template 10-100 ng, primer 10 pmol, 50% DMSO 2 μL, 2×Mix buffer 10 μL, add pure water to make up to 20 μL;

[0116] PCR conditions: 95°C for 10 min; 95°C for 30 s; 60°C for 30 s; 72°C for 30 s-2 min; 30 cycles; 72°C for 10 min.

[0117] The system and conditions used in preparing the zwf-N20 fragment in Example 1 are:

[0118] zwf-N20 fragment preparation system: 5× Buffer (DNA annealing buffer) 10 μL, upstream primer (N20-F) 10 μL, downstream primer (N20-R) 10 μL, ddH2O 20 μL;

[0119] Preparation conditions of zwf-N20 fragment: renaturation in a 95°C metal bath for 2 minutes; after the metal bath is turned off, react for 50 minutes.

[0120] The N20 fragment was used after being diluted 50 times.

[0121] T4 ligation reaction system and conditions in Example 1:

[0122] T4 ligation reaction system: vector 3μL, N20 fragment 1μL, 5×T4DNA Ligase Buffer 2μL, T4DNALigase 1μL, ddH2O 3μL.

[0123] T4 ligation reaction conditions: incubate at 25°C for 1 hour.

[0124] The primer sequences used in Example 1 are shown in Table 1:

[0125] Table 1 is a list of primer sequences used in Example 1

[0126]

[0127]

[0128] Example 2

[0129] This example provides the construction of a recombinant Bacillus subtilis containing the pW-dcas9 recombinant plasmid and the pW-sgRNA-zwf recombinant plasmid and a production strain thereof for producing lactoyl-N-tetraose. The specific steps are as follows:

[0130] Step 1: Introduce the pW-dcas9 recombinant plasmid into B. subtilis 168. The specific steps are as follows:

[0131] The pW-dcas9 recombinant plasmid was digested with restriction endonuclease ApaI, and the vector was recovered using a purification recovery kit; the linearized pW-dcas9 recombinant plasmid was transferred into Bacillus subtilis 168, and the specific method was as follows:

[0132] (1) Streak the strain onto an LB plate and culture at 37°C overnight;

[0133] (2) Add 4 mL of LB to a sterilized test tube, pick a single colony, and culture overnight at 37°C and 200 rpm in a shaking incubator.

[0134] (3) Add 2.5 mL of SPI medium to the test tube, transfer 100 μL of the above bacterial solution to the test tube, and culture at 37°C for 2.5 h. Measure the OD600 to be 1.1-1.3;

[0135] (4) Add 2 mL of SPII medium to the test tube, transfer 200 μL of bacterial solution to the test tube, and culture at 37°C for 1.5 h;

[0136] (5) Add 20 μL 10 mM EGTA and culture at 37 °C in a shaker at 100 rpm for 1.5 h;

[0137] (6) Add plasmid and culture at 37°C, 100 rpm, for 1 h.

[0138] (7) Adjust the speed to 220 r / min and incubate for 1.5 h;

[0139] (8) Take 100 μl of bacterial solution and spread it on LB plate containing erythromycin (10 μg / ml);

[0140] (9) Place the plate in a 37°C incubator and culture overnight.

[0141] An appropriate amount of transformants were selected for colony PCR verification, and the correct transformant band was 9167 bp using primers aprE-F and aprE-R. dcas9 was verified to be integrated into the B. subtilis 168 genome, and BD1 bacteria were obtained.

[0142] Step 2: Introduce the pW-sgRNA-zwf recombinant plasmid into BD1 bacteria. The specific steps are as follows:

[0143] The pW-sgRNA-zwf recombinant plasmid was digested with restriction endonuclease ApaI, and the vector was recovered using a purification recovery kit; the linearized pW-sgRNA-zwf recombinant plasmid was transformed into BD1 bacteria, and the specific method was the same as above, except that the plate was plated on an LB plate containing tetracycline (10 μg / ml);

[0144] An appropriate amount of transformants were selected for colony PCR verification, using primers srfAC-F / srfAC-R, and the correct transformant band was 5067bp. Verify that sgRNA-ZWF was integrated into the BD1 bacterial genome, and obtain BDZ1 bacteria.

