Low-immunogenicity engineered cell as well as preparation method and application thereof

Abstract

The invention discloses an engineered cell with low immunogenicity as well as a preparation method and application of the engineered cell. The expression level of the B2M gene, the CIITA gene, the CD54 gene and the CD58 gene of the engineered cell is lower than that of a wild type cell or is not expressed, so that the sensitivity of the engineered cell to T cells and NK cells is reduced, and the application of the engineered cell in cell therapy is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of cell therapy, and particularly to an engineered cell with low immunogenicity, a preparation method thereof, and an application thereof. Background Art

[0002] Tumors and cancers have become important areas of human concern. Currently, methods such as radiotherapy or chemotherapy are usually used to treat tumor or cancer diseases. However, for some severely ill patients, the expected therapeutic effects are often not achieved. Cell therapy is usually referred to as an advanced therapeutic medicine, which has played a good therapeutic effect in the treatment of some severe malignant tumors. At the same time, it also faces a series of problems such as high price, complex production process, long production cycle, and high production cost.

[0003] Recently, allogeneic cells have emerged, also known as low immunogenicity cells, or off-the-shelf cells, which can significantly reduce the treatment cost of patients and save production time, becoming a popular research direction for many researchers in this field. The development of allogeneic cells inevitably needs to solve the problem of immune rejection. The immune rejection between allogeneic cells and recipient tissues mainly comes from the compatibility of MHC molecules. MHC molecules are also known as human leukocyte antigens (HLA), including HLA class I (HLA-A, HLA-B, and HLA-C) and class II molecules (HLA-DP, HLA-DM, HLA-DO, HLA-DQ, and HLA-DR). In order to avoid transplant rejection, TALEN and CRISPR / Cas9 are usually used in the prior art to inhibit the expression of HLA class I and class II molecules to reduce the immunogenicity of allogeneic cells. Gene editing tools are one of the commonly used tools in the preparation process of allogeneic cells.

[0004] The CRISPR / Cas9 gene editing system has increasingly become one of the most commonly used gene editing tools due to its high cutting efficiency and simple operation. The CRISPR gene editing system mainly uses site-specific Cas nucleases, such as Cas9, to generate DSBs at corresponding target sites in the genome of target cells, and then the broken double strands are repaired by mechanisms such as the cell's own non-homologous end joining (NHEJ) or homologous recombination repair (HDR), thereby achieving the editing of target genes. Although the CRISPR gene editing technology has broad application prospects in many aspects such as disease treatment, gene modification, and drug development, sgRNA and Cas9 proteins also have problems such as off-target effects, genotoxicity, and cytotoxicity due to their different activities and abilities to recognize sites. Moreover, once off-target occurs, it may cause irreversible damage to the cell's genome and affect the normal survival of the cells. In this process, the selection and design of sgRNA play a crucial role. The prior art has disclosed that base mutations can be introduced into sgRNA to reduce off-target effects, but this mutation pattern also reduces gene editing activity and editing efficiency. For allogeneic cells, selecting a suitable gene editing system during the preparation process becomes a key factor. Summary of the Invention

[0005] Through a large number of experiments, the inventors of the present invention unexpectedly found that simultaneously knocking out the B2M gene, CIITA gene, CD54 gene, and CD58 gene in the cell genome can significantly reduce the immunogenicity of the cells. Based on this, the present invention was completed.

[0006] In a first aspect, the present invention provides an engineered cell with low immunogenicity, wherein the expression levels of the B2M gene, CIITA gene, CD54 gene, and CD58 gene in the cell are lower than those of wild-type cells or not expressed.

[0007] The "wild-type cell" herein refers to the corresponding wild-type cell before engineering. For example, compared with the induced pluripotent stem cells before engineering, the levels of B2M protein, CIITA protein, CD54 protein, and CD58 protein in the induced pluripotent stem cells after engineering are lower than those of the induced pluripotent stem cells before engineering, or the B2M protein, CIITA protein, CD54 protein, and CD58 protein are not expressed.

[0008] The B2M (β2 microglobulin) protein is a kind of MHC class I molecule and participates in the presentation of antigen peptides. There are two alleles at the B2M gene locus in eukaryotic cells, and in the specific embodiments disclosed in the present invention, a method of simultaneously knocking out both alleles is adopted.

[0009] CIITA (Class II Major Histocompatibility Complex Transactivator) protein, a type of MHC Class II molecule, is closely related to histocompatibility and immune response. Some wild-type cells may express CIITA upon stimulation or under certain conditions, but cells after gene knockout do not express CIITA under any circumstances, ensuring the low immunogenicity of the cells.

