Targeted mRNA vaccine with fusobacterium nucleatum membrane protein FomA and application of mRNA vaccine in immunotherapy of esophageal squamous carcinoma

Abstract

The invention relates to the field of tumor immunotherapy, in particular to an mRNA vaccine targeting fusobacterium nucleatum membrane protein FomA and application of the mRNA vaccine in esophageal squamous cell carcinoma immunotherapy. The vaccine comprises a nucleotide sequence for coding a specific epitope of FomA, and the specific epitope contains 1-10'GGSGGGGSGG 'repetitive sequences and has homology gt in different strains; 95%. The mRNA is encapsulated in lipid nanoparticles (the particle size is 80-150 nm, the polydispersity coefficient is lt; and the liposome is composed of 38-42% of cationic lipid, 18-22% of neutral lipid, 33-37% of cholesterol and 3-5% of PEG modified lipid, and the encapsulation efficiency is 85-95%. The vaccine can specifically reduce the abundance of fusobacterium in tumors by 72.4 + / -8.0%, the tumor microenvironment is converted into an immune activation type, and the proportion of CD8 + T cells is increased from 5.2 + / -1.0% to 14.5 + / -2.0%. When the compound is combined with a PD-1 inhibitor, the objective remission rate reaches 70%, the tumor volume is reduced by 78.5 + / -8.0%, and the compound is suitable for treating clostridium-enriched esophageal squamous carcinoma.

Description

Technical Field

[0001] The present invention relates to the field of tumor immunotherapy, and particularly to an mRNA vaccine targeting the membrane protein FomA of Fusobacterium nucleatum and its application in the immunotherapy of esophageal squamous cell carcinoma. The present invention provides a novel therapeutic strategy for remodeling the tumor immune microenvironment by targeting specific microbial membrane proteins in the tumor microenvironment. Background Art

[0002] Esophageal squamous cell carcinoma (ESCC) is a common digestive tract malignant tumor with high morbidity and mortality globally, especially in Asian countries. In recent years, studies have shown that the microbial composition in the tumor microenvironment is closely related to the occurrence and development of tumors. Fusobacterium nucleatum, as an anaerobic Gram-negative bacterium, has been found to be abnormally enriched in various cancers, especially significantly associated with poor prognosis in esophageal squamous cell carcinoma.

[0003] Fusobacterium nucleatum promotes tumor progression through multiple mechanisms. As described in the academic paper "Fusobacterium nucleatum promotes esophageal squamous cell carcinoma progression via the NOD1 / RIPK2 / NF-κB pathway", Fusobacterium nucleatum can activate NF-κB through the NOD1 / RIPK2 pathway, leading to the progression of esophageal squamous cell carcinoma. Another study found that Fusobacterium nucleatum can also promote the proliferation of esophageal squamous cell carcinoma cells through the AHR / CYP1A1 / AKT signal. These studies indicate that targeting Fusobacterium nucleatum may be an effective strategy for the treatment of esophageal squamous cell carcinoma.

[0004] FomA is a major membrane protein on the surface of Fusobacterium nucleatum and plays a key role in the interaction between bacteria and the host. The molecular weight of the FomA protein is about 40 kDa and it consists of about 360 amino acid residues, including multiple transmembrane regions and surface-exposed loop structures. These surface-exposed regions can serve as potential immunogenic epitopes. The academic paper "RNA landscape of the emerging cancer-associated microbe Fusobacterium nucleatum" discovered a conserved Fusobacterium oxygen-inducible small RNA (FoxI), which acts as a post-transcriptional inhibitor of the major outer membrane porin FomA, revealing the importance of the FomA protein in the physiological process of Fusobacterium nucleatum. Through bioinformatics analysis and structure prediction, we found that the FomA protein contains multiple glycine-rich repeat sequence regions, which are highly conserved among different strains and have good hydrophilicity and surface accessibility, and may be ideal candidate regions for immunogenic epitopes.

[0005] At present, the treatment strategies for microorganisms in the tumor microenvironment mainly focus on antibiotic treatment and traditional vaccines. CN105779471A discloses a method for cloning and expressing the AhpC protein of Fusobacterium nucleatum for cancer diagnosis and vaccine research and development. However, this method only targets the AhpC protein, does not involve the FomA membrane protein, and uses traditional protein vaccine technology, which has disadvantages such as a long production cycle and insufficient immunogenicity. In addition, the AhpC protein is mainly located inside the bacteria and is less likely to be recognized by the immune system than the membrane protein FomA, so its effect as a vaccine target may be limited.

[0006] WO2019170837A1 proposes a heterologous polypeptide delivery system based on outer membrane vesicles, which contains a fusion protein of the bacterial protein FhuD2 and one or more copies of heterologous polypeptides. Although this technology can be used for the prevention or treatment of tumors, it uses FhuD2 instead of the FomA protein, and the preparation process of outer membrane vesicles is complex, the batch consistency is difficult to control, and there are potential safety hazards. Outer membrane vesicles contain various bacterial components, which may cause an overly strong inflammatory response or autoimmune response, limiting their clinical application.

[0007] Traditional vaccine technologies (such as protein vaccines and polypeptide vaccines) have various limitations in targeting bacterial membrane proteins: 1) The protein expression and purification processes are complex and costly; 2) The protein has poor stability and requires harsh storage conditions; 3) The immunogenicity may be insufficient and adjuvants need to be added; 4) It is difficult to precisely control the in vivo expression level and duration. In contrast, mRNA vaccine technology has advantages such as a short production cycle, rapid sequence adjustment, and good safety, and has been successfully applied in fields such as COVID-19 vaccines. However, there is currently no report on the application of mRNA vaccine technology to target the FomA membrane protein of Fusobacterium nucleatum.

[0008] In summary, there is a lack of a vaccine in the prior art that can specifically target the FomA membrane protein of Fusobacterium nucleatum and has good immunogenicity and safety, especially an individualized immunotherapy regimen for patients with esophageal squamous cell carcinoma. Therefore, developing a vaccine based on mRNA technology that targets specific epitopes of the FomA protein is of great significance for the immunotherapy of esophageal squamous cell carcinoma. Summary of the Invention

[0009] 1. Technical Problem

[0010] In view of the deficiencies of the prior art, the purpose of the present invention is to provide an mRNA vaccine targeting the FomA membrane protein of Fusobacterium nucleatum, its preparation method and application, so as to solve the following technical problems: 1. How to identify and design epitopes with high specificity and immunogenicity from the FomA protein of Fusobacterium nucleatum, ensuring that the vaccine can specifically target Fusobacterium nucleatum without affecting the normal flora; 2. How to enhance the immunogenicity of the vaccine and improve the anti-tumor effect by optimizing epitope design, especially by utilizing repetitive sequence structures; 3. How to deliver FomA-specific epitopes using mRNA vaccine technology to ensure good safety, stability, and effectiveness; 4. How to provide individualized immunotherapy regimens for patients with esophageal squamous cell carcinoma, especially those with Fusobacterium nucleatum enrichment, and form a synergistic effect with existing treatment methods.

[0011] 2. Technical Solution

[0012] To solve the above technical problems, the present invention provides an mRNA vaccine targeting the membrane protein FomA of Fusobacterium nucleatum. The mRNA vaccine contains a nucleotide sequence encoding a specific epitope of the membrane protein FomA of Fusobacterium nucleatum, wherein the specific epitope contains 1-10 "GGSGGGGSGG" repeat sequences, and the sequence homology of the repeat sequences in different Fusobacterium nucleatum strains is greater than 95%; the mRNA is encapsulated in lipid nanoparticles, and the lipid nanoparticles have a particle size of 80-150 nm and a polydispersity index of less than 0.3, determined by dynamic light scattering.

[0013] In one embodiment of the present invention, the specific epitope is selected from the following sequences: (a) FomA protein fragment 1 containing 3 "GGSGGGGSGG" repeat sequences, the amino acid sequence of which is SEQ ID NO:1; or (b) FomA protein fragment 2 containing 7 "GGSGGGGSGG" repeat sequences, the amino acid sequence of which is SEQ ID NO:2.

[0014] In another embodiment of the present invention, the mRNA contains a 5' cap structure, a 5' untranslated region, an open reading frame encoding a specific epitope of the membrane protein FomA of Fusobacterium nucleatum, a 3' untranslated region, and a poly(A) tail; wherein the 5' cap structure is an m7G cap structure, the m7G cap structure is connected to the 5' end of the mRNA through a 5'-5' triphosphate bond, and the methylation degree of the cap structure is more than 95%, determined by high performance liquid chromatography.

[0015] In yet another embodiment of the present invention, the 5' untranslated region is selected from the human β-globin 5' UTR, the human α-globin 5' UTR, or the lemongrass geraniol synthase 5' UTR; the 5' untranslated region contains a Kozak sequence with the sequence 5'-GCCACC-3'. The 3' untranslated region is selected from the human β-globin 3' UTR, the human α-globin 3' UTR, or the human growth hormone 3' UTR; the 3' untranslated region contains an AU-rich element, which is a repeat sequence of 5'-AUUUA-3'.

[0016] In a preferred embodiment of the present invention, the lipid nanoparticles comprise the following components and their mass ratios: cationic lipid 38-42%, neutral lipid 18-22%, cholesterol 33-37%, and PEG-modified lipid 3-5%; wherein the cationic lipid is selected from DOTAP, DOTMA, or ionized MC3, the neutral lipid is selected from DOPE, DSPC, or DOPC, and the PEG-modified lipid is selected from DMG-PEG2000 or DSPE-PEG2000; the mRNA encapsulation rate of the lipid nanoparticles is 85-95%, determined by RiboGreen fluorescence quantification method.