[0145] Step 3: Introduce the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into BD1 and BDZ1 bacteria. The specific chemical transformation method is the same as above, and plate on LB plates containing chloramphenicol (5 μg / ml);

[0146] Pick an appropriate amount of transformants for colony PCR verification, using primers pH-F / pH-R, the correct transformant band is 3596bp. Verify that the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid was transferred into BD1 bacteria, and the correct transformant band is 3596bp. Obtain BDP1; transfer into BDZ1 bacteria to obtain BDZP1. Sp medium: weigh 18.34g / LK 2 HPO 4 , 6g / LKH 2 PO 4 , 2g / L(NH 4 ) 2 SO 4 、0.2g / L MgSO 4 7H 2 O, 1g / L sodium citrate, the solvent is water. Sterilize at 121℃ for 20min.

[0147] Separate configuration: 50g / L casein hydrolysate, 100g / L yeast extract, 500g / L glucose, 106.2g / LMgCl 2 6H 2 O, 147g / L CaCl 2, the solvent is water. Sterilize at 121℃ for 20min. Used for subsequent experiments.

[0148] SpI medium: Under sterile conditions in a clean bench, aspirate 2.4 mL of 100 mL Sp medium and add 400 μL of casein hydrolysate, 1 mL of yeast extract, and 1 mL of glucose.

[0149] SpII medium: aspirate 1 mL of 100 mL SpI medium under sterile conditions in a clean bench and add 500 μL MgCl 2 6H 2 O, 500 μL CaCl 2 After preparation, store the SpI medium and SpII medium in a 4°C refrigerator for later use.

[0150] Ethylene glycol bis(2-aminoethyl ether) tetraacetic acid solution (EGTA solution): weigh 3.80 g of ethylene glycol bis(2-aminoethyl ether) tetraacetic acid and dissolve it into 1 L. After it is completely dissolved with distilled water, adjust the pH value to 8.0 with NaOH, filter it into a sterile 2 mL EP tube with a filter on a clean bench, and store it in a -20°C refrigerator for later use.

[0151] The primer sequences used in Example 2 are shown in Table 2:

[0152] Table 2 is a list of primer sequences used in Example 2

[0153] Primer name Primer sequences (SEQ ID NO.41-45) aprE-F AATGGTGGTTATACGCCTG aprE-R CGTGATTTTCCAAACGAGC srfAC-F TTTGATTCGTGCCGTGTCC srfAC-R GGAATTCACACCAAGCGAC

[0154] Example 3

[0155] This embodiment provides an application of a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose. The specific steps are as follows:

[0156] Step 1: A xylose-inducible CRISPRi system was used to inhibit the expression of the zwf gene in the pentose phosphate pathway to an appropriate level for analysis, such as Figure 3 The specific method is as follows:

[0157] The total RNA of BDP1 and BDZP1 was extracted using a bacterial RNA extraction kit (omege), specifically: BDP1 and BDZP1 were fermented and cultured at 37°C, 220rpm, and 48h. After 4.5h-7.5h of culture, 15g / L xylose inducer was added to induce dcas9 expression, and RNA was extracted 3h after adding xylose inducer. The RNA concentration was determined and adjusted to the same concentration with DEPC water, and cDNA was obtained by reverse transcription using a reverse transcription kit (TakaRa). Fluorescence quantitative PCR primers for hbsU and zwf genes were designed (see Table 3 for specific sequences), and fluorescence quantitative PCR identification was performed, with hbsU as the internal reference.

[0158] The transcription levels of the zwf gene in the BDZP1 strain and the control strain BDP1 were further evaluated by RT-qPCR. Figure 3 As shown, compared with the control strain BDP1, the transcription level of the zwf gene in the BDZP1 strain was significantly reduced by 11.32 times, and the transcription of the target gene was effectively inhibited by binding of sgRNA to the dCas9 protein. This shows that the CRISPR / dCas9 system disclosed in the present invention can specifically target genes on Bacillus subtilis 168 and simultaneously downregulate the gene to a suitable level. At the same time, the CRISPR / dCas9 system is used to inhibit the expression of the zwf gene in the pentose phosphate pathway to a suitable level, weakening the metabolic flow of the competitive pathway, verifying the feasibility of the CRISPR / dCas9 system.

[0159] Step 2: Provide the application of CRISPR / dCas9 system in the fermentation production of lactoyl-N-tetraose by recombinant Bacillus subtilis, such as Figure 4 , the specific method is as follows:

[0160] For the fermentation culture of BDP1 and BDZP1, the culture conditions were: 37°C, 220rpm, 48h. After 4.5h-7.5h of culture, 15g / L xylose inducer was added to induce dcas9 expression. After 42h-48h of culture at 37°C, 1mL of fermentation broth was centrifuged, and the supernatant was boiled for 10min and centrifuged again. After the supernatant was diluted 5 times, the amount of lactoyl-N-tetraose was detected by a high performance liquid chromatograph with a differential refractive index detector.

