Small heat shock protein RpHsp22.6 of apis cerana and application of small heat shock protein RpHsp22.6

By targeting the RpHsp22.6 gene of the syringae, dsRNA was used to reduce its survival rate and egg spawn rate, solving the problem of difficult to effectively prevent and control the pests of the syringae in the prior art, and achieving effective reduction of soybean syndrome.

CN120118907AActive Publication Date: 2025-06-10NINGBO UNIV

Patent Information

Application Number
CN202510601765.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-06-10
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively and environmentally friendly to prevent and control pests of the bee bee bee bee bee bee bee bee bee bee bee bee bee bee bee bee production and quality.

Method used

By targeting the RpHsp22.6 gene of the dotsp22.6 gene, dsRNA specifically inhibits the expression of the RpHsp22.6 gene was designed and synthesized, and fed or injected into the dotsp33.1 to reduce its survival and egg laying rate.

Benefits of technology

It significantly reduces the survival rate and egg laying rate of the squamous beebug, provides an effective and environmentally friendly prevention and treatment method, and reduces the severity of soybean syndrome.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118907A_ABST
    Figure CN120118907A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering and agricultural biology, and provides application of dsRNA for specifically inhibiting RpHsp22.6 gene expression in preparation of insecticides, and the nucleotide sequence of the dsRNA is shown as SEQ ID NO.12. The invention further provides a preparation method of the dsRNA. The invention also provides a method for relieving soybean blue syndrome and provides a small heat shock protein RpHsp22.6 of Emblycoris lividipennis. According to the invention, the problem of how to more effectively and more environmentally prevent and treat the plant diseases and insect pests of the Adelphocoris indica is solved, and the effect of reducing the pathogenicity of the Adelphocoris indica to the soybeans is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the field of genetic engineering and agricultural biotechnology, and in particular to use of dsRNA for specifically inhibiting the expression of RpHsp22.6 gene in preparing insecticides. Background Art

[0002] Soybeans have high nutritional value and are a very high-quality source of plant protein. They are also rich in unsaturated fatty acids, vitamins and dietary fiber. They are important oil crops and sources of plant protein. At the same time, they are also high-protein crops for both food and feed and important industrial raw materials. The specific manifestation of soybean "greening syndrome" is that in the late growth period of soybean plants, the leaves remain dark green, the stems are straight, many branches may grow, there are fewer flowers, and the flowering period is longer than that of normal plants. In the later stage, soybeans have fewer pods, wrinkled fruits in the pods, and shrunken pods, and the quality is greatly reduced. The pods cannot swell normally or do not swell at all, resulting in empty pods, including "greedy green sterility", "young pods", and "pods without fruit". Once "greening syndrome" occurs, it will lead to a reduction in soybean production or even a total loss, which will reduce the production enthusiasm of growers and seriously hinder the revitalization of the soybean industry. Therefore, the prevention and control of soybean "greening syndrome" is urgent.

[0003] Riptortus pedestris belongs to the class Insecta, order Hemiptera, and suborder Heteroptera. It is widely distributed and is the main agricultural pest of leguminous plants. Riptortus pedestris is a polyphagous insect that obtains nutrients and water by inserting its piercing-sucking mouthparts directly into plant tissues such as leaves, stems, flowers, pods, and seeds. This feeding can cause partial necrosis of plant tissues and infection with pathogens, resulting in a significant decrease in the yield and quality of agricultural products. Many studies have shown that Riptortus pedestris is one of the main causes of soybean greening syndrome (commonly known as "greening syndrome"). At present, the prevention and control of Riptortus pedestris is mainly divided into agricultural prevention and control and chemical prevention. Agricultural prevention and control has certain limitations in application, and has the disadvantages of strong regionality and seasonality, slow prevention and control, and inability to quickly control outbreaks of diseases, insects, and weeds. Chemical prevention is prone to pesticide damage, especially long-term application of a drug can make diseases and insects resistant to the drug, pollute the environment, and kill natural enemies. At the same time, pesticide residues may also cause damage to food security.