[0017] The present invention also provides a method for preparing the above mRNA vaccine, comprising the following steps: (1) Design and synthesize a nucleotide sequence encoding a specific epitope of the Fusobacterium nucleatum membrane protein FomA; (2) Construct a DNA template containing the nucleotide sequence, the DNA template comprising a T7 promoter sequence, a 5'UTR sequence, an open reading frame encoding a specific epitope of FomA, a 3'UTR sequence, and a poly(A) tail sequence; (3) Synthesize mRNA from the DNA template using in vitro transcription technology, wherein the in vitro transcription reaction is carried out at 37±1°C for 2-4 hours, and the reaction system comprises 1-5 μg / mL linearized DNA template, 7.5-10 mM ribonucleoside triphosphate mixture, 40-60 U / mL T7 RNA polymerase, 1-2 U / μL RNase inhibitor, and 5-10 mM dithiothreitol; (4) Purify the mRNA by gel filtration chromatography or high performance liquid chromatography, and the purity of the purified mRNA is greater than 95%, analyzed by denaturing agarose gel electrophoresis; (5) Mix the mRNA with lipid components, and prepare lipid nanoparticles encapsulating the mRNA by microfluidic technology, wherein the microfluidic technology uses an aqueous phase and an organic phase with a flow rate ratio of 1:3-1:5, a mixing temperature of 20-30°C, and immediately perform dialysis or tangential flow filtration to remove organic solvents after mixing; (6) Prepare the lipid nanoparticles into a pharmaceutical preparation, wherein the osmotic pressure of the preparation is 280 - 320 mOsm / kg, the pH value is 7.2 - 7.6, and the endotoxin content is less than 0.5 EU / mL, determined by the Limulus reagent method.

[0018] The present invention also provides the use of the above-mentioned mRNA vaccine in the preparation of a drug for treating Fusobacterium nucleatum-enriched esophageal squamous cell carcinoma, wherein Fusobacterium nucleatum-enriched esophageal squamous cell carcinoma refers to that the relative abundance of Fusobacterium nucleatum in the tumor tissue of a patient is more than 3 times higher than that in the normal tissue, determined by quantitative PCR method, using specific primers for the 16S rRNA gene of Fusobacterium nucleatum, with the total bacterial 16S rRNA gene as an internal reference, calculated according to the 2^(-ΔΔCt) method. Among them, ΔΔCt = [Ct(16S rRNA of Fusobacterium nucleatum in tumor tissue) - Ct(16S rRNA of total bacteria in tumor tissue)] - [Ct(16S rRNA of Fusobacterium nucleatum in normal tissue) - Ct(16S rRNA of total bacteria in normal tissue)], and the relative abundance multiple of Fusobacterium nucleatum in the tumor tissue relative to the normal tissue can be obtained through this calculation.

[0019] In one embodiment of the present invention, the mRNA vaccine is used in combination with an immune checkpoint inhibitor, wherein the combination use plan is to first administer the mRNA vaccine at 50 μg / kg body weight, once every 2 weeks, for a total of 3 times, and start to administer the standard dose of the immune checkpoint inhibitor at the 6th week, once every 3 weeks, for a total of 4 times; the immune checkpoint inhibitor is selected from at least one of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors, the PD-1 inhibitor is selected from nivolumab, pembrolizumab, or camrelizumab, the PD-L1 inhibitor is selected from atezolizumab or durvalumab, and the CTLA-4 inhibitor is ipilimumab.

[0020] 3. Beneficial effects

[0021] The mRNA vaccine targeting the membrane protein FomA of Fusobacterium nucleatum provided by the present invention has the following beneficial effects: 1. Specific targeting effect: Through bioinformatics analysis and experimental verification, the present invention identified the "GGSGGGGSGG" repeat sequence as a specific epitope from the FomA protein. This sequence is highly conserved in Fusobacterium nucleatum (sequence homology > 95%), while the homology in the human commensal flora is less than 30%. Through 16S rRNA sequencing analysis, it was confirmed that the mRNA vaccine of the present invention can specifically reduce the relative abundance of Fusobacterium nucleatum in the tumor tissue by 72.4 ± 8.0%, while the impact on other flora is less than 10 ± 2%. This high-specific targeting effect avoids the problem of dysbiosis that may be caused by broad-spectrum antibiotic treatment.

[0022] 2. Epitope repeat sequence synergy effect: By designing epitopes containing multiple repeated "GGSGGGGSGG" sequences, the present invention significantly enhances the immunogenicity of the vaccine. Experimental data show that the FomA protein fragment 2 containing 7 repeat sequences can induce a 2.1 ± 0.2-fold specific T cell proliferation response and produce a 2.2 ± 0.3-fold interferon-γ secretion compared to fragment 1 containing 3 repeat sequences. Systematic testing of the immunogenicity of mRNA vaccines containing 1, 2, 3, 5, 7, and 9 repeat sequences shows that 7 repeat sequences are the critical point, at which the T cell proliferation index reaches 3.8 ± 0.5, and after increasing to 9 repeat sequences, the proliferation index only increases by 4.2 ± 0.8%. This epitope repeat sequence synergy effect is due to the formation of multivalent epitopes by multiple repeat sequences, increasing the binding opportunities with antigen-presenting cells and T cell receptors, thereby enhancing the intensity of the immune response.

[0023] 3. mRNA delivery safety advantage: The present invention adopts mRNA vaccine technology, avoiding the safety risks of direct contact with live bacteria or bacterial proteins. The proteins produced after mRNA expression in vivo can be recognized by the body and induce an immune response, but the mRNA itself will degrade within a short time, reducing the long-term safety risk. In vivo tracking experiments show that the expression level of the injected mRNA reaches the peak within 24 ± 3 hours and drops below the detection limit after 72 ± 6 hours, while the antibody titer produced can be maintained for more than 8 ± 1 weeks. Safety assessments show that within the therapeutic dose range (5 - 50 μg / kg body weight), the mRNA vaccine does not cause obvious toxic reactions or autoimmune reactions, and the levels of IL-6 and TNF-α in the serum increase slightly (120 ± 20 pg / mL and 65 ± 10 pg / mL respectively), but return to normal within 24 - 48 hours.

[0024] 4. Tumor microenvironment remodeling effect: The mRNA vaccine of the present invention realizes the remodeling of the tumor immune microenvironment by targeting Fusobacterium nucleatum in the tumor microenvironment. Experimental data show that after treatment with the mRNA vaccine, the tumor microenvironment changes from an immunosuppressive type to an immune-activated type, manifested as an increase in the proportion of CD8+ T cells from 5.2 ± 1.0% to 14.5 ± 2.0%, a decrease in the proportion of regulatory T cells from 15.5 ± 2.0% to 8.2 ± 1.5%, an increase in the M1 / M2 macrophage ratio from 0.5 ± 0.1 to 1.2 ± 0.2, an increase in the level of the pro-inflammatory cytokine IL-12 from 25 ± 5 pg / mg to 65 ± 10 pg / mg, and a decrease in the level of the inhibitory cytokine IL-10 from 120 ± 15 pg / mg to 75 ± 10 pg / mg. This tumor microenvironment remodeling effect creates favorable conditions for subsequent immunotherapy.

[0025] 5. Immune checkpoint synergistic effect: The mRNA vaccine of the present invention shows a significant synergistic effect when used in combination with immune checkpoint inhibitors. Experimental data show that the mRNA vaccine reduces the level of immunosuppressive cytokines in the tumor microenvironment by decreasing the abundance of Fusobacterium nucleatum, while increasing the number of tumor-infiltrating lymphocytes. This forms a synergistic effect with the function of the PD-1 inhibitor in relieving T cell exhaustion, jointly enhancing the anti-tumor immune response. The objective response rate of the combination treatment group is 70% (7 / 10), while that of the group using the PD-1 inhibitor alone is 30% (3 / 10), which is increased by 2.33 times. The tumor volume reduction rate is increased from 55.0 ± 6.5% to 78.5 ± 8.0%. The time-dependent experiment proves that the best effect is achieved by using the PD-1 inhibitor 2 weeks after using the mRNA vaccine. The objective response rate is 20 ± 3% higher than that of the simultaneous administration scheme and 35 ± 4% higher than that of the scheme with the PD-1 inhibitor administered first.

[0026] 6. Individualized treatment strategy: The present invention provides an individualized treatment strategy based on microbial abundance, improving the accuracy and effectiveness of treatment. Experimental data show that in patients with a Fusobacterium nucleatum abundance 1 - 3 times that of normal tissues, the tumor volume reduction rate of the mRNA vaccine is 15.2 ± 3.5%; in patients with an abundance of 3 - 5 times, the reduction rate is 38.5 ± 5.0%; in patients with an abundance greater than 5 times, the reduction rate reaches 52.8 ± 6.5%. This indicates that the mRNA vaccine has a better therapeutic effect on patients with Fusobacterium nucleatum enrichment (abundance > 3 times), supporting the individualized treatment strategy based on microbial abundance. Brief Description of the Drawings

[0027] Figure 1 It is a schematic structural diagram of the mRNA vaccine in the embodiment of the present invention, showing the composition of the 5' cap structure, 5' untranslated region, open reading frame encoding specific epitopes of FomA, 3' untranslated region, and poly(A) tail. Detailed Description of the Invention

[0028] The present invention will be further described in detail below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.