[0161] like Figure 4 As shown, the LNT content of the control strain BDP1 was 5.53 g / L, and the LNT content of the strain BDZP1 in which the expression of the zwf gene was inhibited was 7.25 g / L. Compared with the control strain BDP1, the LNT yield of the strain BDZP1 in which the expression of the zwf gene was inhibited was significantly increased by 31%. These results indicate that in the BDZP1 strain, the metabolic flux of glucose in the EMP synthesis module was more diverted to the LNT synthesis module due to the reduction in the expression level of key genes. This indicates that appropriately downregulating the metabolic flux of the EMP competition pathway to achieve a balance between the metabolic flux of product synthesis and cell growth is an effective strategy to increase the LNT yield of Bacillus subtilis 168.

[0162] The fermentation medium is: glucose 40-70g / L, lactose 5-15g / L, yeast extract 8-16g / L, tryptone 5-10g / L, (NH 4 ) 2 SO 4 5-10g / L, K 2 HPO4 8.5g / L, KH 2 PO 4 2.5g / L, MgSO 4 7H 2 O 3g / L, CaCl 2 0.15g / L, the trace element solution is prepared according to the mg / L ratio: MnSO 4 3.4mg, FeSO 4 .7H 2 O 28mg, ZnCl 2 7.0mg, solution is water.

[0163] The primer sequences used in Example 3 are shown in Table 3:

[0164] Table 3 is a list of primer sequences used in Example 3

[0165] Primer name Primer sequences (SEQ ID NO.46-49) hbsU-F ATCGGTTTTGGTAACTTCGAGG hbsU-R GCAGGTACTTTGCTTGCTGGA zwf-F CAGCACACGCACAGCCAATC zwf-R GCATCGCCAAGAAGACAGTCG

[0166] The currently reported yield of LNT produced by Bacillus subtilis 168 is only 1.082 g / L, which cannot meet the requirements of industrial large-scale production. Therefore, in order to solve the current bottleneck of microbial production, it is very necessary to create a more efficient production strain.

[0167] The yield of the control strain BDP1 of the present invention is 5.53 g / L, and the LNT content of the strain BDZP1 in which the expression of the zwf gene is inhibited is 7.25 g / L. Compared with the currently reported yield of LNT produced by Bacillus subtilis 168, it is significantly improved. At the same time, the present invention provides a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose in Bacillus subtilis, and a construction method and application thereof. The present invention applies the CRISPR / dCas9 system to the production of lactoyl-N-tetraose by Bacillus subtilis 168 for the first time, and constructs a pW-dcas9 recombinant vector, a pW-sgRNA recombinant vector, and a pW-sgRNA-zwf recombinant vector. It involves a CRISPRi (CRISPR interference) system induced by xylose to inhibit the expression of the zwf gene in the pentose phosphate pathway to a suitable level, weaken the metabolic flow of the competitive pathway, and the lactoyl-N-tetraose yield of the engineered strain obtained by the present invention is greatly improved. The lactoyl-N-tetraose fermentation yield of the engineered strain BDZP1 obtained by the present invention is 31% higher than that of the BDP1 strain, reaching 7.25 g / l, and at the same time provides an effective method for later down-regulating the metabolic flow of the cell wall competition pathway and reducing the glucose-6-phosphate ratio required in the cell growth pathway.

[0168] The sequence of the present invention is as follows:

[0169] SEQ ID NO.1ori-F

[0170] CAAGTTTGTTCAGCGTCGTATGTCATGACATTGGTGTACAG

[0171] SEQ ID NO.2kan-R

[0172] AGGGAGGAAGAAATAAGATGCCCGGGTGTGATAACTCGGCGTATG

[0173] SEQ ID NO.3aprE-UP-F

[0174] ACATACGCCGAGTTATCACACCCGGGCATCTTATTTCTTCCTCCCTCTC

[0175] SEQ ID NO.4aprE-UP-R

[0176] GTGTTACCCCTATAAGTTAGGAGCTCAAAGTAAGCACGCCGGCAGCAGCCGGCTTTTTT

[0177] TCTGCAATATAATGATGCGCTTGGCG

[0178] SEQ ID NO.5aprE-DN-F

[0179] AGAGGTCCCTAGACTCTAGAAAAGTAAGCACGCCGGCAGCAGCCGGCTTTTTTTCTGCA

[0180] GTAAAAGTGCTTGATTCAACAGG

[0181] SEQ ID NO.6aprE-DN-R

[0182] TGTACACCAATGTCATGACATACGACGCTGAACAAACTTG

[0183] SEQ ID NO.7ori-2F

[0184] AAACCGTAACGGTTTCATAAGGTACCTGTCATGACATTGGTGTACAG

[0185] SEQ ID NO.8kan-2R

[0186] TCCTTGCTAAATTGACTCATACTAGTTGTGATAACTCGGCGTATG

[0187] SEQ ID NO.9srfAC-UP-F

[0188] ACATACGCCGAGTTATCACAACTAGTATGAGTCAATTTAGCAAGGATC

[0189] SEQ ID NO.10srfAC-UP-R

[0190] GGGAGAAAACATAGGGGGGTTCTAGATTCTCTCTCCCTGTCGTC

[0191] SEQ ID NO.11 sgRNA-F

[0192] TTGACGACAGGGAGAGAGAATCTAGAACCCCCCTATGTTTTCTCCCC

[0193] SEQ ID NO.12 sgRNA-R

[0194] CGGCTTTTTCGTCATCATCTAAAGGCCTTATTGGCCCGG

[0195] SEQ ID NO.13 TCR-F

[0196] CCCGGGCCAATAAGGCCTTTAGATGATGACGAAAAAGCCG

[0197] SEQ ID NO.14 TCR-R

[0198] ATCTTTCACACCTGGGTATTGCTAGCCACATTTCCCCGAAAAGTGC

[0199] SEQ ID NO.15 srfAC-DN-F

[0200] GCACTTTTCGGGGAAATGTGGCTAGCAATACCCAGGTGTGAAAGATGC

[0201] SEQ ID NO.16 srfAC-DN-R

[0202] TGTACACCAATGTCATGACAGGTACCTTATGAAACCGTTACGGTTTGTG

[0203] SEQ ID NO.17 zwf

[0204]

[0205] SEQ ID NO.18 zwf-N20

[0206] AATCGGAGAAGAGTTTGCAG

[0207] SEQ ID NO.19pf-β-1,3-galT

[0208] ATGGATAAAATTAAACAAGGCTCAACACATCACTGGTTGTTGGCGATCAAAAAAACATCCGGTTGTTTCAGTTCTGCTGCCGGTTAATAGAGTTGATAGATTTTTTTCCGGCAGTTGAATTCGACAAACACTGCAAGATTGAACTGATTCAATTCAAATGGACAACATCAATTCATTCGATTGATTGAATTCGACAAACACTGATCATTCGATTGATTGATTGAATCAATGAAACATCCATGGTTGTTTCAGTTGCTGCCG CTGACATATGGCGATCATAATAGAGTTAGAATCTGAATACAAATTAAAGGCCTGCCGTTTGCACTGAATCTGGGCGTTCATAATGCAAGAGGCCTGTATATTGCAAGAATGGATGCAGATGATATTCAATTCCGGAAAGACTGGAAAAACAACTGAATACACTGGAACAAATAAATTAAGATTGAGGATTGATTGATTGATTGATTGCAAGAGGCCTGTATATTGCAAGAATTCGATCGGAACAAAATTAAGATTGAGGAGGATTGATTGATTGATTGAGCAAGATGCAAGGCTGTTATTGCAGATCACTGGAACAAAAGAAAGAGGAGGAGGATTGAGGATTGATTGATTGCAAGAGGCTGAAAGA GATTTTATTGATGAAAATGATCAGCAATTAGAAGGCAAATTTCCGGAACTGACAGATAAAGATCATAGAAGACTGCTGCCGCTGATTTGCTGCATTGCACATCCGACAGTTATGGTTAGAAAGAAATTTAATAAACTGGGCGGCTATTCATTTGGCTCATTTTCAGATTAAACTGGGCGGCTATTCATTTGGCTCATTTTCAGATTAAACTGGGCGGCTGATTGACTGATTGATTGAATTTGAATTAAA CTGCCGGAAGTTGAATTTTAGAATTCCGGAATCACTGCTGAAATATAGAAGACATGGAAACCAAGCAACACATCAAGCAAATATTAAAAAGATTAGAGCGTATAATTCAGCACTGAAAATTAGAACTGTTTCTGTCAAGAACTGAAATTTTATTGGCATTATTCTGCCGAAGAATGGGACACTGACTAACTAACT