[0004] RNA interference (RNAi), as a defense mechanism in eukaryotes, plays a crucial role in plant growth and development and host antiviral defense. It specifically degrades or inhibits the expression of target gene mRNA by exogenously introducing small double-stranded RNAs approximately 20-25 nt in size, thereby reducing or shutting off the expression level of specific genes. RNAi has the advantages of high specificity, simplicity of operation, and high efficiency, and has broad application prospects. In subsequent experiments, it was found that the RNAi effect could also be induced in various insects by feeding, injecting, or spraying exogenously synthesized double-stranded RNA (dsRNA). Since then, RNAi technology has opened up new avenues in plant protection. In recent years, some researchers have used the RNA interference technology to conduct related functional studies with Riptortus pedestris as the experimental material. For example, the Nan team studied the interaction between chemosensory proteins (CSPs) and host plant volatiles in Riptortus pedestris (Gu N et al, 2024), and the DesMarteaux team studied the role of vesicular glutamate transporters in photoperiod regulation. Under RNAi interference, it can promote ovarian development (Lauren Des Marteaux et al, 2021). However, these studies are more focused on the mechanistic exploration of the action mechanism and have limited application.

[0005] Therefore, in the field of soybean cultivation, there is an urgent need for more effective and environmentally friendly methods to control the pests and diseases of Riptortus pedestris. Summary of the Invention

[0006] The technical problem to be solved by the present invention is how to more effectively and environmentally friendly control the pests and diseases of Riptortus pedestris.

[0007] Based on the above technical problems, the present invention targets the small heat shock protein 22.6 (RpHsp22.6) essential for the survival of Riptortus pedestris to establish an RNA interference system for Riptortus pedestris and an RpHsp22.6 gene mutant, providing a sequence and data basis for the control of Riptortus pedestris.

[0008] The technical solution adopted by the present invention to solve its technical problems is to provide a small heat shock protein RpHsp22.6 of Riptortus pedestris. The nucleotide sequence encoding the small heat shock protein RpHsp22.6 is as shown in SEQ ID NO.1 or a nucleotide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity with SEQ ID NO.1 or composed of the same. The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0009] ATGACCAGAAACAGCCTTATAGAATTGTGCAGTGCTGTTGTGCGCAATCTGGGGAAACAAACAAGAATTTCCAGTAATTACAAAGAAGTAACCCAGAAACCCACTAACTCAGGATTCATCTTCGACCCAGCTTCAAGTACAGCTCTGCAAAGTAGTGGGAAGGTCTTGCAAGAATGTGGCAATCTAAATGCACGCTTCGATACTCCTTCTCTCTCCTCATCCAGCCTGGCTTTTCTCGACAGAACAAGGATTGGAGATATATTGCTAAAGCCGCTCCAAGTCATGGACTCGACTGAAAGGACATCTTCAAATTTCTCTGTGGAATACTCGGATAAAGGAATGGTTGTAGAAATAGAGATGAAAGGCTACAAGGAGGAAGATGTTAGCGTGAGAGTTGACGGCCCATGGCTGGTGATTGAAGGCAACATGACCACCCATGTTCCTGACAAGGAAGGAGGAGGGCTCATGATCCGCAATACCGTCAGGAGGTACGAAATACCGCCCAATTCGGATGTAGCCAACATCAAAATGAAGTTCAAGAACGAGCGACTCACAGTAACCGTACCTACACTCAGCCCCACTGTAAGTATACATTTTGGCATTTGTGTTACTTAA。

[0010] On the other hand, the present invention relates to a Riptortus pedestris small heat shock protein RpHsp22.6, whose amino acid sequence is the amino acid shown in SEQ ID NO.2 or an amino acid having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity with the amino acid shown in SEQ ID NO.2 or composed of the same. The amino acid sequence shown in SEQ ID NO.2 is as follows:

[0011] MTRNSLIELCSAVVRNLGKQTRISSNYKEVTQKPTNSGFIFDPASSTALQSSGKVLQECGNLNARFDTPSLSSSSLAFLDRTRIGDILLKPLQVMDSTERTSSNFSVEYSDKGMVVEIEMKGYKEEDVSVRVDGPWLVIEGNMTTHVPDKEGGGLMIRNTVRRYEIPPNSDVANIKMKFKNERLTVTVPTLSPTVSIHFGICVT。