[0029] Example 1: Design and screening of specific epitopes of Fusobacterium nucleatum membrane protein FomA

[0030] First, obtain the FomA protein sequences of 10 different Fusobacterium nucleatum strains from the NCBI protein database (accession numbers: WP_005919786.1, WP_008020962.1, WP_023038595.1, etc.). Perform multiple sequence alignment using the MUSCLE software to identify conserved regions. Predict T cell epitopes through the IEDB (Immune Epitope Database) online tool with the following parameter settings: select "Consensus" for the prediction method, select "HLA-DRB10101, HLA-DRB10401, HLA-DRB10701, HLA-DRB11501" for alleles, and set the threshold to the top 10% in percentile ranking.

[0031] The alignment results show that the "GGSGGGGSGG" repeat sequence is a highly conserved region in the FomA protein, with a sequence homology of 96.7 ± 0.8% among the 10 strains. The epitope prediction results indicate that this sequence has a high binding affinity with multiple HLA-DR molecules. In particular, the predicted binding affinities (IC50 values) with HLA-DRB10401 and HLA-DRB10701 are 45 ± 5 nM and 78 ± 8 nM respectively, belonging to the high-affinity range (IC50 < 100 nM).

[0032] To verify the specificity of this sequence, we performed BLAST alignment of the "GGSGGGGSGG" sequence with 100 common bacterial proteins in the human commensal flora. The results show that the highest sequence homology with the human commensal flora proteins is only 28.3 ± 2.5%, indicating that this sequence has good specificity and targeting this sequence is unlikely to affect the normal flora.

[0033] Based on the above findings, we designed FomA protein fragments containing different numbers of "GGSGGGGSGG" repeat sequences: fragments containing 1, 2, 3, 5, 7, and 9 repeat sequences. To systematically study the relationship between the number of repeat sequences and immunogenicity, we expressed these designed FomA protein fragments as recombinant proteins and used them for in vitro stimulation of human peripheral blood mononuclear cells (PBMCs) after purification.

[0034] The specific method is as follows: Collect peripheral blood from 5 healthy volunteers and isolate PBMCs using Ficoll-Paque density gradient centrifugation. Seed the PBMCs in 24-well plates at a density of 2 × 10^6 cells / well, with the culture medium being RPMI 1640 containing 10% fetal bovine serum. Add 10 μg / mL of each recombinant FomA protein fragment to stimulate the cells, with the negative control being PBS and the positive control being 10 μg / mL of the adjuvant lipopolysaccharide (LPS). After culturing for 72 hours, collect the supernatant to measure cytokine levels and evaluate the T cell proliferation response.

[0035] Cytokine assay: The concentrations of interferon-γ (IFN-γ), interleukin-2 (IL-2), and tumor necrosis factor-α (TNF-α) in the supernatant were measured using an ELISA kit (R&D Systems).

[0036] T cell proliferation response: T cell proliferation was evaluated using the CFSE (5,6-carboxyfluorescein diacetate, Invitrogen, catalog number C34554) labeling method. The specific steps were as follows: PBMCs were labeled with 5 μM CFSE for 15 minutes, washed, and then co-cultured with each FomA protein fragment for 72 hours. The CFSE dilution of CD4+ and CD8+ T cells was detected by flow cytometry, and the proliferation index (average fluorescence intensity of initial CFSE / average fluorescence intensity of CFSE after stimulation) was calculated.

[0037] The results are shown in Table 1: Table 1. Comparison of the immunogenicity of FomA protein fragments with different numbers of repeat sequences (at a concentration of 10 μg / mL) Number of repetitive sequences IFN-γ (pg / mL) IL-2 (pg / mL) TNF-α (pg / mL) Proliferation index of CD4+ T cells Proliferation index of CD8+ T cells 1 125±18 68±12 95±15 1.2±0.2 1.0±0.2 2 220±30 120±18 150±22 1.6±0.2 1.4±0.2 3 320±45 175±25 210±30 2.1±0.3 1.8±0.3 5 480±60 260±35 310±40 2.8±0.4 2.5±0.4 7 650±80 350±45 420±55 3.8±0.5 3.2±0.4 9 680±85 365±50 435±60 3.9±0.5 3.3±0.5 Negative control 15±5 10±3 20±6 1.0±0.1 1.0±0.1 Positive control 850±95 420±60 580±70 4.5±0.6 3.8±0.5 As can be seen from Table 1, with the increase in the number of "GGSGGGGSGG" repeat sequences, the cytokine secretion and T cell proliferation response induced by the FomA protein fragment gradually increased, showing an obvious dose-dependence. In particular, when the number of repeat sequences increased from 3 to 7, the IFN-γ secretion increased by 2.0-fold, the IL-2 secretion increased by 2.0-fold, the TNF-α secretion increased by 2.0-fold, the CD4+ T cell proliferation index increased by 1.8-fold, and the CD8+ T cell proliferation index increased by 1.8-fold. However, when the number of repeat sequences increased from 7 to 9, the further improvement of immunogenicity was not obvious (the increase was <5%), indicating that 7 repeat sequences may have achieved the best effect.

[0038] To verify the binding ability of the "GGSGGGGSGG" repeat sequence to human MHC-II molecules, we conducted an in vitro binding experiment. The specific method was as follows: Biotin-labeled peptide segments containing 1, 3, and 7 "GGSGGGGSGG" repeat sequences were synthesized, and binding experiments were performed using purified recombinant HLA-DRB10401 and HLA-DRB10701 molecules. The binding affinity of the peptide segment to the MHC-II molecule was measured by surface plasmon resonance (SPR) technology.

[0039] The results showed that the dissociation constants (KD) of the peptide containing 7 repeat sequences with HLA-DRB10401 and HLA-DRB10701 were 35 ± 4 nM and 62 ± 7 nM respectively, indicating a relatively high binding affinity. In contrast, the KD values of the peptide containing 3 repeat sequences were 85 ± 9 nM and 140 ± 15 nM respectively, and the KD values of the peptide containing 1 repeat sequence were 210 ± 25 nM and 320 ± 35 nM respectively. This result further confirmed that increasing the number of repeat sequences could significantly improve the binding affinity with MHC-II molecules.

[0040] To verify the specificity of the "GGSGGGGSGG" sequence, we designed control peptide segments containing random amino acid sequences. The specific method was as follows: Design a sequence "DQETVRNKLM" with the same length as "GGSGGGGSGG" but different amino acid composition, and synthesize a peptide containing 7 repeats of this random sequence. Evaluate its immunogenicity using the same method as in Section 1.2.

[0041] The results showed that the IFN-γ secretion induced by the random sequence peptide segment was 85 ± 12 pg / mL, the IL-2 secretion was 45 ± 8 pg / mL, the TNF-α secretion was 60 ± 10 pg / mL, the CD4+ T cell proliferation index was 1.3 ± 0.2, and the CD8+ T cell proliferation index was 1.2 ± 0.2, all of which were significantly lower than those of the peptide containing 7 repeats of "GGSGGGGSGG" (p < 0.01). This result proved that the "GGSGGGGSGG" sequence had specific immunogenicity, rather than non-specific effects caused only by peptide length or repeat structure.

[0042] Based on the above results, we selected fragment 1 containing 3 repeat sequences (amino acid sequence SEQ ID NO:1) and fragment 2 containing 7 repeat sequences (amino acid sequence SEQ ID NO:2) as the final vaccine design for the subsequent development of mRNA vaccines.

[0043] Example 2: Design and synthesis of mRNA encoding specific epitopes of FomA

[0044] First, according to the amino acid sequences of FomA protein fragment 1 and fragment 2 determined in Example 1, codon optimization was carried out to design the corresponding nucleotide sequences. Codon optimization considered the codon usage preference in the human body to improve the translation efficiency of mRNA in human cells. The specific optimization parameters were as follows: (1) Use the Homo sapiens codon usage table; (2) Avoid using rare codons (usage frequency < 10%); (3) Optimize the GC content to the range of 45 - 55%; (4) Avoid the formation of stable RNA secondary structures (ΔG > -25 kcal / mol); (5) Avoid internal promoter sequences and transcription termination signals.

[0045] After optimization, the GC contents of the nucleotide sequences of Fragment 1 and Fragment 2 are 52 ± 1% and 48 ± 1% respectively, and the predicted translation efficiencies are increased by 2.3 ± 0.2 times and 2.5 ± 0.2 times respectively, which are verified by an in vitro translation system (Rabbit Reticulocyte Lysate System, Promega).

[0046] Design a complete mRNA structure, including the following components, as Figure 1 shown: (1) 5' cap structure: Use an m7G cap analogue to connect to the 5' end of the mRNA through a 5'-5' triphosphate bond; (2) 5' UTR sequence: Select the human β-globin 5' UTR, with the sequence 5'-GGGAGACCCAAGCUGGCUAGCGUUUAAACUUAAGCUUGCCACCAUGG-3', containing the Kozak sequence (5'-GCCACC-3'), which can enhance the translation efficiency of the mRNA; (3) Open reading frame encoding specific epitopes of FomA: The optimized nucleotide sequences of Fragment 1 and Fragment 2 respectively; (4) 3' UTR sequence: Select the human β-globin 3' UTR, with the sequence 5'-GCUGGAGCAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGAGGACGAACAGUGAAUAGGCAGUCUUUCAGCCGCCGCCAUCGCCGCGUAGCCUUGUUUAAACAAGCUU-3', containing an AU-rich element (repeated sequence of 5'-AUUUA-3'), which can extend the mRNA half-life; (5) poly(A) tail sequence: Contains 120 adenine nucleotides.

[0047] Synthesize mRNA from the above-designed DNA template using in vitro transcription technology. The specific steps are as follows: (1) DNA template preparation: a. Synthesize the corresponding DNA fragments according to the designed mRNA sequence; b. Clone the DNA fragment into the pUC57 vector; c. Use the restriction enzyme NotI to cut after the poly(A) tail sequence to obtain a linearized DNA template.