[0209] SEQ ID NO.20pgtA

[0210]

[0211] SEQ ID NO.21lacY

[0212]

[0213] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A method for constructing a CRISPR / dCas9 vector for increasing the yield of lactoyl-N-tetraose in Bacillus subtilis, characterized in that: The steps include: a. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-F and kan-R to obtain fragment 1; The nucleotide sequence of the primer ori-F is shown in SEQ ID NO.1, and the nucleotide sequence of the primer kan-R is shown in SEQ ID NO.2; b. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-UP-F and aprE-UP-F to obtain fragment 2; The nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.3, and the nucleotide sequence of the primer aprE-UP-F is shown in SEQ ID NO.4; c. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers aprE-DN-F and aprE-DN-F to obtain fragment 3; The nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.5, and the nucleotide sequence of the primer aprE-DN-F is shown in SEQ ID NO.6; d. Using pJMP1 as a vector, double digestion with restriction endonuclease SmaI was performed to obtain fragment 4; e. The fragment 1 obtained in step a, the fragment 2 obtained in step b, the fragment 3 obtained in step c and the fragment 4 obtained in step d were used to construct the vector pW-dcas9 through a seamless cloning kit.

2. A Bacillus subtilis containing the vector according to claim 1, characterized in that: The construction method of the Bacillus subtilis comprises the following steps: The vectors were linearized by ApaI digestion, and the linearized vectors were chemically transformed into B. subtilis 168. Positive clones were screened using LB plates containing erythromycin resistance. An appropriate amount of transformants were picked for colony PCR to verify that dcas9 was integrated into the B. subtilis 168 genome, and BD1 bacteria were obtained, which was Bacillus subtilis containing the vector.

3. The Bacillus subtilis according to claim 2, characterized in that: The construction method of the Bacillus subtilis also includes the following steps: The linearized pW-sgRNA-zwf recombinant plasmid was chemically transformed into BD1 bacteria, and positive clones were screened using LB plates containing tetracycline resistance. Transformants were picked for colony PCR to verify that sgRNA-zwf was integrated into the BD1 bacterial genome, and BDZ1 bacteria were obtained, which was Bacillus subtilis containing the vector; Wherein, the construction method of the linearized pW-sgRNA-zwf recombinant plasmid comprises the following steps: Taking the pW-sgRNA recombinant plasmid as the starting vector, first, pW-sgRNA was digested with restriction endonuclease BsaI, and then the vector was recovered; then the zwf-N20 fragment and the pW-sgRNA vector digested with BsaI were connected at 25°C for 1 hour under the condition of adding T4 DNA ligase, and the zwf-N20 fragment was inserted into the digested pW-sgRNA vector; the ligation product was transformed into DH5α competent cells and screened with a plate; LB plates containing kanamycin were used for screening; primers zwf-N20-2F and pW-sgRNA-R were used to verify the correctness of the plasmid through colony PCR, XhoI / XbaI double digestion, and sequencing, and the pW-sgRNA-zwf recombinant plasmid was obtained, which contained sgRNA specifically targeting the zwf gene; The construction method of the pW-sgRNA recombinant plasmid comprises the following steps: f. Using the pJOE8999 vector as a template, PCR amplification was performed using primers ori-2F and kan-2R to obtain fragment 5; The nucleotide sequence of the primer ori-2F is shown in SEQ ID NO.7, and the nucleotide sequence of the primer kan-2R is shown in SEQ ID NO.8; g. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-UP-F and srfAC-UP-F to obtain fragment 6; The nucleotide sequence of the primer srfAC-UP-F is shown in SEQ ID NO.9, and the nucleotide sequence of the primer srfAC-UP-R is shown in SEQ ID NO.10; h. Using the pJOE8999 vector as a template, PCR amplification was performed using primers sgRNA-F and sgRNA-R to obtain fragment 7; The nucleotide sequence of the primer sgRNA-F is shown in SEQ ID NO.11, and the nucleotide sequence of the primer sgRNA-R is shown in SEQ ID NO.12; i. Using pWH1520 vector as template, PCR amplification was performed using primers TCR-F and TCR-R to obtain fragment 8; The nucleotide sequence of the primer TCR-F is shown in SEQ ID NO.13, and the nucleotide sequence of the primer TCR-R is shown in SEQ ID NO.14; j. Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed using primers srfAC-DN-F and srfAC-DN-F to obtain fragment 9; The nucleotide sequence of the primer srfAC-DN-F is shown in SEQ ID NO.15, and the nucleotide sequence of the primer srfAC-DN-R is shown in SEQ ID NO.16; The fragment 5 obtained in step f, the fragment 6 obtained in step g, the fragment 7 obtained in step h, the fragment 8 obtained in step i and the fragment 9 obtained in step j were used to construct the vector pW-sgRNA.