[0012] On the other hand, the present invention relates to a method for preparing the foregoing secreted protein RpHsp22.6 of Riptortus pedestris, comprising the following steps:

[0013] 1. Extraction of total RNA from whole Riptortus pedestris;

[0014] 1) Take adult or nymph Riptortus pedestris and put it into 1 mL of Trizol reagent for thorough grinding;

[0015] 2) Subsequently, add 400 μL of chloroform, mix vigorously and let stand on ice for 8 - 10 min;

[0016] 3) Centrifuge at 12000 rpm at 4°C for 20 min, carefully transfer the upper aqueous phase to a new 1.5 mL centrifuge tube free of RNase;

[0017] 4) Add an equal volume of isopropanol, invert and mix well, and place at -20°C for 2 h to precipitate RNA;

[0018] 5) After taking out, centrifuge at 12000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 12000 rpm at 4°C for 5 min and discard the supernatant, and repeat the above washing steps twice;

[0019] 6) Let stand on ice for 5 min to volatilize ethanol;

[0020] 7) Add 30 μL of RNase-free water, let stand at 4°C for 2 h to dissolve, and measure the RNA concentration with NanoDrop;

[0021] 2. Synthesis of Riptortus pedestris cDNA and acquisition of gene fragments;

[0022] 1) Reverse transcribe the total RNA obtained by the foregoing method for extracting total RNA from whole Riptortus pedestris to obtain Riptortus pedestris cDNA;

[0023] 2) Design the following primers according to the full-length RpHsp22.6 gene sequence (direction: 5’-3’):

[0024] RpHsp22.6-F: ATGACCAGAAACAGCCTTATAGAATTG (SEQ ID NO.4),

[0025] RpHsp22.6-R: TTAAGTAACACAAATGCCAAAATGTAT (SEQ ID NO.5);

[0026] 3) Using the obtained cDNA as a template, and using the aforementioned primers, perform PCR amplification on the target gene;

[0027] 4) Separate the above PCR amplification products by 1% agarose gel electrophoresis, and use a DNA agarose gel recovery kit to recover the target DNA;

[0028] 5) Ligate the purified DNA fragment of the RpHsp22.6 gene of Riptortus pedestris to the blunt-end cloning vector pEASY ® -Blunt, transform it into the Escherichia coli competent cell Trans1-T1, and culture it on an LB solid medium containing kanamycin to obtain monoclonal colonies containing the gene fragment;

[0029] 6) Pick monoclonal colonies and perform large-scale culture in an LB liquid medium containing kanamycin, extract plasmids, and obtain the nucleotide sequence of the RpHsp22.6 gene of Riptortus pedestris. The obtained sequence is shown in SEQ ID NO.1.

[0030] On the other hand, the present invention relates to a method for synthesizing dsRNA of the RpHsp22.6 gene, and the specific steps include:

[0031] 1) Using the dsRpHsp22.6 gene fragment containing the T7 promoter shown in SEQ ID NO.3 as a template to synthesize dsRNA. The reaction system is: 2 μL of 10× reaction buffer, 2 μL of ATP solution, 2 μL of UTP solution, 2 μL of CTP solution, 2 μL of GTP solution, 2 μL of T7 RNA polymerase, 1 μg of DNA template, and make up to 20 μL with RNase-free water. Mix well and react at 37°C for 8 h;

[0032] 2) Add 1 μL of DNase to the reaction system to eliminate the DNA in the system, and react at 37°C for 15 min to obtain dsRNA;

[0033] 3) Take a part of the reacted sample and denature it at 65°C for 5 min;

[0034] 4) Measure the concentration of dsRNA with Nanodrop, and determine the quality of dsRNA by 1% agarose gel electrophoresis;

[0035] 5) Store the remaining dsRNA at -80 °C for future use.

[0036] In another aspect, the present invention relates to a method for controlling Riptortus pedestris, which comprises feeding or injecting dsRNA that specifically inhibits the expression of the RpHsp22.6 gene into Riptortus pedestris, and the dsRNA is obtained through the above steps.

[0037] In another aspect, the present invention also relates to a method for alleviating soybean sudden death syndrome, which includes spraying exogenous synthetic dsRNA with the nucleotide sequence shown in SEQ ID NO.12 on the leaves of field crops.