[0010] CD54 (Cluster of Differentiation 54) protein, also known as ICAM1 (Intercellular Adhesion Molecule 1), is a transmembrane glycoprotein that plays a key role in leukocyte migration and activation.

[0011] CD58 protein, also known as LFA-3, lymphocyte function-associated antigen 3, belongs to the CD2 family members. The CD58 molecule is widely distributed and is a cell surface glycoprotein belonging to the immunoglobulin superfamily members.

[0012] In some embodiments of the present invention, the cells are selected from induced pluripotent stem cells and their derivative cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells, NK cells, T cells, or islet cells and retinal pigment epithelial cells. In other embodiments of the present invention, the derivative cells of the induced pluripotent stem cells are T cells, NK cells, B cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells, or retinal pigment epithelial cells differentiated from the induced pluripotent stem cells, preferably mesenchymal stem cells.

[0013] Induced pluripotent stem cells, abbreviated as iPSCs or ipsc (Induced pluripotent stem cells), can be used interchangeably herein. MSC or MSCs, referring to mesenchymal stem cells, can be used interchangeably herein.

[0014] In some embodiments of the present invention, the B2M gene, CIITA gene, CD54 gene, and CD58 gene in the engineered cell genome are modified. Preferably, the modification is carried out by gene editing. The target binding sequences for the gene editing are respectively: the sequence GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1) or its complementary sequence in the B2M gene, the sequence GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2) or its complementary sequence in the CIITA gene, the sequence CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3) or its complementary sequence in the CD54 gene, and the sequence AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4) or its complementary sequence in the CD58 gene. As used herein, the "target binding sequence" refers to the sequence fragment in the target gene to which the gene editing tool binds, such as the target sequence of the Cas protein. If different Cas proteins are selected, it is possible that the target binding sequence is not the sequence to be edited, and the editing may also occur at the bases near the target binding sequence, which is determined by the type of Cas protein. As is known in the prior art, for a cell population (gene editing of non-single cells), the sequences after modification of different cells are also likely to be different. After targeted editing, several bases may be randomly inserted or deleted in the sequence, but all can achieve the "knockout" effect, resulting in the non-expression or abnormal expression of the target protein.

[0015] In other embodiments, different target binding sequences can be selected, as long as the expression levels of the B2M gene, CIITA gene, CD54 gene, and CD58 gene are lower than those of wild-type cells or not expressed, the technical effects of the present invention can be achieved.

[0016] In a second aspect, the present invention provides a method for preparing the cell described in the first aspect, including the step of gene editing the cell, and the gene editing is CRISPR / Cas gene editing.

[0017] The term "gene editing" refers to the editing (directed modification) of a target gene and its transcription product to achieve the addition, deletion of a specific DNA fragment, the deletion, replacement of specific DNA bases, etc., so as to change the sequence, expression level or function of the target gene or regulatory element. The CRISPR system mainly consists of the Cas9 protein and single-stranded guide RNA (sgRNA). Among them, the Cas9 protein plays a role in cleaving double-stranded DNA, and the sgRNA plays a guiding role. Under the guidance of the sgRNA, through the base complementary pairing principle, the Cas9 protein can cleave different target sites to achieve double-stranded DNA breakage. In addition to CRISPR / Cas9, the CRISPR system also has other Cas proteins, such as Cas12, Cas13, and Cas14.

[0018] In some embodiments, the gene editing simultaneously edits the B2M gene, the CIITA gene, the CD54 gene, and the CD58 gene, that is, the editing can complete the editing of the four genes with only one operation.

[0019] In some embodiments, the target binding sequences for the gene editing are respectively: the sequence GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1) in the B2M gene or its complementary sequence, the sequence GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2) in the CIITA gene or its complementary sequence, the sequence CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3) in the CD54 gene or its complementary sequence, and the sequence AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4) in the CD58 gene or its complementary sequence.

[0020] In some embodiments, the method of the present invention further includes a vector construction step. The vector expresses sgRNA1 GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1) targeting the B2M gene, sgRNA2 GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2) targeting the CIITA gene, sgRNA3 CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3) targeting the CD54 gene, and sgRNA4 AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4) targeting the CD58 gene. It can be expressed using one vector, or two, three, or four vectors. In a specific embodiment, the vector is the p4SG plasmid (SEQ ID NO: 5), which can express sgRNA1-4 in the examples of the present invention and express the Cas9 protein.

[0021] In a third aspect, the present invention provides a CRISPR / Cas gene editing system for simultaneously editing multiple gene loci, which includes a Cas protein and sgRNA, and the sgRNA includes sgRNA1, sgRNA2, sgRNA3, and sgRNA4.