4. A recombinant Bacillus subtilis for synthesizing lactoyl-N-tetraose obtained by using the Bacillus subtilis according to claim 2 or 3, characterized in that: The recombinant Bacillus subtilis is BDP1 or BDZP1; the BDP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BD1 bacterium; the BDZP1 is obtained by chemically transforming the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid into the BDZ1 bacterium.

5. The recombinant Bacillus subtilis for synthesizing lactoyl-N-tetraose according to claim 4, characterized in that: The construction method of the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid comprises the following steps: According to the β-1,3-galactosyltransferase gene (WP_008952439.1) in Pseudogulbenkiania ferrooxidans published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.19 was synthesized; using the synthesized β-1,3-galactosyltransferase gene as a template, PCR amplification was performed using primers pf-F and pf-R to obtain fragment 10; according to the β-1,3-N-acetylglucosaminyltransferase gene (WP_029769400.1) in Neisseria polysaccharea published on NCBI, after codon optimization was performed by Bacillus subtilis, the gene sequence shown in SEQ ID NO.20 was synthesized; using the synthesized β-1,3-N-acetylglucosaminyltransferase gene as a template, PCR amplification was performed using primers nplgtA-F and nplgtA-R to obtain fragment 11; according to the Escherichia coli published on NCBI, coliK12) was encoded by Bacillus subtilis and the codons were optimized to synthesize the gene sequence shown in SEQ ID NO.21; the synthesized lactose permease gene was used as a template and primers lacY-F and lacY-R were used to perform PCR amplification to obtain fragment 12; the plasmid pHT01 was digested with restriction endonuclease BamHI, and the vector was recovered using a purification recovery kit; Fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment were assembled. The specific process was as follows: in a 20 μl reaction system, four fragments 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragments with overlapping sequences were mixed, and the molar ratio of fragment 10, fragment 11, fragment 12 and linearized pHT01 plasmid fragment was 1:1:1:

3. Then 10 μl of 2X Seamless Cloning Mix was added and made up to 20 μl with water. After the reaction was completed at 50°C for 45 min, the reaction product was placed on ice for 5 min, and 5 μl was taken to transform into 100 μl DH5α competent bacteria; LB plates containing ampicillin were used for screening; primers pH-F / pH-R were used to verify the correctness of the plasmid through colony PCR, KpnI / XbaI double enzyme digestion, and sequencing to obtain the pHT01-pf-β-1,3-galT-nplgtA-lacY recombinant plasmid.

6. A method for producing lactoyl-N-tetraose by fermentation using the recombinant Bacillus subtilis according to claim 4 or 5, characterized in that: The steps include: For the fermentation culture of recombinant Bacillus subtilis, 15 g / L xylose inducer was added after 4.5 h to 7.5 h of culture to induce dCas9 expression, and cultured at 37°C and 220 rpm for 42 h to 48 h to obtain lactoyl-N-tetraose.

7. The method according to claim 6, characterized in that: The fermentation medium used for fermentation culture is: glucose 40-70g / L, lactose 5-15g / L, yeast extract 8-16g / L, tryptone 5-10g / L, (NH4)2SO45-10g / L, K2HPO48.5g / L, KH2PO42.5g / L, MgSO4·7H2O 3g / L, CaCl20.15 g / L, the configuration of the trace element solution is according to the mg / L ratio: MnSO43.4 mg, FeSO4.7H2O 28mg, ZnCl27.0 mg, and the solution is water.

8. Use of the recombinant Bacillus subtilis according to claim 4 or 5 in the fermentation production of lactoyl-N-tetraose.

9. Use of the CRISPR / dCas9 vector as claimed in claim 1 in the fermentation production of lactoyl-N-tetraose.

10. Use of the Bacillus subtilis according to claim 2 or 3 in fermentation production of lactoyl-N-tetraose.

Citation Information

Cited By

  • Recombinant bacillus subtilis for producing lactoyl-N-trisaccharide as well as construction method and application of recombinant bacillus subtilis

    CN121718481A