[0038] Compared with the prior art, the present invention has the following beneficial effects: the dsRNA of the present invention can effectively reduce the survival rate of Riptortus pedestris and significantly reduce the oviposition rate of Riptortus pedestris, providing an effective method for controlling Riptortus pedestris and being able to alleviate soybean sudden death syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Comparative diagram of the results of the effect of dsRNA treatment on the survival rate of Riptortus pedestris.

[0040] Figure 2 : Schematic diagram of the results of the silencing efficiency of dsRNA on the RpHsp22.6 gene.

[0041] Figure 3 : Schematic diagram of the results of the effect of dsRNA treatment on the oviposition rate of Riptortus pedestris. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0042] Example 1: Cloning of the RpHsp22.6 gene of Riptortus pedestris

[0043] (1) Extraction of total RNA from whole Riptortus pedestris

[0044] 1) Take adult or nymph Riptortus pedestris and put it into 1 mL of Trizol (Aikerui Biology, product number: AG21101) reagent and grind it thoroughly.

[0045] 2) Then add 400 μL of chloroform, mix vigorously and let it stand on ice for 8 - 10 min.

[0046] 3) Centrifuge at 12000 rpm at 4 °C for 20 min, and carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free centrifuge tube.

[0047] 4) Add an equal volume of isopropanol, invert and mix well, and place it at -20 °C for 2 h to precipitate RNA.

[0048] 5) Centrifuge at 12,000 rpm for 10 min after taking out. After discarding the supernatant, add 1 mL of 75% ethanol to the precipitate to wash the precipitate, centrifuge at 12,000 rpm at 4°C for 5 min, and discard the supernatant. Repeat the above washing steps twice.

[0049] 6) Let it stand on ice for 5 min to volatilize ethanol.

[0050] 7) Add 30 μL of RNase-free water, let it stand at 4°C for 2 h to dissolve, and measure the RNA concentration with NanoDrop.

[0051] (2)Synthesis of cDNA of Riptortus pedestris and acquisition of monoclonal strains of RpHsp22.6 gene

[0052] 1) Reverse transcribe the total RNA obtained by the above-mentioned method for extracting total RNA of whole Riptortus pedestris to obtain Riptortus pedestris cDNA.

[0053] 2) Design primers as follows according to the full-length sequence of the RpHsp22.6 gene (direction: 5’-3’), and the primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.:

[0054] RpHsp22.6-F: ATGACCAGAAACAGCCTTATAGAATTG (SEQ ID NO.4),

[0055] RpHsp22.6-R: TTAAGTAACACAAATGCCAAAATGTAT (SEQ ID NO.5).

[0056] 3) Using the obtained cDNA as a template, use the above primers to perform PCR amplification on the target gene. The PCR reaction system is as follows: 1 μL of Riptortus pedestris cDNA, 1.5 μL of each upstream and downstream primer, 1 μL of Phanta® Max Super-Fidelity DNA polymerase, 25 μL of 2 × Phanta® Max buffer, 1 μL of dNTP Mix (10 mM each), and finally use ddH 2 O to make up the reaction system to 50 μL.

[0057] The PCR reaction program is as follows: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 60 s, 35 cycles; 72°C, 10 min.

[0058] 4) Use 1% agarose gel electrophoresis to separate the above PCR amplification products, and use a DNA agarose gel recovery kit (Sangon Biotech, Shanghai, SK8131) to recover the target DNA.

[0059] 5) Ligate the purified DNA fragment of the RpHsp22.6 gene of Riptortus pedestris to the blunt-end cloning vector pEASY ® -Blunt (TransGen), transform it into the competent cells of Escherichia coli Trans1-T1, and culture it on the LB solid medium containing kanamycin to obtain monoclonal colonies containing the gene fragment.

[0060] 6) Pick monoclonal colonies and culture them in an enlarged manner in the LB liquid medium containing kanamycin, extract the plasmid, name it pEASY-RpHsp22.6, send it to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, obtain the 615 bp RpHsp22.6 sequence of Riptortus pedestris, and the obtained sequence is shown in SEQ ID NO.1.