[0022] In some embodiments, the Cas protein is the Cas9 protein, and sgRNA1, sgRNA2, sgRNA3, and sgRNA4 are respectively specific sgRNAs targeting the target sequences in the B2M gene, the CIITA gene, the CD54 gene, and the CD58 gene.

[0023] In a specific embodiment, the targeting binding sequences of the gene editing tools are respectively: the sequence GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1) in the B2M gene or its complementary sequence, the sequence GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2) in the CIITA gene or its complementary sequence, the sequence CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3) in the CD54 gene or its complementary sequence, and the sequence AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4) in the CD58 gene or its complementary sequence. In another specific embodiment, the sgRNAs are respectively sgRNA1 GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1), sgRNA2 GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2), sgRNA3 CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3), and sgRNA4 AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4). The sgRNAs targeting the four gene loci are completely complementary to the target sequences without setting mismatches, achieving a high gene editing efficiency.

[0024] In a fourth aspect, the present invention provides a vector or vector system based on the CRISPR / Cas gene editing system described in the third aspect, which expresses Cas protein and sgRNAs, and the sgRNAs include sgRNA1, sgRNA2, sgRNA3, and sgRNA4.

[0025] In a fifth aspect, the present invention provides a method for simultaneous editing of multiple genes, which uses the gene editing system described in the third aspect or the vector or vector system described in the fourth aspect.

[0026] In a sixth aspect, the present invention provides a composition, which comprises the cells described in the first aspect, the cells prepared by the method described in the second aspect, the gene editing system described in the third aspect, or the vector or vector system described in the fourth aspect.

[0027] In a seventh aspect, the present invention provides the application of the gene editing system described in the third aspect or the vector or vector system described in the fourth aspect in the preparation of engineered cells.

[0028] The inventors have proved through research that the above-mentioned B2M gene, CIITA gene, CD54 gene, and CD58 gene loci are safe loci, and the toxicity generated by gene editing is relatively low, ensuring the viability of cells.

[0029] The CRISPR / Cas gene editing system of the present invention realizes the simultaneous editing of the B2M locus, CIITA locus, CD54 locus and CD58 locus, achieving the simultaneous editing of four loci at one time, avoiding the damage to the cells themselves during multiple gene editing processes, and reducing the potential off-target toxicity caused by multiple editing.

[0030] In a specific embodiment of the present invention, the sgRNAs targeting the four loci are completely complementary to the target sequences without setting mismatches, achieving a high gene editing efficiency, ensuring a high cell survival rate, efficiently performing simultaneous editing of the four genes at one time, greatly shortening the production process and reducing the production cost.

[0031] In addition, the deletion of the four genes does not impair the pluripotency of iPSCs and their ability to differentiate into mesenchymal stem cells (iMSCs), demonstrating that the sequences GGCCGAGATGTCTCGCTCCG in the B2M locus, GCTGAACTGGTCGCAGTTGA in the CIITA locus, CGGGCTGTTCCCAGTCTCGG in the CD54 locus, and AAGCAATGTGCCTTTAAAAG in the CD58 locus as the targeting binding sequences of the CRISPR / Cas gene editing tool are safe sites that can be simultaneously edited, and no cytotoxicity problem occurs in MSCs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Showing the plasmid design schematic diagram in Example 1, where Figure 1 A is the scheme of the sgRNA expression element and the gRNA sequence, Figure 1 B is the schematic diagram of the plasmid (also known as p4SG plasmid) structure.

[0033] Figure 2 Showing the representative flow cytometry plots of the surface expression of CD54, CD58, HLA-A / B / C and HLA-DR / DP / DQ in wild-type iPSCs.

[0034] Figure 3 Showing the flow cytometry plots of CD54, CD58 and HLA-A / B / C of the mixed iPSCs edited with the plasmid p4SG.

[0035] Figure 4 Showing HLA-A / B / C - in the total cells and CD54 - CD58 - subpopulations after editing.

[0036] Figure 5Shows the expression of CD54, CD58, and HLA-A / B / C in the wild type and three selected clones in Example 2.

[0037] Figure 6 Shows the expression of HLA-DR / DP / DQ in the wild type and three clones in Example 2.

[0038] Figure 7 Shows the gene sequencing result fragments of CIITA in three clones in Example 2.

[0039] Figure 8 Shows the growth and marker comparison graphs of clone B23 and wild-type iPSCs. (A) Growth curves of B23 and WT iPSCs; (B) Representative flow cytometry plots of iPSC markers; (C) Karyotypes of B23 and wild-type iPSCs.

[0040] Figure 9 Shows the growth curves of B23-iMSCs and WT iMSCs.

[0041] Figure 10 Shows the flow cytometry plots of HLA-DR / CD34 / CD45-BV421 in B23-iMSCs and WT iMSCs.