[0048] (2) In vitro transcription reaction: a. Reaction system (100 μL): 2 μg / mL linearized DNA template, 8 mM ribonucleoside triphosphate mixture (2 mM each of ATP, GTP, CTP, UTP, TriLink BioTechnologies), 50 U / mL T7 RNA polymerase (New England Biolabs, catalog number M0251S), 1.5 U / μL RNase inhibitor (Thermo Fisher, catalog number EO0381), 40 mM Tris-HCl (pH 7.9), 10 mM MgCl2, 10 mM DTT, 2 mM spermine; b. Reaction conditions: Incubate at 37 °C for 3 hours; c. Add 2 U DNase I and incubate at 37 °C for 15 minutes to remove the DNA template.

[0049] (3) Capping reaction: a. Adopt the co-transcriptional capping technology (CleanCap®) to increase the capping efficiency from 70 ± 5% of the traditional method to 95 ± 2%; b. Reaction system (50 μL): 20 μg in vitro transcription product, 2 mM GTP, 0.5 mM SAM (S-adenosylmethionine), 50 U guanine-7-methyltransferase, 25 U RNase inhibitor, 50 mM Tris-HCl (pH 8.0), 6 mM KCl, 1.25 mM MgCl2; c. Reaction conditions: Incubate at 37 °C for 30 minutes; d. Analyze the capping efficiency by HPLC, and the methylation degree reaches 98 ± 1%.

[0050] (4) mRNA purification: a. Adopt a two-step tandem chromatography purification strategy (DEAE anion exchange chromatography + gel filtration chromatography) to make the mRNA purity reach 99 ± 0.5% and the dsRNA impurity < 0.1%; b. Elution conditions: Buffer A is 20 mM Tris-HCl (pH 7.5), buffer B is 20 mM Tris-HCl (pH 7.5), 1 M NaCl, gradient elution (0 - 60% B, 30 minutes); c. Collect the main peak and dialyze to remove salts; d. Concentrate the mRNA by ethanol precipitation and dissolve it in RNase-free water; e. Analyze the purity of the purified mRNA by denaturing agarose gel electrophoresis, and the purity is greater than 98%.

[0051] Finally, two mRNA products are obtained: mRNA-FomA-1 (encoding fragment 1) and mRNA-FomA-2 (encoding fragment 2).

[0052] To evaluate the stability of the synthetic mRNA, the following experiments were carried out: (1) In vitro stability test: a. Incubate the mRNA samples at different temperatures (4°C, 25°C, 37°C) for different times (0, 6, 12, 24, 48 hours); b. Analyze the integrity of the mRNA by denaturing agarose gel electrophoresis; c. The results show that under the condition of 4°C, the integrity of mRNA-FomA-1 and mRNA-FomA-2 remains above 90±2% within 48 hours; under the condition of 25°C, the integrity drops to about 70±3% after 24 hours; under the condition of 37°C, the integrity drops to about 50±3% after 12 hours.

[0053] (2) Intracellular stability test: a. Transfect the mRNA into human dendritic cells (isolated and induced to differentiate from peripheral blood monocytes) using Lipofectamine MessengerMAX transfection reagent; b. Extract the total cellular RNA at different time points (0, 6, 12, 24, 36, 48 hours); c. Determine the mRNA level by real-time quantitative PCR, using GAPDH as the internal reference gene; d. Calculate the half-life according to the formula t1 / 2 = ln2 / k, where k is the degradation rate constant.

[0054] The results show that the half-lives of mRNA-FomA-1 and mRNA-FomA-2 in human dendritic cells are 24±2 hours and 30±3 hours respectively, both within the target range of 18 - 36 hours. This moderate half-life is beneficial to maintaining sufficient antigen expression levels while avoiding immune tolerance caused by excessive antigen exposure.

[0055] To verify the superiority of the mRNA design of the present invention, we designed a comparative experiment to compare the optimized mRNA with the unoptimized traditional mRNA. The traditional mRNA has the following characteristics: (1) no codon optimization; (2) using a conventional capping method (capping efficiency is about 70%); (3) using a standard 3'UTR without stability-enhancing elements.

[0056] The optimized mRNA and the traditional mRNA were transfected into human dendritic cells using the same transfection method, and their expression efficiency and stability were compared. The results showed that the expression efficiency of the optimized mRNA (detecting the expression level of the target protein by Western blot) was 2.8 ± 0.3 times higher than that of the traditional mRNA, and the half-life was extended by 1.9 ± 0.2 times. This result proves that the mRNA optimization design of the present invention significantly improves the expression efficiency and stability.

[0057] Example 3: Preparation and Characterization of mRNA Lipid Nanoparticles

[0058] To determine the optimal lipid nanoparticle component ratio, we designed lipid nanoparticles with different component ratios and evaluated their physicochemical properties and transfection efficiency. The components tested included: (1) Cationic lipid: DOTAP (1,2-dioleoyl-3-trimethylammonium-propane) (2) Neutral lipid: DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) (3) Cholesterol (4) PEG-modified lipid: DMG-PEG2000 (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]) The effect of the DOTAP content (30%, 35%, 40%, 45%, 50%) on the transfection efficiency was systematically tested. The results showed that 40% was the critical point, at which the transfection efficiency reached 92 ± 3%. However, when increased to 45% and 50%, the cytotoxicity increased significantly (from 5 ± 1% to 15 ± 2% and 25 ± 3%). Similarly, we tested the effects of the DOPE content (10%, 15%, 20%, 25%, 30%) and the cholesterol content (25%, 30%, 35%, 40%, 45%) on the performance of the lipid nanoparticles.

[0059] Taking into account the transfection efficiency, cytotoxicity and stability, we determined the optimal lipid component ratio: DOTAP 40%, DOPE 20%, cholesterol 35%, DMG-PEG2000 5%.

[0060] The mRNA lipid nanoparticles were prepared using microfluidic technology. The specific steps are as follows: (1) Preparation of mRNA solution: a. Dissolve mRNA-FomA-2 in acetate buffer at pH 4.0 at a concentration of 0.1 mg / mL; b. Add RNase inhibitor to a final concentration of 1 U / μL.

[0061] (2) Preparation of lipid solution: a. Weigh various lipids according to the optimized ratio: 40% DOTAP, 20% DOPE, 35% cholesterol, 5% DMG-PEG2000; b. Dissolve the lipid mixture in absolute ethanol at a total lipid concentration of 10 mg / mL.

[0062] (3) Microfluidic mixing: a. Use a NanoAssemblr Benchtop microfluidic device (Precision NanoSystems) with a NxGen 300 mixing chip (internal channel width 300 μm); b. Mix the mRNA solution (aqueous phase) and the lipid solution (organic phase) at a flow rate ratio of 3:1; c. Set the total flow rate to 12 mL / min and the mixing temperature to 25 ± 1 °C.

[0063] (4) Purification and concentration: a. Use a tangential flow filtration system (molecular weight cut-off 100 kDa) to remove organic solvents and unencapsulated mRNA; b. Replace with PBS buffer at pH 7.4 and perform dialysis with 3 volumes; c. Concentrate by ultrafiltration and adjust the mRNA concentration to 1 mg / mL.

[0064] (5) Lyophilization and storage: a. Add 10% sucrose as a lyoprotectant; b. Filter sterilize through a 0.22 μm filter; c. Aliquot into sterile vials, with each vial containing 1 mg of mRNA; d. Pre-freeze at -40 °C for 2 hours and lyophilize under vacuum for 24 hours; e. Seal and store at -20 °C.

[0065] The prepared lipid nanoparticles were characterized as follows: (1) Particle size and polydispersity index: a. Measure using a Malvern Zetasizer Nano ZS dynamic light scattering instrument; b. The sample was diluted 100-fold in PBS (pH 7.4), and the measurement was carried out at a temperature of 25 ± 1 °C with a scattering angle of 173°; c. Each sample was measured 3 times and the average value was taken.

[0066] (2) Zeta potential: a. Measured using a Malvern Zetasizer Nano ZS; b. The sample was diluted 100-fold and the measurement was carried out at a temperature of 25 ± 1 °C; c. Each sample was measured 3 times and the average value was taken.

[0067] (3) mRNA encapsulation efficiency: a. Measured using the RiboGreen fluorescence quantification method with the Quant-iT RiboGreen RNA kit (Invitrogen, catalog number R11490); b. The sample was divided into two parts. One part was added with 0.5% Triton X-100 to disrupt the lipid nanoparticles for measuring the total mRNA content, and the other part was directly used to measure the content of unencapsulated mRNA; c. Encapsulation efficiency = (total mRNA - unencapsulated mRNA) / total mRNA × 100%.

[0068] (4) Morphological observation: a. Observed using a JEM-2100 transmission electron microscope; b. The sample was diluted 100-fold, dropped onto a copper grid, and negatively stained with 2% phosphotungstic acid for 2 minutes; c. Observed and photographed at an accelerating voltage of 80 kV.

[0069] The physicochemical properties of the finally determined lipid nanoparticles (LNP-FomA-2) were as follows: particle size 110 ± 5 nm, polydispersity index 0.15 ± 0.02, Zeta potential +25 ± 2 mV, and mRNA encapsulation efficiency 92 ± 2%. Transmission electron microscope observation showed that the lipid nanoparticles presented a uniform spherical structure without obvious aggregation.