[0061] Example 2: Synthesis of dsRNA of the RpHsp22.6 gene of Riptortus pedestris

[0062] (1) T7 primer PCR amplification and purification

[0063] 1) Using the pEASY-RpHsp22.6 plasmid as a template, amplify the target gene using primers with the following sequences containing the T7 promoter sequence (5'-3'), and the primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0064] The amplification reaction system and procedure are the same as above.

[0065] dsRpHsp22.6-F: taatacgactcactatagggCCACTAACTCAGGATTCATCTTC (SEQ IDNO.6),

[0066] dsRpHsp22.6-R: taatacgactcactatagggGTGTAGGTACGGTTACTGTGAG (SEQ IDNO.7).

[0067] 2) Separate the amplification product by agarose gel electrophoresis and recover it using a DNA agarose gel recovery kit to finally obtain a large amount of single dsRpHsp22.6 gene fragment containing the T7 promoter. The obtained sequence is shown in SEQ ID NO.3:

[0068] CCACTAACTCAGGATTCATCTTCGACCCAGCTTCAAGTACAGCTCTGCAAAGTAGTGGGAAGGTCTTGCAAGAATGTGGCAATCTAAATGCACGCTTCGATACTCCTTCTCTCTCCTCATCCAGCCTGGCTTTTCTCGACAGAACAAGGATTGGAGATATATTGCTAAAGCCGCTCCAAGTCATGGACTCGACTGAAAGGACATCTTCAAATTTCTCTGTGGAATACTCGGATAAAGGAATGGTTGTAGAAATAGAGATGAAAGGCTACAAGGAGGAAGATGTTAGCGTGAGAGTTGACGGCCCATGGCTGGTGATTGAAGGCAACATGACCACCCATGTTCCTGACAAGGAAGGAGGAGGGCTCATGATCCGCAATACCGTCAGGAGGTACGAAATACCGCCCAATTCGGATGTAGCCAACATCAAAATGAAGTTCAAGAACGAGCGACTCACAGTAACCGTACCTACAC。

[0069] (2) Synthesis and purification of dsRNA of dsRpHsp22.6 gene

[0070] The dsRNA of dsRpHsp22.6 gene was synthesized and purified using the T7 High Yield RNA Transcription Kit of Novoprotein Biotechnology Co., Ltd. The specific method is as follows:

[0071] 1) Using the aforementioned dsRpHsp22.6 gene fragment containing the T7 promoter obtained by PCR amplification as a template to synthesize dsRNA. The reaction system is: 2 μL of 10× reaction buffer, 2 μL of ATP solution, 2 μL of UTP solution, 2 μL of CTP solution, 2 μL of GTP solution, 2 μL of T7 RNA polymerase, 1 μg of DNA template, and made up to 20 μL with RNase-free water. Mix well and react at 37°C for 8 h.

[0072] 2) Add 1 μL of DNase to the reaction system to eliminate the DNA in the system, and react at 37°C for 15 min to obtain dsRNA.

[0073] 3) Take a part of the reacted sample and denature it at 65°C for 5 min.

[0074] 4) Measure the concentration of dsRNA with Nanodrop and determine the quality of dsRNA by 1% agarose gel electrophoresis.

[0075] 5) Store the remaining dsRNA at -80 °C for future use.

[0076] The dsRNA sequence is shown in SEQ ID NO.12:

[0077] CCACUAACUCAGGAUUCAUCUUCGACCCAGCUUCAAGUACAGCUCUGCAAAGUAGUGGGAAGGUCUUGCAAGAAUGUGGCAAUCUAAAUGCACGCUUCGAUACUCCUUCUCUCUCCUCAUCCAGCCUGGCUUUUCUCGACAGAACAAGGAUUGGAGAUAUAUUGCUAAAGCCGCUCCAAGUCAUGGACUCGACUGAAAGGACAUCUUCAAAUUUCUCUGUGGAAUACUCGGAUAAAGGAAUGGUUGUAGAAAUAGAGAUGAAAGGCUACAAGGAGGAAGAUGUUAGCGUGAGAGUUGACGGCCCAUGGCUGGUGAUUGAAGGCAACAUGACCACCCAUGUUCCUGACAAGGAAGGAGGAGGGCUCAUGAUCCGCAAUACCGUCAGGAGGUACGAAAUACCGCCCAAUUCGGAUGUAGCCAACAUCAAAAUGAAGUUCAAGAACGAGCGACUCACAGUAACCGUACCUACAC.