[0042] Figure 11 Shows the flow cytometry plots of MSC markers in B23-iMSCs and WT iMSCs.

[0043] Figure 12 Shows the statistical data of well-conditioned iMSCs co-cultured with T cells in B23 iMSCs, with a ratio of B23 iMSCs to T cells of 1:3.

[0044] Figure 13 Shows the statistical data of well-conditioned iMSCs co-cultured with NK cells in B23 iMSCs, with a ratio of B23 iMSCs to NK cells of 1:5.

[0045] Figure 14 Shows the cell morphology graph of B23 iMSC after co-culture with NK cells. Detailed implementation manners

[0046] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0047] Although the numerical ranges and parameter approximations shown in the broad scope of the present invention, the numerical values shown in the specific embodiments are recorded as accurately as possible. However, any numerical value inherently necessarily contains certain errors, which are caused by the standard deviations existing in their respective measurements. In addition, all ranges disclosed herein should be understood to cover any and all sub-ranges subsumed therein. For example, the range described as "1 to 10" should be considered to include any and all sub-ranges between the minimum value 1 and the maximum value 10 (including the endpoints); that is, all sub-ranges starting from the minimum value 1 or greater, such as 1 to 6.1, and all sub-ranges ending with the maximum value 10 or less, such as 5.5 to 10. In addition, any reference cited as "incorporated herein" should be understood to be incorporated in its entirety. Examples

[0048] The following examples are only used to explain the present invention and do not limit the protection scope of the present invention. For the methods, steps, etc. not specifically described in the following examples, the methods, steps well known to those skilled in the art are adopted, or the operations are carried out according to the instructions of the commercially available products used. All experimental reagents used in the examples are commercially available products, and the same product has the same source in different processes or experimental steps.

[0049] The following further elaborates some preferred embodiments and aspects of the present invention in conjunction with specific embodiments, and should not be construed as limiting its scope. Example 1: Plasmid construction

[0050] In order to obtain engineered cells with lower immunogenicity, the present invention specifically selects the B2M, CIITA, CD54, and CD58 loci as the targets for gene editing. The specific locus IDs and targeting binding sequences are shown in Table 1.

[0051] Table 1

[0052] PAM is the abbreviation of protospacer adjacent motif and is related to the precise cleavage function of Cas9. Specifically, the CRISPR targeting specificity is determined by two parts. One part is the base pairing between the RNA chimera and the target DNA, and the other part is the Cas9 protein complex and a short DNA sequence, which usually acts at the 3′ end of the target DNA. The PAM sequence of the spCas9 protein is NGG, where N is any one of A, T, C, and G.

[0053] Design sgRNA sequences (without PAM) for editing the targeting binding sequences in the B2M, CIITA, CD54, and CD58 loci:

[0054] sgRNA1 (B2Mex1): GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1);

[0055] sgRNA2 (CIITAex3): GCTGAACTGGTCGCAGTTGA (SEQ ID NO: 2);

[0056] sgRNA3 (CD54ex4): CGGGCTGTTCCCAGTCTCGG (SEQ ID NO: 3);

[0057] sgRNA4 (CD58ex2): AAGCAATGTGCCTTTAAAAG (SEQ ID NO: 4).

[0058] Synthesize the above sgRNAs respectively and clone them between the Bbs1 restriction enzyme sites of the pX330 plasmid (Addgene, catalog number 42230), and combine with the original CAG promoter and the expression cassette of Streptococcus pyogenes Cas9 to form an editing plasmid (also referred to as the p4SG plasmid in this article, synthesized by Sangon Biotech (Shanghai) Co., Ltd.). The structural schematic diagram of the p4SG plasmid is as Figure 1 shown. The nucleotide sequence of the p4SG plasmid is as shown in SEQ ID NO: 5. In addition, the above four sgRNAs can also be directly used for subsequent experiments.

[0059] Meanwhile, in order to screen for higher editing efficiency and lower cytotoxicity, a mutant sgRNA was designed for the sgRNA targeting CD58. Specifically: mutate the 5th A to T and the 7th T to G. The mutated sequence is as follows: AAGCTAGGTGCCTTTAAAAG (SEQ ID NO: 6), and the plasmid synthesized using this mutant sgRNA is named p4SG-mut. The sequence of this plasmid is different from that of the p4SG plasmid only in the above two mutated bases, and the rest are the same. Example 2: Gene editing of iPSCs