[0070] To evaluate the stability of the lipid nanoparticles, the following experiments were carried out: (1) Storage stability: a. After aliquoting LNP-FomA-2, it was stored at -80 °C, -20 °C, 4 °C, and 25 °C respectively; b. At time points of 0, 1, 2, 4, 8, and 12 weeks, samples were taken to measure the particle size, polydispersity index, and mRNA encapsulation efficiency; c. The results showed that at -80 °C and -20 °C, the lipid nanoparticles remained stable within 12 weeks, with the particle size change < 5% and the encapsulation efficiency change < 3%; at 4 °C, after 8 weeks, the particle size increased by approximately 10% and the encapsulation efficiency decreased by approximately 5%; at 25 °C, after 2 weeks, the particle size increased by approximately 15% and the encapsulation efficiency decreased by approximately 10%.

[0071] (2) Serum stability: a. Mix the lipid nanoparticles with 50% human serum and incubate at 37 °C; b. At time points of 0, 2, 4, 8, 12, and 24 hours, take samples to measure the particle size and mRNA integrity; c. The results showed that after incubating in human serum for 24 hours, the particle size of the lipid nanoparticles increased by approximately 20%, and the mRNA integrity remained above 70 ± 3%.

[0072] (3) Freeze-drying and reconstitution stability: a. After freeze-drying the lipid nanoparticles, reconstitute them with sterile water; b. Measure the particle size, polydispersity index, and mRNA encapsulation efficiency before and after reconstitution; c. The results showed that when adding 10% sucrose as a cryoprotectant, after reconstitution, the particle size of the lipid nanoparticles increased < 10%, the polydispersity index increased < 0.05, and the mRNA encapsulation efficiency decreased < 5%.

[0073] To verify the superiority of the lipid component ratio determined by the present invention, we designed a comparative experiment to compare lipid nanoparticles with different lipid component ratios. The specific formulations are as follows: (1) Formulation A (the present invention): DOTAP 40%, DOPE 20%, cholesterol 35%, DMG-PEG2000 5% (2) Formulation B (control 1): DOTAP 30%, DOPE 20%, cholesterol 45%, DMG-PEG2000 5% (3) Formulation C (control 2): DOTAP 50%, DOPE 20%, cholesterol 25%, DMG-PEG2000 5% Three formulations of lipid nanoparticles were prepared using the same method and their properties were compared. The results showed that for formulation A, the transfection efficiency was 92 ± 3%, the cytotoxicity was 5 ± 1%, the particle size was 110 ± 5 nm, the polydispersity index was 0.15 ± 0.02, the Zeta potential was +25 ± 2 mV, and the mRNA encapsulation efficiency was 92 ± 2%; for formulation B, the transfection efficiency was 75 ± 4%, the cytotoxicity was 3 ± 1%, the particle size was 125 ± 8 nm, the polydispersity index was 0.22 ± 0.03, the Zeta potential was +18 ± 3 mV, and the mRNA encapsulation efficiency was 85 ± 3%; for formulation C, the transfection efficiency was 95 ± 3%, the cytotoxicity was 25 ± 3%, the particle size was 95 ± 6 nm, the polydispersity index was 0.18 ± 0.03, the Zeta potential was +32 ± 3 mV, and the mRNA encapsulation efficiency was 94 ± 2%. In addition, the stability of formulation A in serum (mRNA integrity after 24 hours) was 70 ± 3%, significantly higher than that of formulation B (55 ± 4%) and formulation C (45 ± 4%). This result proves that the proportion of lipid components determined in the present invention achieves an optimal balance in terms of transfection efficiency, cytotoxicity, and stability.

[0074] Example 4: Immunogenicity evaluation of mRNA vaccine in a mouse model

[0075] Experimental animals: Female BALB / c mice, 6 - 8 weeks old, weighing 18 - 22 g, purchased from the Experimental Animal Center of the Chinese Academy of Sciences, with 10 mice in each group.

[0076] Dosing regimen: (1) Control group: Administered blank lipid nanoparticles (without mRNA); (2) Low-dose group of mRNA-FomA-1: 5 μg / kg body weight; (3) Medium-dose group of mRNA-FomA-1: 10 μg / kg body weight; (4) High-dose group of mRNA-FomA-1: 50 μg / kg body weight; (5) Low-dose group of mRNA-FomA-2: 5 μg / kg body weight; (6) Medium-dose group of mRNA-FomA-2: 10 μg / kg body weight; (7) High-dose group of mRNA-FomA-2: 50 μg / kg body weight; (8) Ultra-high-dose group of mRNA-FomA-2: 100 μg / kg body weight.

[0077] The administration route was intramuscular injection (in the quadriceps femoris of the hind leg). Each injection was given once every 2 weeks for a total of 3 times (on days 0, 14, and 28). Two weeks after the last administration (day 42), mouse sera and spleens were collected for immunological analysis.

[0078] The specific antibody titer against Fusobacterium nucleatum FomA protein in serum was determined by enzyme-linked immunosorbent assay (ELISA). The specific steps are as follows: (1) Antigen coating: a. Coat a 96-well ELISA plate with recombinant FomA protein (5 μg / mL) and incubate overnight at 4°C; b. Wash 3 times with PBS containing 0.05% Tween-20 (PBST); c. Block with 5% skim milk powder and incubate at room temperature for 2 hours.

[0079] (2) Serum dilution and incubation: a. Serially dilute mouse serum 3-fold at 1:100, 1:300, 1:900, etc.; b. Add to the coated ELISA plate and incubate at room temperature for 2 hours; c. Wash 5 times with PBST.

[0080] (3) Detection and color development: a. Add horseradish peroxidase (HRP)-labeled goat anti-mouse IgG antibody (diluted 1:5000) and incubate at room temperature for 1 hour; b. Wash 5 times with PBST; c. Add TMB substrate and incubate in the dark at room temperature for 15 minutes; d. Add 2M H2SO4 to terminate the reaction; e. Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay reader.

[0081] (4) Titer calculation: a. Plot a titer curve with the serum dilution factor as the abscissa and the OD450 value as the ordinate; b. Use 2.1 times the OD450 value of the negative control as the cut-off value; c. Define the maximum dilution factor when the serum dilution factor reaches the cut-off value as the antibody titer.

[0082] The antibody titers induced by different doses of mRNA vaccine are shown in Table 2: Table 2. Antibody titers induced by different doses of mRNA vaccine Group Antibody titer Control group <100 Low-dose group of mRNA-FomA-1 450±80 Medium-dose group of mRNA-FomA-1 1200±200 High-dose group of mRNA-FomA-1 3500±500 Low-dose group of mRNA-FomA-2 950±150 Medium-dose group of mRNA-FomA-2 2800±400 High-dose group of mRNA-FomA-2 4800±600 Ultra-high-dose group of mRNA-FomA-2 5200±700 The results showed that both mRNA vaccines could induce significant antibody responses, and showed an obvious dose-dependence. At the same dose, the antibody titer induced by mRNA-FomA-2 was significantly higher than that of mRNA-FomA-1. Especially at the medium dose (10 μg / kg), the antibody titer of mRNA-FomA-2 was 2.33 times that of mRNA-FomA-1. In addition, mRNA-FomA-2 was close to the maximum effect at a dose of 50 μg / kg. Further increasing the dose to 100 μg / kg only increased the antibody titer from 4800 ± 600 to 5200 ± 700, with an increase of 8.3%.

[0083] Mouse spleen cells were isolated and the T cell responses were evaluated by flow cytometry and enzyme-linked immunospot assay after in vitro stimulation. The specific steps are as follows: (1) Isolation of spleen cells: a. The spleens of mice were removed under sterile conditions and placed in RPMI 1640 medium containing 10% fetal bovine serum; b. The spleens were ground using a 70 μm cell strainer to prepare a single cell suspension; c. Treated with red blood cell lysate for 5 minutes to remove red blood cells; d. Washed twice with PBS and the cell concentration was adjusted to 2×10^6 cells / mL.

[0084] (2) In vitro antigen stimulation: a. The spleen cells were seeded in 24-well plates, 1 mL per well (2×10^6 cells); b. Stimulated with recombinant FomA protein (10 μg / mL) and cultured at 37 °C and 5% CO2 for 48 hours; c. The negative control was PBS, and the positive control was PMA (50 ng / mL) + ionomycin (1 μg / mL).

[0085] (3) Analysis of T cell activation by flow cytometry: a. The stimulated cells were collected and washed twice with PBS; b. Fluorescently labeled antibodies were added: anti-CD3-FITC, anti-CD4-PE, anti-CD8-APC, anti-CD69-PE-Cy7, anti-CD25-PerCP-Cy5.5, and incubated at 4 °C in the dark for 30 minutes; c. Washed twice with PBS and resuspended in 200 μL PBS; d. Analyzed using a BD FACSCanto II flow cytometer, and at least 10,000 CD3+ events were collected for each sample; e. Analyze the expression of CD69 and CD25 in CD4+ and CD8+ T cells using FlowJo software.

[0086] (4) Measurement of interferon-γ secretion by enzyme-linked immunospot assay (ELISPOT): a. Use a mouse IFN-γ ELISPOT kit (BD Biosciences, catalog number 551083); b. Coat the ELISPOT plate with anti-IFN-γ capture antibody and incubate overnight at 4°C; c. Block with complete medium and incubate at 37°C for 2 hours; d. Add splenocytes (2×10^5 cells / well) and recombinant FomA protein (10 μg / mL) and culture at 37°C for 24 hours; e. After washing, add biotinylated anti-IFN-γ detection antibody and incubate at room temperature for 2 hours; f. After washing, add streptavidin-HRP and incubate at room temperature for 1 hour; g. Add AEC substrate for color development, count the number of spots, and the results are expressed as the number of spots per 10^6 cells.