[0078] Example 3: Effect of dsRNA of RpHsp22.6 gene introduced into Riptortus pedestris on insect survival rate

[0079] (1) Inject dsRNA by microinjection

[0080] 1) Prepare the injection solution with RNase-free water and dilute the dsRNA synthesized in Example 2 to a final concentration of 4000 ng / mL.

[0081] 2) Select 3rd instar nymphs of Riptortus pedestris and introduce dsRNA into the body of Riptortus pedestris under a stereomicroscope using a microinjector. The parameters of the microinjector are set as follows: injection pressure 1300 pa, injection time 0.3 s, and compensation pressure 10 pa.

[0082] 3) Use the same method to introduce dsRNA of jellyfish green fluorescent protein gene (GFP) into the body of Riptortus pedestris as a negative control.

[0083] (2)Effect of injecting dsRNA of dsRpHsp22.6 gene on the survival rate of Riptortus pedestris

[0084] 1) Transfer the Riptortus pedestris injected with dsRNA to soybean plants. Put 10 Riptortus pedestris in each group of soybeans, with 3 replicates. Count the mortality rate daily. The rearing conditions of Riptortus pedestris are: temperature 26°C ± 0.5°C, relative humidity 50% ± 5%, and photoperiod 16 h: 8 h (day: night).

[0085] 2) The experimental results are as Figure 1 shown. The survival rate of Riptortus pedestris injected with dsRNA of dsRpHsp22.6 gene (dsRpHsp22.6) was significantly lower than that of the control (dsGFP), indicating that dsRNA of dsRpHsp22.6 gene has potential application value for the control of Riptortus pedestris.

[0086] Example 4: Silencing efficiency of dsRpHsp22.6 introduced into Riptortus pedestris on RpHsp22.6 gene

[0087] Collect Riptortus pedestris on the 3rd day after injecting dsRpHsp22.6 and measure the expression level of dsRpHsp22.6 gene. The specific method is as follows:

[0088] 1) Grind the collected Riptortus pedestris, extract total RNA by Trizol method, and reverse transcribe to obtain cDNA of Riptortus pedestris.

[0089] 2) Use the online software Primer Primer 3.0 to design quantitative primers for the RpHsp22.6 gene of Riptortus pedestris. The sequences are as follows (5'-3'), and the primers are synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0090] qRpHsp22.6-F: ATGACCACCCATGTTCCTGA (SEQ ID NO.8),

[0091] qRpHsp22.6-R: TGTAGGTACGGTTACTGTGAG (SEQ ID NO.9),

[0092] qRpGAPDH-F: CTGTTGTAGACCTCACTGTT (SEQ ID NO.10),

[0093] qRpGAPDH-R: ATATCCGCACTCATTGTCAT (SEQ ID NO.11).

[0094] 3) Using the cDNA of Riptortus pedestris as a template, the expression level of the RpHsp22.6 gene was detected by fluorescence quantitative PCR (qRT-PCR) using the aforementioned primers. The GAPDH gene of Riptortus pedestris was used as an internal reference, and the relative expression level of the RpHsp22.6 gene in Riptortus pedestris was calculated using the 2-ΔΔCt method to evaluate the gene silencing efficiency of RpHsp22.6. The significance of differences between different treatment groups was tested by Student's t-test.

[0095] The qRT-PCR reaction system was as follows: 10 μL: 1.5 μg of cDNA, 0.3 μL of each of the upstream and downstream primers at 10 μmol / L, 5 μL of SYBRqPCR Master Mix, and ddH 2 O was supplemented to 10 μL.

[0096] The qRT-PCR reaction program was: 95°C for 3 min; 95°C for 15 s, 60°C for 15 s, 72°C for 20 s, for 40 cycles.