[0060] The iPSCs were respectively transfected with the plasmid p4SG and the plasmid p4SG-mut in Example 1. The iPSCs (Chinese Academy of Sciences Stem Cell Bank, DYR0100) were cultured. When the confluence of the iPSCs reached 80%, the iPSCs were dissociated into single cells using TrypLE Select (ThermoFisher, catalog number 12563029). Then, 5 μg of the plasmids in Example 1 were respectively delivered into 3×10⁶ iPSCs using the Amaxa Human Stem Cell Nucleofection Kit (Lonza, catalog number VPH-5002). The nucleofection instrument 2b Device (Lonza) was used, and the program B-016 was applied. The nucleofected single cells were cultured in mTeSR (StemCell Technologies, catalog number 85850) medium supplemented with Y-27632 (STEM CELL, catalog number 72304) for 48 hours. Cells were collected at 1 day after nucleofection, and the proportion of HLA-A / B / C-CD54-CD58-HLA-DR / DP / DQ-negative cells and the cell viability in the cell population were detected. The cell number was detected using 0.4% trypan blue. The trypan blue dye can enter dead cells, making the cells appear light blue or dark blue, while live iPSCs reject the penetration of the dye and appear nearly colorless and have good refractive index under an optical microscope. It was found that the trypan blue-positive cells obtained in the p4SG plasmid group and the p4SG-mut plasmid group were close, indicating that the use of the p4SG-mut plasmid did not reduce cell death and failed to reduce potential cytotoxicity.

[0061] The cells were expanded in culture and then collected for flow cytometry analysis. The results showed that the percentage of HLA-A / B / C - CD54 - CD58 - HLA-DR / DP / DQ - (indicating that HLA-A / B / C, CD54, CD58, and HLA-DR / DP / DQ are all negative) cells in the total cell population was 1.2%, while this proportion in the p4SG-mut plasmid group was 0.7%. It can be seen that the unmutated sgRNA combination has a higher gene editing efficiency than the sgRNA combination containing mutations.

[0062] Based on the above results, subsequent experiments used the p4SG plasmid group as the research object. On the 7th day after nuclear transfection, cells were collected for flow cytometry sorting. To avoid including unnecessary markers or tags in cell therapy, the target molecule itself was used to distinguish edited iPSCs from unedited wild-type iPSCs. Flow cytometry analysis was performed on wild-type iPSCs and cells 7 days after nuclear transfection with plasmid p4SG. The expression levels of HLA-A / B / C, CD54, CD58, and HLA-DR / DP / DQ in wild-type iPSCs were as Figure 2 shown, among which, CD54, CD58, and HLA-A / B / C showed high levels, while HLA-DR / DP / DQ, an HLA-II membrane protein associated with CIITA, showed very low or undetectable levels. However, the mixed cells after nuclear transfection with plasmid p4SG had an obvious CD54 - CD58 - HLA-A / B / C - subpopulation (cell population not expressing CD54, CD58, and HLA-A / B / C), as Figure 3 shown.

[0063] To effectively and rapidly enrich edited iPSCs, CD54 - CD58 - HLA-A / B / C - subpopulation was purified from the mixed gene-edited cells. After sorting, the cells were allowed to recover for another 4 days, and the cells were separated into single cells. 5e3 cells per 10 cm culture dish (less than 100 cells / cm 2 ) were seeded for picking single-cell clones. Three clones were identified and named B23, A18, and C15, and the purity of each cell line was higher than 95%. Flow cytometry results showed that all three cloned cell lines lacked CD54, CD58, and HLA-a / B / C markers ( Figure 5 ), and remained negative for HLA-DR / DP / DQ ( Figure 6 ), demonstrating successful gene knockout. High-fidelity 2×Phanta Max Master Mix (Vazyme, catalog number P525-01) was used for further genotyping PCR and verified by Sanger sequencing. The PCR primers are shown in Table 2. The cell number was detected using a hematocytometer and trypan blue (0.4%). The results showed that the proportion of HLA-A / B / C in the CD54 - CD58 - subpopulation was significantly higher than that in the total cell population, exceeding 60%, as - shown, as Figure 4As shown, it can be seen that the 4 sgRNAs used in the embodiments of the present invention that are not misconfigured are completely complementary to the target binding sequence, have high gene editing activity, and demonstrate high editing efficiency during the simultaneous editing of 4 gene loci at one time.