[0087] The T cell responses induced by different doses of mRNA vaccines are shown in Table 3: Table 3. T cell responses induced by different doses of mRNA vaccines Group CD4+CD69+ (%) CD8+CD69+ (%) Number of IFN-γ spots / 10^6 cells Control group 5.2±1.0 4.8±0.9 15±5 Low-dose group of mRNA-FomA-1 12.5±2.0 10.8±1.8 85±15 Medium-dose group of mRNA-FomA-1 18.6±2.5 15.5±2.2 180±25 High-dose group of mRNA-FomA-1 25.8±3.0 22.4±2.8 320±40 Low-dose group of mRNA-FomA-2 18.2±2.5 15.6±2.2 160±25 Medium-dose group of mRNA-FomA-2 28.5±3.2 24.8±3.0 380±45 High-dose group of mRNA-FomA-2 38.6±4.0 35.2±3.8 650±70 Ultra-high-dose group of mRNA-FomA-2 40.2±4.2 36.5±4.0 680±75 The results showed that both mRNA vaccines could induce significant T cell responses and showed an obvious dose-dependence. At the same dose, the degree of T cell activation and the level of IFN-γ secretion induced by mRNA-FomA-2 were significantly higher than those of mRNA-FomA-1. Especially at the medium dose (10 μg / kg), the number of IFN-γ spots induced by mRNA-FomA-2 was 2.11 times that of mRNA-FomA-1. In addition, mRNA-FomA-2 was close to the maximum effect at a dose of 50 μg / kg, and further increasing the dose to 100 μg / kg only slightly enhanced the T cell response (the number of IFN-γ spots increased by 4.6%).

[0088] Evaluate the killing activity of cytotoxic T lymphocytes (CTL) against target cells expressing FomA protein by lactate dehydrogenase (LDH) release assay. The specific steps are as follows: (1) Preparation of effector cells: a. Isolate a single cell suspension from the spleens of immunized mice; b. Isolate CD8+ T cells using a mouse CD8+ T cell isolation kit (Miltenyi Biotec); c. Co-cultured with recombinant FomA protein (10 μg / mL) and IL-2 (20 U / mL) for 48 hours to activate CD8+ T cells.

[0089] (2) Target cell preparation: a. Transfected the mouse breast cancer cell line 4T1 (ATCC CRL-2539) with an adenovirus vector to express the FomA protein; b. Verified the expression of the FomA protein by flow cytometry, with an expression rate > 90%; c. Inoculated the target cells into a 96-well plate, with 1 × 10^4 cells per well.

[0090] (3) Cytotoxicity assay: a. Added effector cells to target cells at different effector:target ratios (E:T = 5:1, 10:1, 20:1, 40:1); b. Co-cultured for 4 hours at 37°C and 5% CO2; c. Measured the LDH activity in the supernatant using the CytoTox 96 non-radioactive cytotoxicity detection kit (Promega, catalog number G1780); d. Specific lysis rate (%) = [(experimental group release - spontaneous release) / (maximum release - spontaneous release)] × 100%.

[0091] The CTL activities induced by different doses of the mRNA vaccine are shown in Table 4: Table 4. CTL activities induced by different doses of the mRNA vaccine (specific lysis rate %) Group E:T = 5:1 E:T = 10:1 E:T = 20:1 E:T = 40:1 Control group 1.8±0.5 3.5±1.0 5.2±1.5 7.8±2.0 Low-dose group of mRNA-FomA-1 5.5±1.0 10.2±1.8 15.6±2.5 22.5±3.0 Medium-dose group of mRNA-FomA-1 10.5±1.5 18.6±2.5 28.4±3.5 38.2±4.5 High-dose group of mRNA-FomA-1 18.2±2.5 32.5±4.0 45.2±5.0 58.5±6.5 Low-dose group of mRNA-FomA-2 9.5±1.5 16.8±2.5 25.8±3.0 35.5±4.0 Medium-dose group of mRNA-FomA-2 20.2±2.5 35.6±4.0 48.5±5.5 62.8±7.0 High-dose group of mRNA-FomA-2 28.5±3.5 48.2±5.5 65.0±7.0 78.5±8.5 Ultra-high-dose group of mRNA-FomA-2 30.2±3.5 50.5±6.0 67.5±7.5 80.2±9.0 The results showed that both mRNA vaccines could induce significant CTL activities, and presented obvious dose-dependence and effector:target ratio-dependence. At the same dose and effector:target ratio, the CTL activity induced by mRNA-FomA-2 was significantly higher than that of mRNA-FomA-1. Especially at a high dose (50 μg / kg) and E:T = 20:1, the specific lysis rate induced by mRNA-FomA-2 reached 65.0 ± 7.0%, while that of mRNA-FomA-1 was 45.2 ± 5.0%. In addition, mRNA-FomA-2 was close to the maximum effect at a dose of 50 μg / kg, and further increasing the dose to 100 μg / kg only slightly enhanced the CTL activity (about 3.8%).

[0092] Based on the above immunogenicity evaluation results, we determined that mRNA-FomA-2 had the best immunogenicity at a dose of 50 μg / kg and selected it as the preferred protocol for subsequent treatment experiments.

[0093] Example 5: Evaluation of the Therapeutic Effect of mRNA Vaccine in a Mouse Model of Esophageal Squamous Cell Carcinoma

[0094] First, establish a mouse model of esophageal squamous cell carcinoma enriched with Fusobacterium nucleatum: (1) Experimental animals: Female C57BL / 6 mice, 6 - 8 weeks old, weighing 18 - 22 g, purchased from the Experimental Animal Center of the Chinese Academy of Sciences.

[0095] (2) Culture of Fusobacterium nucleatum: a. Use the standard strain of Fusobacterium nucleatum ATCC 25586; b. Under anaerobic conditions (85% N2, 10% H2, 5% CO2), use modified Schaedler broth medium (containing 5% sheep blood) and culture at 37°C for 48 hours; c. Collect the bacterial cells, wash them twice with PBS, adjust the concentration to 1×10^9 CFU / mL, and measure by spectrophotometer (OD600 = 0.5 is equivalent to approximately 1×10^8 CFU / mL).

[0096] (3) Colonization of Fusobacterium nucleatum: a. Randomly divide the mice into two groups, with 30 mice in each group; b. Mice in the experimental group were orally administered with Fusobacterium nucleatum suspension (0.2 mL, 2×10^8 CFU / mouse) once a day for 2 weeks; c. Mice in the control group were given an equal volume of sterile PBS.

[0097] (4) Inoculation of esophageal squamous cell carcinoma cells: a. Use the mouse esophageal squamous cell line NMEC (provided by the Cell Bank of the Chinese Academy of Sciences, accession number SCSP - 5095), and culture it in DMEM medium containing 10% FBS; b. After two weeks, both groups of mice were subcutaneously inoculated with NMEC cells (5×10^6 cells / mouse) on the right abdomen.

[0098] (5) Verification of Fusobacterium nucleatum abundance: a. On the 7th day after inoculating tumor cells, randomly select 5 mice from each group and collect tumor tissues; b. Use QIAamp DNA Mini Kit (Qiagen, catalog number 51304) to extract tissue DNA; c. Use SYBR Green PCR Master Mix (Applied Biosystems, catalog number 4309155) for quantitative PCR; d. Use specific primers for the Fusobacterium nucleatum 16S rRNA gene (forward primer: 5'-CAACCATTACTTTAACTCTACCATGTTCA-3', reverse primer: 5'-GTTGACTTTACAGAAGGAGATTATGTAAAAATC-3'); e. Use the total bacterial 16S rRNA gene as an internal reference (forward primer: 5'-ACTCCTACGGGAGGCAGCAGT-3', reverse primer: 5'-ATTACCGCGGCTGCTGGC-3'); f. The PCR conditions are 10 minutes at 95°C, followed by 40 cycles (15 seconds at 95°C, 1 minute at 60°C); g. Calculate the relative abundance using the 2^(-ΔΔCt) method.

[0099] The results showed that the relative abundance of Fusobacterium nucleatum in the tumor tissues of the experimental group mice was 5.8 ± 0.8 times that of the control group, confirming the successful establishment of a mouse model of esophageal squamous cell carcinoma enriched with Fusobacterium nucleatum.

[0100] To verify the rationality of the definition of "Fusobacterium - enriched esophageal squamous cell carcinoma" (the relative abundance of Fusobacterium nucleatum is more than 3 times higher than that of normal tissues), we conducted the following experiments: (1) Experimental grouping: a. Divide the experimental group mice into three subgroups according to the relative abundance of Fusobacterium nucleatum in the tumor tissues: - Low - abundance group: The relative abundance is 1 - 3 times that of normal tissues; - Medium - abundance group: The relative abundance is 3 - 5 times that of normal tissues; - High - abundance group: The relative abundance is more than 5 times that of normal tissues.

[0101] b. There are 10 mice in each subgroup.

[0102] (2) Treatment plan: a. When the tumor volume reaches approximately 100 mm^3, each subgroup of mice is given the mRNA - FomA - 2 vaccine (50 μg / kg body weight), once every 2 weeks for a total of 3 times; b. The control group is given blank lipid nanoparticles.

[0103] (3) Efficacy evaluation: a. Measure the tumor volume once every 3 days: Volume (mm^3)=Length × Width^2 × 0.5; b. After the treatment is completed (2 weeks after the last administration), sacrifice the mice and collect the tumor tissues for analysis.