[0097] The experimental results were as Figure 2 shown. The expression level of the RpHsp22.6 gene in Riptortus pedestris injected with dsRpHsp22.6 was significantly lower than that of the control, indicating that the dsRNA of the RpHsp22.6 gene had a high gene silencing efficiency on the RpHsp22.6 gene of Riptortus pedestris.

[0098] Example 5: Effect of dsRNA of the RpHsp22.6 gene introduced into Riptortus pedestris on the insect oviposition rate

[0099] (1) Injecting dsRNA by microinjection

[0100] 1) Prepare the injection solution using RNase-free water and dilute the previously synthesized dsRNA to a final concentration of 4000 ng / mL.

[0101] 2) Select the 5th instar nymphs of Riptortus pedestris. Using a microinjector, introduce dsRNA into the body of Riptortus pedestris under a stereomicroscope. The parameters of the microinjector were set as follows: injection pressure 1300 pa, injection time 0.3 s, and compensation pressure 10 pa.

[0102] 3) Using the same method, introduce dsRNA of the green fluorescent protein gene (GFP) of jellyfish into the body of Riptortus pedestris as a negative control.

[0103] (2) Effect of injecting dsRNA of the RpHsp22.6 gene on the survival rate of Riptortus pedestris

[0104] 1) Move the Riptortus pedestris into which dsRNA has been introduced to a culture cup, and place one pair of newly emerged adult Riptortus pedestris in each culture cup. Conduct 20 replicates, and after 15 days, count the oviposition rate. The rearing conditions for Riptortus pedestris are as follows: temperature 26°C ± 0.5°C, relative humidity 50% ± 5%, and photoperiod 16 h: 8 h (day: night).

[0105] The experimental results are as Figure 3 shown: The oviposition rate of Riptortus pedestris into which dsRNA of the dsRpHsp22.6 gene has been introduced is significantly lower than that of the control (dsGFP), indicating that dsRNA of the dsRpHsp22.6 gene has potential application value for the control of Riptortus pedestris.

Claims

1. Use of a dsRNA that specifically inhibits the expression of the RpHsp22.6 gene in the preparation of an insecticide, wherein the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

12.

2. The use according to claim 1, characterized in that The preparation method of the dsRNA comprises the following steps: 1) synthesizing dsRNA using the dsRpHsp22.6 gene fragment containing the T7 promoter as shown in SEQ ID NO.3 as a template, mixing and then performing an amplification reaction; 2) Add DNase to eliminate DNA in the system; 3) Take part of the reacted samples for denaturation treatment; 4) Determine dsRNA concentration and determine dsRNA quality; 5) storing the dsRNA for future use.

3. A method for alleviating soybean greening, the method comprising spraying exogenously synthesized dsRNA containing the nucleotide sequence shown in SEQ ID NO.12 on the leaves of crops in the field.

4. A small heat shock protein RpHsp22.6 of the bee-margin bug, the nucleotide sequence encoding the small heat shock protein RpHsp22.6 is shown in SEQ ID NO.

1.

5. The small heat shock protein RpHsp22.6 according to claim 4, characterized in that The amino acid sequence of the small heat shock protein RpHsp22.6 is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Emblycoris indica synaptic fusion protein binding protein RpSDP and application thereof

    CN114507669A

  • Chitin synthase 1 (CHS1) gene of Embryonidae and application of chitin synthase 1 (CHS1) gene in aspect of RNAi (Ribonucleic Acid Interfere)-mediated pest control

    CN114854774A

  • Emblycoris indica secretory protein RpSP4043 and application thereof in prevention and control of soybean'disease green '

    CN115927357A

  • Reference gene combination stably expressed under different conditions for point bee bugs and application of reference gene combination

    CN116970710A

  • Non-ATP (adenosine triphosphate) enzyme regulation subunit RpRpn gene of 26S proteasome of Eriomycorus cerinus and application thereof

    CN118240849A

Cited By

  • Application of apis cerana secretory protein RpSP1834 and RNAi of apis cerana secretory protein RpSP1834 in prevention and control of soybean disease green disease

    CN120310799A

  • Saliva protein RP402 and application thereof as target spot in prevention and treatment of soybean green disease

    CN120365399A

  • Salivary protein RP402 from the bee stink bug and its application as a target in controlling soybean greening disease

    CN120365399B