[0064] Table 2

[0065] To confirm the results of targeted knockout of CIITA in these clones, Sanger sequencing was performed, showing deletions in the CIITA gene sequences in clones B23, A18, and C15 ( Figure 7 ). The above results prove that the use of the p4SG plasmid not only successfully prepared iPSCs with knockout of four genes, namely B2M, CIITA, CD54, and CD58 (referred to as 4SG iPPSC), but also each sgRNA was not misconfigured, ensuring low toxicity during the gene editing process, improving cell viability, not causing large-scale damage to iPPSC, and having a relatively high success rate of gene editing. Example 3: Differentiation of iPSCs into mesenchymal stem cells

[0066] Based on the results of Example 2, 4SG iPSC clone B23 was further selected for subsequent experiments. There were no significant changes in the morphology and growth rate between B23 and WT iPSC ( Figure 8 A). The pluripotency markers, including Klf4+Sox2+, Oct4+Lin28+, and SSEA4+, had a consistent SSEA1-negative expression profile in B23 and that in WT iPSC ( Figure 8 B). In addition, no significant abnormal karyotypes were found in either of them ( Figure 8C). It can be seen from this that iPSCs with four genes knocked out simultaneously using the p4SG plasmid have the characteristic of low toxicity. The activity of the edited cells shows no obvious difference from that of WT iPSCs, and their gene karyotypes and related markers are all consistent. Generally, the more times a cell undergoes gene editing and the more sites are edited, the more serious the off-target toxicity problem is, the more serious the damage to the cell genome is, and the greater the impact on cell survival and performance. The above results also show that the sequences of GGCCGAGATGTCTCGCTCCG in the B2M locus of iPSCs, GCTGAACTGGTCGCAGTTGA in the CIITA locus, CGGGCTGTTCCCAGTCTCGG in the CD54 locus, and AAGCAATGTGCCTTTAAAAG in the CD58 locus can be used as safe target binding sequences for CRISPR / Cas gene editing tools. Selecting to edit and knockout the expression of the corresponding genes at the above target binding sequences can achieve high gene editing efficiency and low toxicity, and does not affect cell activity. For iPSCs, knocking out the B2M, CIITA, CD54, and CD58 genes at the above sites is safe and has a relatively high editing efficiency, enabling simultaneous one-time knockout of four genes.

[0067] Given the increasingly widespread use of mesenchymal stem cells (MSCs) in the fields of regenerative medicine and cell therapy, in this example, 4SG iPSCs were further purposefully differentiated to form iMSCs. The differentiation process can refer to the existing technical literature (Z. Wang, H. Chen, P. Wang, M. Zhou, G. Li, Z. Hu, Q. Hu, J. Zhao, X. Liu, L. Wu, D. Liang, Site-Specific Integration of TRAIL in iPSC-Derived Mesenchymal Stem Cells for Targeted Cancer Therapy, Stem Cells Translational Medicine, 11(2022)297 - 309). In this example, STEMdiff was used to differentiate iPSCs into mesenchymal stem cells (STEM CELL, catalog number 05240). 1e5 iPSCs were seeded into the wells of a 12-well plate pre-coated with Matrigel (Corning, catalog number 354277) and cultured with induction medium and expansion medium according to the instruction manual. The cell number was measured using a flow cytometer and trypan blue (0.4%), and the phenotype was verified by flow cytometry.

[0068] As Figures 9 to 11As shown, the results indicate that no obvious differences were observed between B23-iPSCs (i.e., B23 clones) and WT iPSCs throughout the differentiation process. The iMSCs derived from B23-iPSCs (i.e., B23-iMSCs) exhibited the characteristic morphology of MSCs and showed an amplification ability comparable to that of WT iMSCs. In addition, B23-iMSCs displayed a typical marker profile of MSCs. These results further demonstrate that after knocking out B2M / CIITA / CD54 / CD58 using the p4SG plasmid, the downstream applications of 4SG iPSCs were not affected, proving the low toxicity of the 4 sgRNAs. Example 4: Detection of low immunogenicity of cells

[0069] Human primary T cells were isolated from healthy donors (Pan T Cell Isolation Kit, Miltenyi Biotec, Germany; 130-096-535) and amplified using Dynabeads anti-CD3 / CD28 (Gibco, catalog number 11161D) and IL-2 (200 IU / mL) (for the specific procedure, refer to the existing technical literature "Q. Hu, Y. Zhang, P. Wang, M. Zhou, Z. Hu, C. Liu, M. Liu, L. Wu, X. Liu, D. Liang, IL-24 armored CAR19-T cells show enhanced antitumor activity and persistence, Signal Transduct Target Ther, 6 (2021) 14"). In this example, T cells and NK-92 cells were used as effectors, iMSCs as targets, and co-cultured with effectors at a designed ratio. For apoptosis analysis, all cells were collected and stained with AnnexinV and Zombie NIR (Biolegend) in 1x Annexin V staining buffer. After incubation at room temperature for 30 minutes, the cells were analyzed on a Cytek NL-CLC. And the cell status was monitored and recorded through an EVOS M5000 imaging system under a 4x objective lens (Thermo Fisher).