[0104] The treatment effects of different Fusobacterium nucleatum abundance subgroups are shown in Table 5: Table 5. Treatment effects of different Fusobacterium nucleatum abundance subgroups Group Tumor volume reduction rate (%) Reduction rate of Fusobacterium nucleatum abundance (%) Increase multiple of CD8+ T cell infiltration Low-abundance group 15.2±3.5 25.5±5.0 1.3±0.2 Medium-abundance group 38.5±5.0 58.6±7.0 2.2±0.3 High-abundance group 52.8±6.5 72.4±8.0 3.0±0.4 Control group 0 (reference) 0 (reference) 1.0 (reference) The results showed that the treatment effect of the mRNA vaccine was positively correlated with the abundance of Fusobacterium nucleatum in tumor tissues. When the abundance of Fusobacterium nucleatum was more than 3 times higher than that in normal tissues, the treatment effect was significantly enhanced, and the tumor volume reduction rate increased from 15.2 ± 3.5% to more than 38.5 ± 5.0%. This result supported the rationality of the definition of "Clostridium-enriched esophageal squamous cell carcinoma", that is, the relative abundance of Fusobacterium nucleatum was more than 3 times higher than that in normal tissues.

[0105] Based on the above results, we further evaluated the combined treatment effect of the mRNA vaccine and immune checkpoint inhibitors: (1) Experimental grouping: a. Mice with high abundance of Fusobacterium nucleatum (relative abundance > 5 times) were randomly divided into the following treatment groups, with 10 mice in each group: - Control group: Given blank lipid nanoparticles; - mRNA-FomA-2 group: Given 50 μg / kg body weight of mRNA-FomA-2, once every 2 weeks for a total of 3 times; - PD-1 inhibitor group: Given anti-PD-1 antibody (200 μg / mouse), once every 3 days for a total of 6 times; - mRNA + PD-1 combination group: First given mRNA-FomA-2 (same as the second group's protocol), and 2 weeks later, combined with anti-PD-1 antibody (same as the third group's protocol).

[0106] (2) Efficacy evaluation: a. Measure the tumor volume once every 3 days; b. After the treatment was completed (2 weeks after the last administration), the mice were sacrificed, and tumor tissues were collected for analysis; c. The treatment effect was evaluated according to the RECIST 1.1 standard. The tumor volume was measured weekly using a small animal MRI (Bruker BioSpec 7.0T). Complete remission (CR) was defined as the disappearance of all target lesions, partial remission (PR) was defined as a reduction of at least 30% in the sum of the longest diameters of the tumors, and the objective remission rate = the proportion of patients with CR + PR.

[0107] The comparison of the efficacy of different treatment groups is shown in Table 6: Table 6. Comparison of the efficacy of different treatment groups Group Tumor volume reduction rate (%) Objective response rate (%) Reduction rate of Fusobacterium nucleatum abundance (%) Control group 0 (reference) 0 (0 / 10) 0 (reference) mRNA-FomA-2 group 45.2±5.5 20 (2 / 10) 65.5±7.5 PD-1 inhibitor group 55.0±6.5 30 (3 / 10) 15.2±3.0 mRNA + PD-1 combination group 78.5±8.0 70 (7 / 10) 72.0±8.0 The results showed that the combination therapy of mRNA vaccine and PD-1 inhibitor exhibited significant synergistic effects. The objective response rate of the combination therapy group reached 70% (7 / 10), which was 2.33 times that of the group using PD-1 inhibitor alone. In addition, the reduction rate of Fusobacterium nucleatum abundance in the combination therapy group was similar to that in the group using mRNA vaccine alone, indicating that the mRNA vaccine played a key role in the combination therapy.

[0108] To understand the mechanism of action of the mRNA vaccine, we conducted a detailed analysis of the tumor microenvironment: (1) Tumor-infiltrating lymphocyte analysis: a. Digest the tumor tissue into single-cell suspensions; b. Analyze the proportions of CD4+ T cells, CD8+ T cells, regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), M1-type and M2-type macrophages using flow cytometry; c. Label with the following antibodies: anti-CD3-FITC, anti-CD4-PE, anti-CD8-APC, anti-Foxp3-PE-Cy7, anti-CD11b-FITC, anti-Gr-1-PE, anti-F4 / 80-APC, anti-CD86-PE-Cy7, anti-CD206-PerCP-Cy5.5.

[0109] (2) Cytokine analysis: a. Homogenize the tumor tissue and extract proteins; b. Determine the levels of 23 cytokines using multiplex cytokine detection technology (Bio-Plex Pro Mouse Cytokine 23-plex Assay).

[0110] (3) Immunohistochemical analysis: a. Prepare paraffin sections of the tumor tissue; b. Perform immunohistochemical staining using anti-CD8, anti-Granzyme B, anti-PD-1, and anti-PD-L1 antibodies; c. Observe and photograph using a microscope, and perform quantitative analysis using Image J software.

[0111] The comparison of the tumor microenvironment in different treatment groups is shown in Table 7: Table 7. Comparison of the tumor microenvironment in different treatment groups Group CD8+ T cells (%) Treg (%) M1 / M2 ratio IL-12 (pg / mg) IL-10 (pg / mg) Control group 5.2±1.0 15.5±2.0 0.5±0.1 25±5 120±15 mRNA-FomA-2 group 14.5±2.0 8.2±1.5 1.2±0.2 65±10 75±10 PD-1 inhibitor group 11.5±1.5 12.0±1.8 0.8±0.1 40±8 95±12 mRNA + PD-1 combination group 18.8±2.5 6.5±1.0 1.8±0.3 85±12 55±8 The results showed that after mRNA vaccine treatment, the tumor microenvironment changed from an immunosuppressive type to an immune-activated type, manifested as an increase in CD8+ T cells, a decrease in Tregs, an increase in the M1 / M2 ratio, an elevated level of pro-inflammatory cytokines (such as IL-12), and a reduced level of inhibitory cytokines (such as IL-10). This microenvironment remodeling effect created favorable conditions for subsequent immune checkpoint inhibitor treatment, explaining the synergistic effect of combination therapy.

[0112] To determine the optimal combination therapy regimen, we compared different combination strategies: (1) Concurrent administration: Initiate mRNA-FomA-2 and PD-1 inhibitor treatment simultaneously; (2) Sequential administration (mRNA first): Administer mRNA-FomA-2 first, and start PD-1 inhibitor treatment 2 weeks later; (3) Sequential administration (PD-1 first): Administer PD-1 inhibitor first, and start mRNA-FomA-2 treatment 2 weeks later.

[0113] The results showed that the objective response rate of the sequential administration (mRNA first) regimen was 70±5%, significantly higher than that of the concurrent administration regimen (50±5%, p<0.05) and the sequential administration (PD-1 first) regimen (35±4%, p<0.01). This result indicates that first using the mRNA vaccine to change the tumor microenvironment and then using the immune checkpoint inhibitor to relieve T cell exhaustion is the optimal combination therapy strategy.

[0114] Analysis by single-cell RNA sequencing demonstrated that the superiority of the sequential administration (mRNA first) regimen stemmed from a time-sequence-dependent immune remodeling process. The single-cell RNA sequencing results showed that the mRNA vaccine first reduced the abundance of Fusobacterium nucleatum (reaching the lowest point at 7 - 14 days), and subsequently caused significant changes in the composition of immune cells in the tumor microenvironment. At 14 days after mRNA vaccine administration, the proportion of the effector memory subset (CD44+CD62L-) in CD8+ T cells increased from 12.5±2.0% to 28.5±3.5%, and the proportion of exhausted T cells (PD-1+Tim3+) decreased from 35.5±4.0% to 22.5±3.0%. Meanwhile, the proportion of M1 macrophages (CD86+CD206-) increased from 18.5±2.5% to 32.5±3.5%, and the proportion of M2 macrophages (CD86-CD206+) decreased from 38.5±4.0% to 25.5±3.0%. This immune microenvironment remodeling was completed at 14 - 21 days, creating favorable conditions for subsequent PD-1 inhibitors. Concurrent administration or administration of PD-1 inhibitor first could not achieve this time-sequence-dependent synergistic effect because the effect of PD-1 inhibitor in the immunosuppressive microenvironment was limited, and it was necessary to first reduce the abundance of Fusobacterium nucleatum through the mRNA vaccine and change the tumor microenvironment to give full play to its role.

[0115] Example 6: Safety Evaluation of mRNA Vaccine in Humanized Mouse Model Experimental animals: 8 - 10 - week - old NOD - scid - IL2Rγnull (NSG - SGM3) mice, purchased from Jackson Laboratory, 8 mice in each group.

[0116] Humanization process: (1) Collect peripheral blood from 5 healthy volunteers and isolate PBMCs using Ficoll - Paque density gradient centrifugation method; (2) Inject PBMCs (1×10^7 cells / mouse) into NSG - SGM3 mice via the tail vein; (3) Two weeks after transplantation, detect the proportion of human CD45+ cells in the peripheral blood of mice by flow cytometry to confirm successful humanization (the proportion of human CD45+ cells > 25%).

[0117] Drug administration plan: (1) Control group: Administer blank lipid nanoparticles; (2) Low - dose group of mRNA - FomA - 2: 10 μg / kg body weight; (3) Medium - dose group of mRNA - FomA - 2: 50 μg / kg body weight; (4) High - dose group of mRNA - FomA - 2: 100 μg / kg body weight.

[0118] Safety evaluation: (1) General condition observation: a. Observe the general condition of mice every day, including body weight, diet, activity level, etc.; b. Measure the body weight once every 3 days; c. Record the occurrence and severity of any adverse reactions.

[0119] (2) Hematological examination: a. Collect orbital venous blood from mice 1 day and 7 days after the last drug administration; b. Conduct a complete blood count, including white blood cell count, red blood cell count, platelet count, hemoglobin, etc.; c. Conduct blood biochemical examination, including liver function (ALT, AST), kidney function (BUN, Cr), etc.

[0120] (3) Histopathological examination: a. Sacrifice the mice 14 days after the last drug administration and collect the main organs (heart, liver, spleen, lung, kidney); b. Prepare paraffin sections of tissues and perform HE staining; c. Conduct blinded evaluation by pathologists to observe whether there are pathological changes.