[0070] As Figures 12 - 13As shown, B23 iMSCs exhibit increased resistance to T cells and NK cells. In other words, the possibility of being recognized and killed by T cells and NK cells is reduced. During co-culture, B23 iMSCs showed significantly increased tolerance to T cells and NK cells compared to WT iMSCs, demonstrating significantly lower immunogenicity. In addition, during a 7-day long-term co-culture, it was observed that B23-iMSCs could maintain nearly 100% confluence when co-existing with NK cells (co-cultured at a ratio of 1:1), while WT iMSCs could not ( Figure 14 ). Allogeneic cells are recognized and eliminated by the recipient's immune system, which hinders the long-term survival of therapeutic cells and thus weakens the efficacy of cell therapy. The experimental results in this example showed that the simultaneous deletion of B2M / CIITA / CD54 / CD58 effectively enhanced the resistance of allogeneic mesenchymal stem cells to T cells and NK cells, especially reversing the sensitivity to NK cells in the context of HLA deficiency. This has important implications for allogeneic applications and further promotes the development of truly universal iMSCs.

[0071] In summary, although MSCs themselves have the characteristic of low immunogenicity, which is conducive to their application in gene / cell therapy, the problem of rejection between allogeneic cells results in a short effective time, thus greatly increasing their drug cost, which is still one of the reasons hindering the widespread use of MSCs. In the specific implementation of the present invention, the inventors first knocked out four genes, B2M / CIITA / CD54 / CD58, in MSCs, greatly improving the immune tolerance of the cells to T cells and NK cells, having significantly improved lower immunogenicity, and still being able to maintain a confluence of nearly 100% after 7 days of co-culture with NK cells, showing significant survival persistence.

[0072] In addition, in the embodiments of the present invention, the sequences GGCCGAGATGTCTCGCTCCG in the B2M locus, GCTGAACTGGTCGCAGTTGA in the CIITA locus, CGGGCTGTTCCCAGTCTCGG in the CD54 locus, and AAGCAATGTGCCTTTAAAAG in the CD58 locus are selected as the target binding sequences of the CRISPR / Cas gene editing tool for editing and knockout, achieving high editing efficiency, ensuring sufficient safety, not generating other defects in the genome of the edited cells, and not affecting their subsequent performance. Further, in order to achieve lower toxicity and higher target binding ability, the sgRNAs for editing the above four loci are all selected with mismatch-free design and are all composed of 20 bases. Optionally, the 4 sgRNAs can be used by fusing them in the same plasmid, or directly using the 4 sgRNAs, both of which can achieve the purpose of the present invention. In summary, a series of gene editing events are integrated into one round in the specific implementation manner of the present invention, and then iMSCs with low immunogenicity are prepared, with a simpler process and lower cost, which provides a new feasible way for exploring a general allogeneic cell therapy method.

[0073] All publications and patents mentioned in this application are incorporated herein by reference. Various modifications and variations of the methods and compositions of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention has been described by specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to these specific embodiments. In fact, various variations of the described modes for carrying out the invention that are obvious to those skilled in the relevant art are intended to be included within the scope of the appended claims.

Claims

1. An engineered cell with low immunogenicity, wherein the expression levels of the B2M gene, CIITA gene, CD54 gene, and CD58 gene in the cell are lower than those of wild-type cells or not expressed.

2. The cell according to claim 1, wherein the cell is selected from induced pluripotent stem cells and their derivative cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells, NK cells, T cells, or pancreatic islet cells and retinal pigment epithelial cells.

3. The cell according to claim 2, wherein the derivative cells of the induced pluripotent stem cells are T cells, NK cells, B cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells, or retinal pigment epithelial cells differentiated from the induced pluripotent stem cells, preferably mesenchymal stem cells.

4. The cell according to any one of claims 1 to 3, wherein the B2M gene, CIITA gene, CD54 gene, and CD58 gene are modified, preferably, the modification is carried out by gene editing, and the target binding sequences of the gene editing are respectively: the sequence GGCCGAGATGTCTCGCTCCG (SEQ ID NO:1) in the B2M gene or its complementary sequence, the sequence GCTGAACTGGTCGCAGTTGA (SEQ ID NO:2) in the CIITA gene or its complementary sequence, the sequence CGGGCTGTTCCCAGTCTCGG (SEQ ID NO:3) in the CD54 gene or its complementary sequence, and the sequence AAGCAATGTGCCTTTAAAAG (SEQ ID NO:4) in the CD58 gene or its complementary sequence.

5. A method for preparing the cell according to any one of claims 1 to 4, comprising the step of gene editing the cell, and the gene editing is CRISPR / Cas gene editing.

6. The method according to claim 5, wherein the gene editing simultaneously edits the B2M gene, CIITA gene, CD54 gene, and CD58 gene, and the editing is carried out only once.

7. The method according to claim 6, wherein the target sequences of the gene editing are respectively: the sequence GGCCGAGATGTCTCGCTCCG (SEQ ID NO:1) in the B2M gene or its complementary sequence, the sequence GCTGAACTGGTCGCAGTTGA (SEQ ID NO:2) in the CIITA gene or its complementary sequence, the sequence CGGGCTGTTCCCAGTCTCGG (SEQ ID NO:3) in the CD54 gene or its complementary sequence, and the sequence AAGCAATGTGCCTTTAAAAG (SEQ ID NO:4) in the CD58 gene or its complementary sequence.

8. The method according to claim 7, comprising a vector construction step, wherein the vector expresses sgRNA1 GGCCGAGATGTCTCGCTCCG (SEQ ID NO:1) targeting the B2M gene, sgRNA2 GCTGAACTGGTCGCAGTTGA (SEQ ID NO:2) targeting the CIITA gene, sgRNA3 CGGGCTGTTCCCAGTCTCGG (SEQ ID NO:3) targeting the CD54 gene, and sgRNA4 AAGCAATGTGCCTTTAAAAG (SEQ ID NO:4) targeting the CD58 gene.

9. A CRISPR / Cas gene editing system for simultaneously editing multiple gene loci, comprising a Cas protein and sgRNAs, wherein the sgRNAs include sgRNA1, sgRNA2, sgRNA3, and sgRNA4.

10. The gene editing system according to claim 9, wherein the Cas protein is selected from Cas9, Cas12, Cas13, and Cas14, preferably Cas9 protein.

11. The gene editing system according to claim 9 or 10, wherein the sgRNA1, sgRNA2, sgRNA3, and sgRNA4 are specific sgRNAs targeting target sequences in the B2M gene, CIITA gene, CD54 gene, and CD58 gene, respectively.

12. The gene editing system according to claim 11, wherein the target sequences are respectively: the GGCCGAGATGTCTCGCTCCG sequence (SEQ ID NO:1) or its complementary sequence in the B2M gene, the GCTGAACTGGTCGCAGTTGA sequence (SEQ ID NO:2) or its complementary sequence in the CIITA gene, the CGGGCTGTTCCCAGTCTCGG sequence (SEQ ID NO:3) or its complementary sequence in the CD54 gene, and the AAGCAATGTGCCTTTAAAAG sequence (SEQ ID NO:4) or its complementary sequence in the CD58 gene.

13. The gene editing system according to claim 12, wherein the sgRNAs are respectively sgRNA1 GGCCGAGATGTCTCGCTCCG (SEQ ID NO:1), sgRNA2 GCTGAACTGGTCGCAGTTGA (SEQ ID NO:2), sgRNA3 CGGGCTGTTCCCAGTCTCGG (SEQ ID NO:3), and sgRNA4 AAGCAATGTGCCTTTAAAAG (SEQ ID NO:4).

14. A vector or vector system based on the CRISPR / Cas gene editing system according to claim 9, which expresses Cas protein and sgRNA, and the sgRNA includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4.

15. The vector or vector system according to claim 14, wherein the sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are respectively specific sgRNAs targeting target sequences in the B2M gene, target sequences in the CIITA gene, target sequences in the CD54 gene and target sequences in the CD58 gene.

16. The vector or vector system according to claim 15, wherein the sgRNAs are respectively sgRNA1 GGCCGAGATGTCTCGCTCCG (SEQ ID NO:1), sgRNA2 GCTGAACTGGTCGCAGTTGA (SEQ ID NO:2), sgRNA3 CGGGCTGTTCCCAGTCTCGG (SEQ ID NO:3) and sgRNA4 AAGCAATGTGCCTTTAAAAG (SEQ ID NO:4).

17. A method for simultaneous editing of multiple genes, which uses the gene editing system according to any one of claims 9 to 13 or the vector or vector system according to any one of claims 14 to 16.

18. A composition comprising the cell according to any one of claims 1 to 4, the cell prepared by the method according to any one of claims 5 to 8, the gene editing system according to any one of claims 9 to 13 or the vector or vector system according to any one of claims 14 to 16.

19. Application of the gene editing system according to any one of claims 9 to 13 or the vector or vector system according to any one of claims 14 to 16 in the preparation of engineered cells.

20. The application according to claim 19, wherein the cells are selected from induced pluripotent stem cells and their derivative cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells, NK cells, T cells or islet cells and retinal pigment epithelial cells.

21. The application according to claim 20, wherein the derivative cells of the induced pluripotent stem cells are T cells, NK cells, B cells, mesenchymal stem cells, endothelial cells, hepatocytes, cardiomyocytes, neuronal cells or retinal pigment epithelial cells differentiated from the induced pluripotent stem cells, preferably mesenchymal stem cells.

Images