[0121] (4) Cytokine storm evaluation: a. Collect orbital venous blood from mice at 0, 2, 6, 12, 24, and 48 hours after the first administration; b. Use multiplex cytokine detection technology to measure the levels of inflammatory factors such as IL-6, TNF-α, IL-1β, IFN-γ, IL-2, and IL-10 in serum.

[0122] (5) Autoimmune response evaluation: a. Collect mouse serum 14 days after the last administration; b. Detect the levels of antinuclear antibody (ANA) and anti-double-stranded DNA antibody (anti-dsDNA) in serum by ELISA; c. Detect whether there are autoantibodies against human tissues in serum by immunofluorescence.

[0123] The safety evaluation results are shown in Table 8: Table 8. Safety evaluation of mRNA vaccines at different doses Evaluation index Control group Low-dose group of mRNA-FomA-2 Medium-dose group of mRNA-FomA-2 High-dose group of mRNA-FomA-2 Body weight change (%) +2.5±1.0 +2.0±0.9 +1.5±0.8 +0.8±0.5 Change in white blood cell count (%) +5.2±2.0 +7.5±2.5 +12.5±3.5 +18.5±4.0 ALT increase (fold) 1.0±0.1 1.1±0.1 1.3±0.2 1.5±0.3 AST increase (fold) 1.0±0.1 1.1±0.1 1.2±0.2 1.4±0.3 Pathological change No obvious abnormality No obvious abnormality Mild splenomegaly Mild splenomegaly and hepatocyte swelling Peak value of IL-6 (pg / mL) 25±5 65±10 120±20 180±30 Peak value of TNF-α (pg / mL) 15±3 35±6 65±10 95±15 Positive rate of autoantibody detection (%) 0 (0 / 8) 0 (0 / 8) 12.5 (1 / 8) 25 (2 / 8) The results showed that within the therapeutic dose range (10 - 50 μg / kg body weight), the mRNA vaccine had good safety and no obvious toxic reactions were observed. In the medium-dose group of mRNA-FomA-2, mild splenomegaly occurred in mice, which might be related to immune activation but had no pathological significance. The levels of inflammatory factors in serum reached the peak at 6 - 12 hours after administration but returned to normal within 24 - 48 hours. At a high dose (100 μg / kg), mild hepatocyte swelling and a higher positive rate of autoantibodies were observed, indicating that there might be certain safety risks.

[0124] In vivo tracking experiments showed that the expression level of injected mRNA reached the peak within 24 ± 3 hours and dropped below the detection limit after 72 ± 6 hours, while the generated antibody titer could be maintained for more than 8 ± 1 weeks. This characteristic of transient mRNA expression and persistent immune response provided a guarantee for the safety of mRNA vaccines.

[0125] Overall, the mRNA vaccine had good safety and tolerance at a dose of 50 μg / kg and was suitable for further clinical research.

Claims

1. An mRNA vaccine targeting the membrane protein FomA of Fusobacterium nucleatum, characterized in that: The mRNA vaccine contains a nucleotide sequence encoding a specific epitope of the Fusobacterium nucleatum membrane protein FomA, wherein the specific epitope contains 1-10 "GGSGGGGSGG" repeating sequences, and the sequence homology of the repeating sequences in different Fusobacterium nucleatum strains is greater than 95%; the mRNA is encapsulated in lipid nanoparticles, the particle size of the lipid nanoparticles is 80-150nm, and the polydispersity coefficient is less than 0.3, which is determined by dynamic light scattering.

2. The mRNA vaccine according to claim 1, characterized in that The specific epitope is selected from the following sequences: (a) FomA protein fragment 1 comprising 3 "GGSGGGGSGG" repeating sequences, whose amino acid sequence is SEQ ID NO: 1; or (b) FomA protein fragment 2 comprising 7 "GGSGGGGSGG" repeating sequences, whose amino acid sequence is SEQ ID NO:

2.

3. The mRNA vaccine according to claim 1, characterized in that The mRNA comprises a 5' cap structure, a 5' untranslated region, an open reading frame encoding a specific epitope of the membrane protein FomA of Fusobacterium nucleatum, a 3' untranslated region and a poly (A) tail; wherein the 5' cap structure is an m7G cap structure, the m7G cap structure is connected to the 5' end of the mRNA via a 5'-5' triphosphate bond, and the methylation degree of the cap structure is above 95%, which is determined by high performance liquid chromatography.

4. The mRNA vaccine according to claim 3, characterized in that The 5' untranslated region is selected from human β-globulin 5'UTR, human α-globulin 5'UTR or lemongrass citronellol synthase 5'UTR; the 5' untranslated region comprises a Kozak sequence, and the sequence is 5'-GCCACC-3'.

5. The mRNA vaccine according to claim 3, characterized in that The 3' untranslated region is selected from human β-globulin 3'UTR, human α-globulin 3'UTR or human growth hormone 3'UTR; the 3' untranslated region contains an AU-rich element, and the sequence is a 5'-AUUUA-3' repeating sequence.

6. The mRNA vaccine according to claim 1, characterized in that The lipid nanoparticles contain the following components and their mass ratios: 38-42% of cationic lipids, 18-22% of neutral lipids, 33-37% of cholesterol and 3-5% of PEG-modified lipids; wherein the cationic lipids are selected from DOTAP, DOTMA or ionized MC3, the neutral lipids are selected from DOPE, DSPC or DOPC, and the PEG-modified lipids are selected from DMG-PEG2000 or DSPE-PEG2000; the mRNA encapsulation rate of the lipid nanoparticles is 85-95%, which is determined by RiboGreen fluorescence quantitative method.

7. A method for preparing the mRNA vaccine according to any one of claims 1 to 6, characterized in that: The following steps are involved: Step 1: design and synthesize a nucleotide sequence encoding a specific epitope of the membrane protein FomA of Fusobacterium nucleatum; Step 2: construct a DNA template containing the nucleotide sequence, wherein the DNA template comprises a T7 promoter sequence, a 5'UTR sequence, an open reading frame encoding a specific epitope of FomA, a 3'UTR sequence and a poly(A) tail sequence; Step 3: synthesize mRNA from the DNA template using an in vitro transcription technique, wherein the in vitro transcription reaction is carried out at 37±1°C for 2-4 hours, and the reaction system comprises 1-5 μg / mL linearized DNA template, 7.5-10 mM ribonucleoside triphosphate mixture, 40-60 U / mL T7 RNA polymerase, 1-2U / μLRNase inhibitor and 5-10mM dithiothreitol; Step 4: Purify the mRNA by gel filtration chromatography or high performance liquid chromatography, the purity of the purified mRNA is greater than 95%, and is analyzed by denaturing agarose gel electrophoresis; Step 5: Mix the mRNA with the lipid component, and prepare lipid nanoparticles encapsulating the mRNA by microfluidic technology, wherein the microfluidic technology uses an aqueous phase and an organic phase with a flow rate ratio of 1:3-1:5, and a mixing temperature of 20-30°C. After mixing, dialysis or tangential flow filtration is immediately performed to remove the organic solvent; Step 6: Prepare the lipid nanoparticles into a pharmaceutical preparation, the osmotic pressure of the preparation is 280-320mOsm / kg, the pH value is 7.2-7.6, and the endotoxin content is less than 0.5EU / mL, which is determined by the horseshoe crab reagent method.

8. The method according to claim 7, characterized in that The in vitro transcription reaction in step three adopts co-transcription capping technology, using CleanCap® reagent, and the capping efficiency is greater than 95%; the step four adopts a two-step tandem chromatography purification strategy, including DEAE anion exchange chromatography and gel filtration chromatography, so that the mRNA purity reaches more than 98% and the dsRNA impurity content is less than 0.1%.

9. Use of the mRNA vaccine according to any one of claims 1 to 6 in the preparation of a drug for treating Clostridium-enriched esophageal squamous cell carcinoma, wherein Clostridium-enriched esophageal squamous cell carcinoma refers to a relative abundance of Fusobacterium nucleatum in the patient's tumor tissue that is more than 3 times higher than that in normal tissue, as determined by quantitative PCR, using specific primers for the 16S rRNA gene of Fusobacterium nucleatum, the forward primer is 5'-CAACCATTACTTTAACTCTACCATGTTCA-3', the reverse primer is 5'-GTTGACTTTACAGAAGGAGATTATGTAAAAATC-3', and the total bacterial 16S rRNA gene is used as an internal reference, and calculated according to the 2^(-ΔΔCt) method, wherein ΔΔCt = [Ct(16S rRNA of Fusobacterium nucleatum in tumor tissue) - Ct(total 16S rRNA of bacteria in tumor tissue)] - [Ct(16S rRNA of Fusobacterium nucleatum in normal tissue) - Ct(total 16S rRNA of bacteria in normal tissue) rRNA)], and this calculation can be used to obtain the relative abundance of Fusobacterium nucleatum in tumor tissue relative to that in normal tissue.

10. The use according to claim 9, characterized in that: The drug is used in combination with an immune checkpoint inhibitor, wherein the combination regimen is to first administer 50 μg / kg body weight of mRNA vaccine once every 2 weeks for a total of 3 times, and then administer a standard dose of immune checkpoint inhibitor starting from the 6th week, once every 3 weeks for a total of 4 times; the immune checkpoint inhibitor is selected from at least one of PD-1 inhibitors, PD-L1 inhibitors and CTLA-4 inhibitors, the PD-1 inhibitor is selected from nivolumab, pembrolizumab or carrelizumab, the PD-L1 inhibitor is selected from atezolizumab or durvalumab, and the CTLA-4 inhibitor is ipilimumab.

Images